Expression Profile of PIN-Formed Auxin Efflux Carrier Genes during IBA-Induced In Vitro Adventitious Rooting in Olea europaea L.
Abstract
1. Introduction
2. Results
2.1. Gene Expression Analysis
2.2. ROS Accumulation in Stem-Base Tissues
3. Discussion
4. Materials and Methods
4.1. Plant Material and In Vitro Rooting Trials
4.2. RNA Isolation and First-Strand cDNA Synthesis
4.3. Quantitative Real-Time PCR (qPCR)
4.4. Transcript Expression Analysis
4.5. Histochemical Detection of Reactive Oxygen Species (ROS)
4.6. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Tanaka, H.; Dhonukshe, P.; Brewer, P.B.; Friml, J. Spatiotemporal asymmetric auxin distribution: A means to coordinate plant development. Cell. Mol. Life Sci. C 2006, 63, 2738–2754. [Google Scholar] [CrossRef]
 - Teale, W.D.; Paponov, I.A.; Palme, K. Auxin in action: Signalling, transport and the control of plant growth and development. Nat. Rev. Mol. Cell Biol. 2006, 7, 847–859. [Google Scholar] [CrossRef] [PubMed]
 - Vanneste, S.; Friml, J. Auxin: A Trigger for Change in Plant Development. Cell 2009, 136, 1005–1016. [Google Scholar] [CrossRef] [PubMed]
 - Wolters, H.; Anders, N.; Geldner, N.; Gavidia, R.; Jurgens, G. Coordination of apical and basal embryo development revealed by tissue-specific GNOM functions. Development 2010, 138, 117–126. [Google Scholar] [CrossRef] [PubMed]
 - Swarup, R.; Kramer, E.M.; Perry, P.; Knox, K.; Leyser, H.M.O.; Haseloff, J.; Beemster, G.T.S.; Bhalerao, R.; Bennett, M.J. Root gravitropism requires lateral root cap and epidermal cells for transport and response to a mobile auxin signal. Nat. Cell Biol. 2005, 7, 1057–1065. [Google Scholar] [CrossRef]
 - Swarup, K.; Benková, E.; Swarup, R.; Casimiro, I.; Péret, B.; Yang, Y.; Parry, G.; Nielsen, E.; De Smet, I.; Vanneste, S.; et al. The auxin influx carrier LAX3 promotes lateral root emergence. Nat. Cell Biol. 2008, 10, 946–954. [Google Scholar] [CrossRef]
 - Overvoorde, P.; Fukaki, H.; Beeckman, T. Auxin control of root development. Cold Spring Harb. Perspect. Biol. 2010, 2, a001537. [Google Scholar] [CrossRef]
 - Lewis, D.R.; Negi, S.; Sukumar, P.; Muday, G.K. Ethylene inhibits lateral root development, increases IAA transport and expression of PIN3 and PIN7 auxin efflux carriers. Development 2011, 138, 3485–3495. [Google Scholar] [CrossRef]
 - Dubrovsky, J.G.; Sauer, M.; Napsucialy-Mendivil, S.; Ivanchenko, M.G.; Friml, J.; Shishkova, S.; Celenza, J.; Benková, E. Auxin acts as a local morphogenetic trigger to specify lateral root founder cells. Proc. Natl. Acad. Sci. USA 2008, 105, 8790–8794. [Google Scholar] [CrossRef]
 - Blakeslee, J.J. Relocalization of the PIN1 Auxin Efflux Facilitator Plays a Role in Phototropic Responses. Plant Physiol. 2004, 134, 28–31. [Google Scholar] [CrossRef]
 - Kimura, M.; Kagawa, T. Phototropin and light-signaling in phototropism. Curr. Opin. Plant Biol. 2006, 9, 503–508. [Google Scholar] [CrossRef]
 - Palme, K.; Dovzhenko, A.; Ditengou, F.A. Auxin transport and gravitational research: Perspectives. Protoplasma 2006, 229, 175–181. [Google Scholar] [CrossRef]
