Molecular Detection of Potato Viruses in Bangladesh and Their Phylogenetic Analysis
Abstract
:1. Introduction
2. Results
2.1. Detection of Potato Viruses
2.2. Phylogenetic Analysis
3. Discussion
4. Materials and Methods
4.1. Collection of Potato Tuber Samples
4.2. RT-PCR Detection
4.3. Cloning and Sequence Analysis
4.4. Phylogenetic Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Uddin, M.A.; Yasmin, S.; Rahman, M.L.; Hossain, S.M.B.; Choudhury, R.U. Challenges of potato cultivation in Bangladesh and developing digital databases of potato. Bangladesh J. Agril. Res. 2010, 35, 453–463. [Google Scholar] [CrossRef] [Green Version]
- [FAOSTAT] Food and Agricultural Organization of the United Nations. Potato Production in 2018; Region/World/Production Quantity/Crops from Pick Lists; Statistical Division, Economic and Social Department: Rome, Italy, 2020; Available online: http://www.fao.org/faostat/en/#data/QC (accessed on 14 August 2020).
- Awasthi, L.P.; Verma, H.N. Current status of viral diseases of potato and their ecofriendly management—A critical review. Virol. Virol. Res. Rev. 2017, 1, 1–16. [Google Scholar]
- Kerlan, C.; Moury, B. Potato Virus Y. In Encyclopaedia of Virology; Mahy, B.W.J., Regenmortel, V., Eds.; Academic Press: London, UK, 2008; pp. 287–296. [Google Scholar]
- Halterman, D.; Charkowski, A.; Verchot, J. Potato viruses and seed certification in the USA to provide healthy propagated tubers. Pest Technol. 2012, 6, 1–14. [Google Scholar]
- Kreuze, J.F.; Souza-Dias, J.A.C.; Jeevalatha, A.; Figueira, A.R.; Valkonen, J.P.T.; Jones, R.A.C. Viral diseases in potato. In The Potato Crop: Its Agricultural, Nutritional and Social Contribution to Humankind; Campos, H., Ortiz, O., Eds.; Springer: Cham, Switzerland, 2020; pp. 389–430. [Google Scholar]
- Wales, S.; Platt, H.W.; Cattlin, N. Diseases, Pests and Disorders of Potatoes: A Colour Handbook, 1st ed.; Manson Publishing Ltd.: London, UK, 2008. [Google Scholar]
- Pallás, V.; Sánchez-Navarro, J.A.; James, D. Recent advances on the multiplex molecular detection of plant viruses and viroids. Front. Microbiol. 2018, 9, 2087. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ali, M.S.; Khan, A.L. Pathological Constraints of Seed Potato Production in Bangladesh. In Proceedings of the International Seminar on Seed Potato, Dhaka, Bangladesh, 8–10 January 1990; p. 240. [Google Scholar]
- Khan, A.L.; Ali, M.S.; Bari, M.A. A Review of the Viral Diseases of Potato in Bangladesh. In Proceedings of the First National Workshop on Tuber Crop, Gazpur, Bangladesh, 28–30 May 1991; p. 286. [Google Scholar]
- Rashid, M.; Li, Y.Y.; Wang, Y.; Han, C.G. First report of Potato virus H infecting potatoes in Bangladesh. Plant Dis. 2019, 103, 1051. [Google Scholar] [CrossRef]
- Rashid, M.; Zhang, X.Y.; Wang, Y.; Han, C.G. First report of Potato virus S infecting potatoes in Bangladesh. Plant Dis. 2019, 103, 781. [Google Scholar] [CrossRef]
- Hossain, M.D.; Mia, S.A.; Ali, M.S.; Khan, A. Effect of degrees of severity of leaf roll virus on the growth and yield of potato. Bangladesh J. Bot. 1989, 18, 15–21. [Google Scholar]
- Hossain, M.; Ali, M. Effect of potato virus Y severities on virus concentration, dilution endpoint and potato yield. Bangladesh J. Plant Pathol. 1992, 8, 27–30. [Google Scholar]
- Muqit, A.; Akanda, A.M. Research on Virus and Mycoplasma Disease Management of Bangladesh Agricultural Research Institute mandated crops. In Strategic Intervention of Plant Pathology Research in Bangladesh; BARI: Gazpur, Bangladesh, 2007; p. 344. [Google Scholar]
- Ghorai, A.K.; Kang, S.S.; Sharma, A.; Sharma, S. Occurrence of Cucumber mosaic virus on potato and its transmission to muskmelon under potato-cucurbit cropping pattern followed in Punjab, India. Int. J. Curr. Microbiol. App. Sci. 2017, 6, 2947–2965. [Google Scholar] [CrossRef]