 - Zahir, Z.A.; Shah, M.K.; Naveed, M.; Akhter, M.J. Substrate-dependent auxin production by Rhizobium phaseoli improves the growth and yield of Vigna radiata L. under salt stress conditions. J. Microbiol. Biotechnol. 2010, 20, 1288–1294. [Google Scholar] [CrossRef]
 - Van Ha, C.; Le, D.T.; Nishiyama, R.; Watanabe, Y.; Sulieman, S.; Tran, U.T.; Mochida, K.; Van Dong, N.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; et al. The auxin response factor transcription factor family in soybean: Genome-wide identification and expression analyses during development and water stress. DNA Res. 2013, 20, 511–524. [Google Scholar] [CrossRef]
 - Min, L.; Li, Y.; Hu, Q.; Zhu, L.; Gao, W.; Wu, Y.; Ding, Y.; Liu, S.; Yang, X.; Zhang, X. Sugar and Auxin Signaling Pathways Respond to High-Temperature Stress during Anther Development as Revealed by Transcript Profiling Analysis in Cotton. Plant Physiol. 2014, 164, 1293–1308. [Google Scholar] [CrossRef]
 - Prusinkiewicz, P.; Crawford, S.; Smith, R.S.; Ljung, K.; Bennett, T.; Ongaro, V.; Leyser, O. Control of bud activation by an auxin transport switch. Proc. Natl. Acad. Sci. USA 2009, 106, 17431–17436. [Google Scholar] [CrossRef]
 - Leyser, O. The fall and rise of apical dominance. Curr. Opin. Genet. Dev. 2005, 15, 468–471. [Google Scholar] [CrossRef]
 - Bainbridge, K.; Guyomarc’h, S.; Bayer, E.; Swarup, R.; Bennett, M.; Mandel, T.; Kuhlemeier, C. Auxin influx carriers stabilize phyllotactic patterning. Genes Dev. 2008, 22, 810–823. [Google Scholar] [CrossRef]
 - Guenot, B.; Bayer, E.; Kierzkowski, D.; Smith, R.S.; Mandel, T.; Zadnikova, P.; Benkova, E.; Kuhlemeier, C. PIN1-Independent Leaf Initiation in Arabidopsis. Plant Physiol. 2012, 159, 1501–1510. [Google Scholar] [CrossRef]
 - van Noorden, G.E.; Kerim, T.; Goffard, N.; Wiblin, R.; Pellerone, F.I.; Rolfe, B.G.; Mathesius, U. Overlap of Proteome Changes in Medicago truncatula in Response to Auxin and Sinorhizobium meliloti. Plant Physiol. 2007, 144, 1115–1131. [Google Scholar] [CrossRef]
 - Reinhardt, D.; Mandel, T.; Kuhlemeier, C. Auxin Regulates the Initiation and Radial Position of Plant Lateral Organs. Plant Cell 2007, 12, 507. [Google Scholar] [CrossRef] [PubMed]
 - Reinhardt, D.; Pesce, E.-R.; Stieger, P.; Mandel, T.; Baltensperger, K.; Bennett, M.; Traas, J.; Friml, J.; Kuhlemeier, C. Regulation of phyllotaxis by polar auxin transport. Nature 2003, 426, 255–260. [Google Scholar] [CrossRef] [PubMed]
 - Heisler, M.G.; Ohno, C.; Das, P.; Sieber, P.; Reddy, G.V.; Long, J.A.; Meyerowitz, E.M. Patterns of auxin transport and gene expression during primordium development revealed by live imaging of the Arabidopsis inflorescence meristem. Curr. Biol. 2005, 15, 1899–1911. [Google Scholar] [CrossRef] [PubMed]
 - Woodward, A.W.; Bartel, B. Auxin: Regulation, action, and interaction. Ann. Bot. 2005, 95, 707–735. [Google Scholar] [CrossRef]
 - Zhao, Y. Auxin Biosynthesis and Its Role in Plant Development. Annu. Rev. Plant Biol. 2010, 61, 49–64. [Google Scholar] [CrossRef]
 - Zažímalová, E.; Křeček, P.; Skůpa, P.; Hoyerová, K.; Petrášek, J. Polar transport of the plant hormone auxin—The role of PIN-FORMED (PIN) proteins. Cell. Mol. Life Sci. 2007, 64, 1621–1637. [Google Scholar] [CrossRef]
 - Petrasek, J.; Friml, J. Auxin transport routes in plant development. Development 2009, 136, 2675–2688. [Google Scholar] [CrossRef]
 - Robert, H.S.; Friml, J. Auxin and other signals on the move in plants. Nat. Chem. Biol. 2009, 5, 325–332. [Google Scholar] [CrossRef] [PubMed]
 - Wabnik, K.; Kleine-Vehn, J.; Govaerts, W.; Friml, J. Prototype cell-to-cell auxin transport mechanism by intracellular auxin compartmentalization. Trends Plant Sci. 2011, 16, 468–475. [Google Scholar] [CrossRef]
 - Křeček, P.; Skůpa, P.; Libus, J.; Naramoto, S.; Tejos, R.; Friml, J.; Zažímalová, E. The PIN-FORMED (PIN) protein family of auxin transporters. Genome Biol. 2009, 10, 249. [Google Scholar] [CrossRef]
 - Xu, M.; Zhu, L.; Shou, H.; Wu, P. A PIN1 family gene, OsPIN1, involved in auxin-dependent adventitious root emergence and tillering in rice. Plant Cell Physiol. 2005, 46, 1674–1681. [Google Scholar] [CrossRef] [PubMed]
 - Zhou, J.-J.; Luo, J. The PIN-FORMED Auxin Efflux Carriers in Plants. Int. J. Mol. Sci. 2018, 19, 2759. [Google Scholar] [CrossRef] [PubMed]
 - Steffens, B.; Rasmussen, A. The Physiology of Adventitious Roots. Plant Physiol. 2016, 170, 603–617. [Google Scholar] [CrossRef] [PubMed]
 - Porfirio, S.; Calado, M.L.; Noceda, C.; Cabrita, M.J.; da Silva, M.G.; Azadi, P.; Peixe, A. Tracking biochemical changes during adventitious root formation in olive (Olea europaea L.). Sci. Hortic. 2016, 204, 41–53. [Google Scholar] [CrossRef]
 - Guan, L.; Murphy, A.S.; Peer, W.A.; Gan, L.; Li, Y.; Cheng, Z.M. (Max) Physiological and Molecular Regulation of Adventitious Root Formation. CRC Crit. Rev. Plant Sci. 2015, 34, 506–521. [Google Scholar] [CrossRef]
 - Porfírio, S.; Gomes da Silva, M.D.R.; Cabrita, M.J.; Azadi, P.; Peixe, A. Reviewing current knowledge on olive (Olea europaea L.) adventitious root formation. Sci. Hortic. 2016, 198, 207–226. [Google Scholar] [CrossRef]
 - Macedo, E.; Vieira, C.; Carrizo, D.; Porfírio, S.; Hegewald, H.; Arnholdt-Schmitt, B.; Calado, M.L.; Peixe, A. Adventitious root formation in olive (Olea europaea L.) microshoots: Anatomical evaluation and associated biochemical changes in peroxidase and polyphenoloxidase activities. J. Hortic. Sci. Biotechnol. 2013. [Google Scholar] [CrossRef]
 - Pacurar, D.I.; Perrone, I.; Bellini, C. Auxin is a central player in the hormone cross-talks that control adventitious rooting. Physiol. Plant. 2014, 151, 83–96. [Google Scholar] [CrossRef]
 - Pop, T.I.; Pamfil, D.; Bellini, C. Auxin control in the formation of adventitious roots. Not. Bot. Horti Agrobot. Cluj-Napoca 2011, 39, 307–316. [Google Scholar] [CrossRef]
 - Vidoz, M.L.; Loreti, E.; Mensuali, A.; Alpi, A.; Perata, P. Hormonal interplay during adventitious root formation in flooded tomato plants. Plant J. 2010, 63, 551–562. [Google Scholar] [CrossRef]
 - Ford, Y.Y.; Bonham, E.C.; Cameron, R.W.F.; Blake, P.S.; Judd, H.L.; Harrison-Murray, R.S. Adventitious rooting: Examining the role of auxin in an easy- and a difficult-to-root plant. Plant Growth Regul. 2002, 36, 149–159. [Google Scholar] [CrossRef]
 - Liu, S.; Wang, J.; Wang, L.; Wang, X.; Xue, Y.; Wu, P.; Shou, H. Adventitious root formation in rice requires OsGNOM1 and is mediated by the OsPINs family. Cell Res. 2009, 19, 1110–1119. [Google Scholar] [CrossRef] [PubMed]