- Wu, X.; Liu, Q.; Chai, M.; Liu, J.; Zhang, L.; Cheng, X. First report of Potato aucuba mosaic virus on potato in China. Plant Dis. 2018, 102, 2671. [Google Scholar] [CrossRef]
- Salazar, L.F. Virus detection and management in developing countries. In Advances in Potato Pest Biology and Management; Zehnder, G.W., Powelson, M.L., Jansson, R.K., Raman, K.B., Eds.; APS Press: St. Paul, MN, USA, 1994; pp. 643–652. [Google Scholar]
- Hull, R. Nucleic acid hybridization procedures. In Diagnosis of Plant Virus Diseases; Matthews, R.E.F., Ed.; CRC Press: Boca Raton, FL, USA, 1993; pp. 253–271. [Google Scholar]
- Mumford, R.A.; Waish, K.; Barker, L.; Boonham, N. Detection of Potato mop top virus using a multiplex-real time fluorescent reverse transcription polymerase chain reaction assay. Phytopathology 2000, 90, 448–453. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nie, X.; Singh, R.P. A new approach for the simultaneous differentiation of biological and geographical strains of Potato virus Y by multiplex RT-PCR. J. Virol. Methods 2002, 104, 41–54. [Google Scholar] [CrossRef]
- Singh, R.P.; Valkonen, J.P.; Gray, S.M.; Boonham, N.; Jones, R.A.; Kerlan, C.; Scubert, J. Discussion paper: The naming of Potato virus Y strains infecting potato. Arch. Virol. 2008, 153, 1–13. [Google Scholar] [CrossRef]
- Dietzgen, R.G. Application of PCR in plant virology. In Plant Viruses as Molecular Pathogens; Khan, J.A., Dijkstra, J., Eds.; The Haworth Press: New York, NY, USA, 2002; pp. 471–500. [Google Scholar]
- Ju, H.J. Simple and rapid detection of Potato leafroll virus (PLRV) by reverse transcription loop-mediated isothermal amplification (RT-LAMP). Plant Pathol. J. 2011, 27, 1–4. [Google Scholar] [CrossRef] [Green Version]
- Jeong, J.; Cho, S.Y.; Lee, W.H.; Lee, K.J.; Ju, H.J. Development of a rapid detection method for Potato virus X by reverse transcription loop-mediated isothermal amplification. Plant Pathol. J. 2015, 31, 219–225. [Google Scholar] [CrossRef] [Green Version]
- Treder, K.; Chołuj, J.; Zacharzewska, B.; Babujee, L.; Mielczarek, M.; Burzyński, A.; Rakotondrafara, A.M. Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of Potato virus Y and differentiation of N and O serotypes. Arch. Virol. 2018, 163, 447–458. [Google Scholar] [CrossRef] [Green Version]
- Adams, I.; Fox, A. Diagnosis of plant viruses using next-generation sequencing and metagenomic analysis. In Current Research Topics in Plant Virology; Wang, A., Zhou, X., Eds.; Springer: Cham, Switzerland, 2016; pp. 323–335. [Google Scholar]
- Jones, S.; Baizan-Edge, A.; MacFarlane, S.; Torrance, L. Viral diagnostics in plants using next generation sequencing: Computational analysis in practice. Front. Plant Sci. 2017, 8, 1770. [Google Scholar] [CrossRef]
- Bhat, A.I.; Rao, G.P. Next-generation sequencing for diagnosis of virus. In Characterization of Plant Viruses; Bhat, A.I., Rao, G.P., Eds.; Humana Press: New York, NY, USA, 2020; pp. 389–395. [Google Scholar]
- Koenig, R.; Lesemann, D.E.; Adam, G.; Winter, S. Diagnostic techniques: Plant viruses. In Desk Encyclopedia of Plant and Fungal Virology; Mahy, B.W., van Regenmortel, M.H., Eds.; Academic Press: London, UK, 2009; pp. 18–30. [Google Scholar]
- Faccioli, G. Control of potato viruses using meristem culture and stem-cutting cultures, thermotherapy and chemotherapy. In Virus and Virus-Like Diseases of Potatoes and Production of Seed-Potatoes; Loebenstein, G., Berger, P.H., Brunt, A., Lawson, R.H., Eds.; Kluwer Academic Publishers: Dordrecht, The Netherlands, 2001; pp. 365–390. [Google Scholar]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peiman, M.; Xie, C. Sensitive detection of potato viruses, PVX, PLRV and PVS, by RT PCR in potato leaf and tuber. Australas. Plant Dis. Notes 2006, 1, 41–46. [Google Scholar] [CrossRef] [Green Version]
- Stevenson, W.R. Compendium of Potato Diseases, 2nd ed.; APS Press: St. Paul, MN, USA, 2001. [Google Scholar]