 - Brinker, M. Microarray Analyses of Gene Expression during Adventitious Root Development in Pinus contorta. Plant Physiol. 2004, 135, 1526–1539. [Google Scholar] [CrossRef] [PubMed]
 - Arnholdt-Schmitt, B.; Costa, J.H.; de Melo, D.F. AOX—A functional marker for efficient cell reprogramming under stress? Trends Plant Sci. 2006, 11, 281–287. [Google Scholar] [CrossRef]
 - Arnholdt-Schmitt, B.; Santos Macedo, E.; Peixe, A.; Cardoso, H.; Cordeiro, A. AOX—A potential functional marker for efficient rooting in olive shoot cuttings. In Proceedings of the Second International Seminar Olivebioteq, Marsala Mazara del Vallo, Italy, 5–10 November 2006; pp. 249–254. [Google Scholar]
 - Santos Macedo, E.; Sircar, D.; Cardoso, H.G.; Peixe, A.; Arnholdt-Schmitt, B. Involvement of alternative oxidase (AOX) in adventitious rooting of Olea europaea L. microshoots is linked to adaptive phenylpropanoid and lignin metabolism. Plant Cell Rep. 2012, 31, 1581–1590. [Google Scholar] [CrossRef]
 - Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef]
 - Tognetti, V.B.; Mühlenbock, P.; van Breusegem, F. Stress homeostasis - the redox and auxin perspective. Plant Cell Environ. 2012, 35, 321–333. [Google Scholar] [CrossRef]
 - Potters, G.; Pasternak, T.P.; Guisez, Y.; Palme, K.J.; Jansen, M.A.K. Stress-induced morphogenic responses: Growing out of trouble? Trends Plant Sci. 2007, 12, 98–105. [Google Scholar] [CrossRef]
 - Potters, G.; Pasternak, T.P.; Guisez, Y.; Jansen, M.A.K. Different stresses, similar morphogenic responses: Integrating a plethora of pathways. Plant Cell Environ. 2009, 32, 158–169. [Google Scholar] [CrossRef]
 - Pasternak, T.; Potters, G.; Caubergs, R.; Jansen, M.A.K. Complementary interactions between oxidative stress and auxins control plant growth responses at plant, organ, and cellular level. J. Exp. Bot. 2005, 56, 1991–2001. [Google Scholar] [CrossRef]
 - Kovtun, Y.; Chiu, W.-L.; Tena, G.; Sheen, J. Functional analysis of oxidative stress-activated mitogen-activated protein kinase cascade in plants. Proc. Natl. Acad. Sci. USA 2002, 97, 2940–2945. [Google Scholar] [CrossRef] [PubMed]
 - Blomster, T.; Salojarvi, J.; Sipari, N.; Brosche, M.; Ahlfors, R.; Keinanen, M.; Overmyer, K.; Kangasjarvi, J. Apoplastic Reactive Oxygen Species Transiently Decrease Auxin Signaling and Cause Stress-Induced Morphogenic Response in Arabidopsis. Plant Physiol. 2011, 157, 1866–1883. [Google Scholar] [CrossRef] [PubMed]
 - Nakagami, H.; Soukupová, H.; Schikora, A.; Žárský, V.; Hirt, H. A mitogen-activated protein kinase kinase kinase mediates reactive oxygen species homeostasis in Arabidopsis. J. Biol. Chem. 2006, 281, 38697–38704. [Google Scholar] [CrossRef] [PubMed]
 - Xia, X.J.; Zhou, Y.H.; Shi, K.; Zhou, J.; Foyer, C.H.; Yu, J.Q. Interplay between reactive oxygen species and hormones in the control of plant development and stress tolerance. J. Exp. Bot. 2015, 66, 2839–2856. [Google Scholar] [CrossRef]
 - Peer, W.A.; Cheng, Y.; Murphy, A.S. Evidence of oxidative attenuation of auxin signalling. J. Exp. Bot. 2013, 64, 2629–2639. [Google Scholar] [CrossRef]
 - Choudhury, F.K.; Rivero, R.M.; Blumwald, E.; Mittler, R. Reactive oxygen species, abiotic stress and stress combination. Plant J. 2017, 90, 856–867. [Google Scholar] [CrossRef]
 - He, J.; Duan, Y.; Hua, D.; Fan, G.; Wang, L.; Liu, Y.; Chen, Z.; Han, L.; Qu, L.-J.; Gong, Z. DEXH Box RNA Helicase–Mediated Mitochondrial Reactive Oxygen Species Production in Arabidopsis Mediates Crosstalk between Abscisic Acid and Auxin Signaling. Plant Cell 2012, 24, 1815–1833. [Google Scholar] [CrossRef]
 - Kawano, T. Roles of the reactive oxygen species-generating peroxidase reactions in plant defense and growth induction. Plant Cell Rep. 2003, 21, 829–837. [Google Scholar] [CrossRef]
 - Grunewald, W.; Friml, J. The march of the PINs: Developmental plasticity by dynamic polar targeting in plant cells. EMBO J. 2010, 29, 2700–2714. [Google Scholar] [CrossRef]
 - Shen, C.J.; Bai, Y.H.; Wang, S.K.; Zhang, S.N.; Wu, Y.R.; Chen, M.; Jiang, D.A.; Qi, Y.H. Expression profile of PIN, AUX/LAX and PGP auxin transporter gene families in Sorghum bicolor under phytohormone and abiotic stress. FEBS J. 2010, 277, 2954–2969. [Google Scholar] [CrossRef]
 - Shibasaki, K.; Uemura, M.; Tsurumi, S.; Rahman, A. Auxin Response in Arabidopsis under Cold Stress: Underlying Molecular Mechanisms. Plant Cell 2009, 21, 3823–3838. [Google Scholar] [CrossRef] [PubMed]
 - Santos MacEdo, E.; Cardoso, H.G.; Hernández, A.; Peixe, A.A.; Polidoros, A.; Ferreira, A.; Cordeiro, A.; Arnholdt-Schmitt, B. Physiologic responses and gene diversity indicate olive alternative oxidase as a potential source for markers involved in efficient adventitious root induction. Physiol. Plant. 2009, 137, 532–552. [Google Scholar] [CrossRef] [PubMed]
 - Fattorini, L.; Veloccia, A.; Della Rovere, F.; D’Angeli, S.; Falasca, G.; Altamura, M.M. Indole-3-butyric acid promotes adventitious rooting in Arabidopsis thaliana thin cell layers by conversion into indole-3-acetic acid and stimulation of anthranilate synthase activity. BMC Plant Biol. 2017, 17, 121. [Google Scholar] [CrossRef] [PubMed]
 - Estrella-Maldonado, H.; Fuentes Ortíz, G.; Chan León, A.C.; Rodríguez Zapata, L.C.; Talavera May, C.; Espadas y Gil, F.; Barredo Pool, F.; Idrovo Espín, F.M.; Santamaría, J.M. The papaya CpAUX1/LAX and CpPIN genes: Structure, phylogeny and expression analysis related to root formation on in vitro plantlets. Plant Cell. Tissue Organ Cult. 2016, 126, 187–204. [Google Scholar] [CrossRef]
 - Yue, R.; Tie, S.; Sun, T.; Zhang, L.; Yang, Y.; Qi, J.; Yan, S.; Han, X.; Wang, H.; Shen, C. Genome-wide identification and expression profiling analysis of ZmPIN, ZmPILS, ZmLAX and ZmABCB auxin transporter gene families in maize (Zea mays L.) under various abiotic stresses. PLoS ONE 2015, 10, e0118751. [Google Scholar] [CrossRef]
 - Wang, J.R.; Hu, H.; Wang, G.H.; Li, J.; Chen, J.Y.; Wu, P. Expression of PIN genes in rice (Oryza sativa L.): Tissue specificity and regulation by hormones. Mol. Plant 2009, 2, 823–831. [Google Scholar] [CrossRef]
 - Zazímalová, E.; Murphy, A.S.; Yang, H.; Hoyerová, K.; Hosek, P. Auxin transporters—Why so many? Cold Spring Harb. Perspect. Biol. 2010, 2, a001552. [Google Scholar] [CrossRef]
 - Della Rovere, F.; Fattorini, L.; Ronzan, M.; Falasca, G.; Altamura, M.M. The quiescent center and the stem cell niche in the adventitious roots of Arabidopsis thaliana. Plant Signal. Behav. 2016, 11, e1176660. [Google Scholar] [CrossRef]
 - Sukumar, P.; Maloney, G.S.; Muday, G.K. Localized Induction of the ATP-Binding Cassette B19 Auxin Transporter Enhances Adventitious Root Formation in Arabidopsis. Plant Physiol. 2013, 162, 1392–1405. [Google Scholar] [CrossRef]
 - Xu, W.; Jia, L.; ŠekBaluška, F.; Ding, G.; Shi, W.; Ye, N.; Zhang, J. PIN2 is required for the adaptation of Arabidopsis roots to alkaline stress by modulating proton secretion. J. Exp. Bot. 2012, 63, 6105–6114. [Google Scholar] [CrossRef]
 - Zhang, Q.; Li, J.; Zhang, W.; Yan, S.; Wang, R.; Zhao, J.; Li, Y.; Qi, Z.; Sun, Z.; Zhu, Z. The putative auxin efflux carrier OsPIN3t is involved in the drought stress response and drought tolerance. Plant J. 2012, 72, 805–816. [Google Scholar] [CrossRef] [PubMed]
 - Baluška, F.; Mancuso, S.; Volkmann, D.; Barlow, P.W. Root apex transition zone: A signalling-response nexus in the root. Trends Plant Sci. 2010, 15, 402–408. [Google Scholar] [CrossRef] [PubMed]
 - Du, H.; Liu, H.; Xiong, L. Endogenous auxin and jasmonic acid levels are differentially modulated by abiotic stresses in rice. Front. Plant Sci. 2013, 4, 397. [Google Scholar] [CrossRef] [PubMed]
 - Mravec, J.; Skůpa, P.; Bailly, A.; Hoyerová, K.; Křeček, P.; Bielach, A.; Petrášek, J.; Zhang, J.; Gaykova, V.; Stierhof, Y.D.; et al. Subcellular homeostasis of phytohormone auxin is mediated by the ER-localized PIN5 transporter. Nature 2009, 459, 1136–1140. [Google Scholar] [CrossRef]
 - Lu, G.; Coneva, V.; Casaretto, J.A.; Ying, S.; Mahmood, K.; Liu, F.; Nambara, E.; Bi, Y.M.; Rothstein, S.J. OsPIN5b modulates rice (Oryza sativa) plant architecture and yield by changing auxin homeostasis, transport and distribution. Plant J. 2015, 83, 913–925. [Google Scholar] [CrossRef]
 - Cazzonelli, C.I.; Vanstraelen, M.; Simon, S.; Yin, K.; Carron-Arthur, A.; Nisar, N.; Tarle, G.; Cuttriss, A.J.; Searle, I.R.; Benkova, E.; et al. Role of the Arabidopsis PIN6 Auxin Transporter in Auxin Homeostasis and Auxin-Mediated Development. PLoS ONE 2013, 8, e70069. [Google Scholar] [CrossRef]
 - Simon, S.; Skůpa, P.; Viaene, T.; Zwiewka, M.; Tejos, R.; Klíma, P.; Čarná, M.; Rolčík, J.; De Rycke, R.; Moreno, I.; et al. PIN6 auxin transporter at endoplasmic reticulum and plasma membrane mediates auxin homeostasis and organogenesis in Arabidopsis. New Phytol. 2016, 211, 65–74. [Google Scholar] [CrossRef] [PubMed]
 - Ding, Z.; Wang, B.; Moreno, I.; Duplá Ková, N.; Simon, S.; Carraro, N.; Reemmer, J.; Pě Nčí K, A.; Chen, X.; Tejos, R.; et al. ER-localized auxin transporter PIN8 regulates auxin homeostasis and male gametophyte development in Arabidopsis. Nat. Commun. 2012, 3, 1–11. [Google Scholar] [CrossRef]
 - Velada, I.; Grzebelus, D.; Lousa, D.; Soares, C.M.; Macedo, E.S.; Peixe, A.; Arnholdt-Schmitt, B.; Cardoso, H.G. AOX1-subfamily gene members in olea europaea cv. “Galega vulgar”—Gene characterization and expression of transcripts during IBA-induced in vitro adventitious rooting. Int. J. Mol. Sci. 2018, 19, 597. [Google Scholar] [CrossRef]
 - Millar, A.H.; Whelan, J.; Soole, K.L.; Day, D.A. Organization and Regulation of Mitochondrial Respiration in Plants. Annu. Rev. Plant Biol. 2011, 62, 79–104. [Google Scholar] [CrossRef]
 - Vanlerberghe, G.C. Alternative oxidase: A mitochondrial respiratory pathway to maintain metabolic and signaling homeostasis during abiotic and biotic stress in plants. Int. J. Mol. Sci. 2013, 14, 6805–6847. [Google Scholar] [CrossRef] [PubMed]
 - Clifton, R.; Lister, R.; Parker, K.L.; Sappl, P.G.; Elhafez, D.; Millar, A.H.; Day, D.A.; Whelan, J. Stress-induced co-expression of alternative respiratory chain components in Arabidopsis thaliana. Plant Mol. Biol. 2005, 58, 193–212. [Google Scholar] [CrossRef] [PubMed]
 - Clifton, R.; Millar, A.H.; Whelan, J. Alternative oxidases in Arabidopsis: A comparative analysis of differential expression in the gene family provides new insights into function of non-phosphorylating bypasses. Biochim. Biophys. Acta Bioenerg. 2006, 1757, 730–741. [Google Scholar] [CrossRef] [PubMed]
 - Rhoads, D.M.; Umbach, A.L.; Subbaiah, C.C.; Siedow, J.N. Mitochondrial reactive oxygen species. Contribution to oxidative stress and interorganellar signaling. Plant Physiol. 2006, 141, 357–366. [Google Scholar] [CrossRef] [PubMed]
 - Ivanova, A.; Law, S.R.; Narsai, R.; Duncan, O.; Lee, J.-H.; Zhang, B.; Van Aken, O.; Radomiljac, J.D.; van der Merwe, M.; Yi, K.; et al. A Functional Antagonistic Relationship between Auxin and Mitochondrial Retrograde Signaling Regulates Alternative Oxidase1a Expression in Arabidopsis. Plant Physiol. 2014, 165, 1233–1254. [Google Scholar] [CrossRef]
 - Peixe, A.; Raposo, A.; Lourenço, R.; Cardoso, H.; Macedo, E. Coconut water and BAP successfully replaced zeatin in olive (Olea europaea L.) micropropagation. Sci. Hortic. 2007, 113, 1–7. [Google Scholar] [CrossRef]
 - Rugini, E. In vitro propagation of some olive (Olea europaea sativa L.) cultivars with different root-ability, and medium development using analytical data from developing shoots and embryos. Sci. Hortic. 1984, 24, 123–134. [Google Scholar] [CrossRef]
 - He, P.; Zhao, P.; Wang, L.; Zhang, Y.; Wang, X.; Xiao, H.; Yu, J.; Xiao, G. The PIN gene family in cotton (Gossypium hirsutum): Genome-wide identification and gene expression analyses during root development and abiotic stress responses. BMC Genom. 2017, 18, 1–10. [Google Scholar] [CrossRef]
 - Yang, C.; Wang, D.; Zhang, C.; Kong, N.; Ma, H.; Chen, Q. Comparative analysis of the PIN auxin transporter gene family in different plant species: A focus on structural and expression profiling of PINs in Solanum tuberosum. Int. J. Mol. Sci. 2019, 20, 3270. [Google Scholar] [CrossRef]
 - Sánchez-García, A.B.; Ibáñez, S.; Cano, A.; Acosta, M.; Pérez-Pérez, J.M. A comprehensive phylogeny of auxin homeostasis genes involved in adventitious root formation in carnation stem cuttings. PLoS ONE 2018, 13, e0196663. [Google Scholar] [CrossRef]
 - Yu, C.; Dong, W.; Zhan, Y.; Huang, Z.A.; Li, Z.; Kim, I.S.; Zhang, C. Genome-wide identification and expression analysis of ClLAX, ClPIN and ClABCB genes families in Citrullus lanatus under various abiotic stresses and grafting. BMC Genet. 2017, 18, 1–15. [Google Scholar] [CrossRef] [PubMed]
 - Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, RESEARCH0034. [Google Scholar] [CrossRef] [PubMed]
 - Thordal-Christensen, H.; Zhang, Z.; Wei, Y.; Collinge, D.B. Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley-powdery mildew interaction. Plant J. 1997, 11, 1187–1194. [Google Scholar] [CrossRef]
 - Daudi, A.; O’Brien, J. Detection of Hydrogen Peroxide by DAB Staining in Arabidopsis Leaves. BIO-PROTOCOL 2012, 2, 1–4. [Google Scholar] [CrossRef]
 - Kumar, D.; Yusuf, M.; Singh, P.; Sardar, M.; Sarin, N. Histochemical Detection of Superoxide and H2O2 Accumulation in Brassica juncea Seedlings. Bio-Protocol 2014, 4, e1108. [Google Scholar] [CrossRef]
 - R Development Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2018. [Google Scholar]
 


| Gene | Locus ID | Primer Sequences 5′→3′ | Amplicon Size (bp) | 
|---|---|---|---|
| OePIN1a | OE6A110180 | Fw: TATGAGAAGGGCAGTAGAAGATTAGAGCAT Rv: GGGCCAATGAATTCCGTTTC  | 86 | 
| OePIN1b | OE6A100299 | Fw: TGCTGGGATTATGAAAAGGAA Rv: TTGGTGATCCCAACTTCAAA  | 82 | 
| OePIN1c | OE6A008174 | Fw: GGCTATGAATGTGATGTGTCGAT Rv: TTTCGGTGTCCAAGTCTTTGA  | 64 | 
| OePIN2b | OE6A029229 | Fw: CTTCTTGGGGTGTAACTTTGG Rv: AAAAACAAGCAACAAGAACATCA  | 147 | 
| OePIN3a | OE6A013411 | Fw: TTTGGAATGTTGATTGCATTG Rv: TTCAACGAAGCGTCACAATC  | 128 | 
| OePIN3b | OE6A121027 | Fw: TCCCGATTACGCTCGTCTAT Rv: TTTGACACCATTTTCACACAGTC  | 84 | 
| OePIN3c | OE6A040519 | Fw: ATCGCGCTACCGATTACACT Rv: CCCGAATATGACCAAGAACAA  | 72 | 
| OePIN5a | OE6A089248 | Fw: CGTCATTTTAGATAGTATCCATTGATGT Rv: TTTATACTGGAAAGTCCTAGTCAGCA  | 53 | 
| OePIN5b | OE6A062743 | Fw: GCTTCCACTCTTGATTGGCTA Rv: TGGATCGTCAGATGCAAACT  | 82 | 
| OePIN5c | OE6A015595 | Fw: GGTGTTGATCGGATATTATGCAGTT Rv: ATGATCCAAAATTTAGCCATGAAAAC  | 125 | 
| OePIN6 | OE6A074435 | Fw: CCCGTGACCCTTGTCTATTACATAT Rv: TTATCCTTTTCCTTTTTGTTCCAACT  | 72 | 
| OePIN8 | OE6A113148 | Fw: GCCAATTGCATTAGCCTACTACTTC Rv: GCACGAGATGAATCTTGTGTTATCA  | 74 | 
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Velada, I.; Cardoso, H.; Porfirio, S.; Peixe, A. Expression Profile of PIN-Formed Auxin Efflux Carrier Genes during IBA-Induced In Vitro Adventitious Rooting in Olea europaea L. Plants 2020, 9, 185. https://doi.org/10.3390/plants9020185
Velada I, Cardoso H, Porfirio S, Peixe A. Expression Profile of PIN-Formed Auxin Efflux Carrier Genes during IBA-Induced In Vitro Adventitious Rooting in Olea europaea L. Plants. 2020; 9(2):185. https://doi.org/10.3390/plants9020185
Chicago/Turabian StyleVelada, Isabel, Hélia Cardoso, Sara Porfirio, and Augusto Peixe. 2020. "Expression Profile of PIN-Formed Auxin Efflux Carrier Genes during IBA-Induced In Vitro Adventitious Rooting in Olea europaea L." Plants 9, no. 2: 185. https://doi.org/10.3390/plants9020185
APA StyleVelada, I., Cardoso, H., Porfirio, S., & Peixe, A. (2020). Expression Profile of PIN-Formed Auxin Efflux Carrier Genes during IBA-Induced In Vitro Adventitious Rooting in Olea europaea L. Plants, 9(2), 185. https://doi.org/10.3390/plants9020185
        