- Zhang, W.; Zhang, Z.; Fan, G.; Gao, Y.; Wen, J.; Bai, Y.; Qiu, C.; Zhang, S.; Shen, Y.; Men, X. Development and application of a universal and simplified multiplex RT-PCR assay to detect five potato viruses. J. Gen. Plant Pathol. 2017, 83, 33–45. [Google Scholar] [CrossRef]
- Wang, B.; Ma, Y.L.; Zhang, Z.B.; Wu, Z.M.; Wu, Y.F.; Wang, Q.C.; Li, M.F. Potato viruses in China. Crop Prot. 2011, 30, 1117–1123. [Google Scholar] [CrossRef]
- Barker, H.; Dale, M.F.B. Resistance to viruses in potato. In Natural Resistance Mechanisms of Plants to Viruses; Loebenstein, G., Carr, J.P., Eds.; Springer: Cham, Switzerland, 2006; pp. 341–366. [Google Scholar]
- Dolby, C.A.; Jones, R.A.C. Occurrence of the Andean strain of Potato virus S in imported potato material and its effects on potato cultivars. Plant Pathol. 1987, 36, 381–388. [Google Scholar] [CrossRef]
- Li, Y.Y.; Zhang, R.N.; Xiang, H.Y.; Abouelnasr, H.; Li, D.W.; Yu, J.L.; McBeath, J.H.; Han, C.G. Discovery and characterization of a novel Carlavirus infecting potatoes in China. PLoS ONE 2013, 8, e69255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yardimci, N.; Culal, K.H.; Demir, Y. Detection of PVY, PVX, PVS, PVA, and PLRV on different potato varieties in Turkey using DAS-ELISA. J. Agric. Sci. Tech. 2015, 17, 757–764. [Google Scholar]
- Hull, R. Matthews’ Plant Virology, 4th ed.; Academic Press: London, UK, 2002. [Google Scholar]
- Gibbs, A.J.; Ohshima, K. Potyviruses and the digital revolution. Annu. Rev. Phytopathol. 2010, 48, 205–223. [Google Scholar] [CrossRef]
- Rota-Stabelli, O.; Telford, M.J. A multi criterion approach for the selection of optimal outgrous in phylogeny: Recovering some support for Mandibulata over Myriochelata using mitogenomics. Mol. Phylogenet. Evol. 2008, 48, 103–111. [Google Scholar] [CrossRef]
- Rosenfeld, J.A.; Payne, A.; DeSalle, R. Random roots and lineage sorting. Mol. Phylogenet. Evol. 2012, 64, 12–20. [Google Scholar] [CrossRef]
- Graham, S.W.; Olmstead, R.G.; Barrett, S.C.H. Rooting phylogenetic trees with distant outgroups: A case study from the Commelinoid monocots. Mol. Biol. Evol. 2002, 19, 1769–1781. [Google Scholar] [CrossRef] [Green Version]
- Abbas, M.F.; Hameed, S.; Rauf, A.; Nosheen, Q.; Ghani, A.; Qadir, A.; Zakia, S. Incidence of six viruses in potato growing areas of Pakistan. Pak. J. Phytopathol. 2012, 24, 44–47. [Google Scholar]
- Nosheen, Q.; Hameed, S.; Mughal, S.M.; Abbas, M.F. Serological identity of Potato virus X (PVX) and PCR characterization of its coat protein (CP) gene. Int. J. Phytopathol. 2013, 2, 92–96. [Google Scholar] [CrossRef]
- Al-Saikhan, M.S.; Alhudaib, K.A.; Soliman, A.M. Detection of three potato viruses isolated from Saudi Arabia. Int. J. Virol. 2014, 10, 224–234. [Google Scholar] [CrossRef] [Green Version]
- Han, C.G.; Li, D.W.; Xing, Y.M.; Zhu, K.; Tian, Z.F.; Cai, Z.N.; Yu, J.L.; Liu, Y. Wheat yellow mosaic virus widely occurring in wheat (Triticum aestivum) in China. Plant Dis. 2000, 84, 627–630. [Google Scholar] [CrossRef] [Green Version]
- Khine, M.O.; Michaela, B.; Liu, Y.; Kundu, J.K.; Wang, X. Molecular diversity of Barley yellow dwarf virus-PAV from China and the Czech Republic. J. Integr. Agric. 2020, 19, 2–11. [Google Scholar] [CrossRef]
- Zhang, X.Y.; Zhao, T.Y.; Li, Y.Y.; Xiang, H.Y.; Dong, S.W.; Zhang, Z.Y.; Wang, Y.; Li, D.W.; Yu, J.L.; Han, C.G. The conserved proline18 in the polerovirus P3a is important for Brassica yellows virus systemic infection. Front. Microbiol. 2018, 9, 613. [Google Scholar] [CrossRef]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T.A. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
Sample Collected Regions | No. of Collected Tuber Samples | Associated Virus Name | RT-PCR Detection | |
---|---|---|---|---|
No. of Infected Tubers | Infection Ratio (%) | |||
Munshiganj | 50 | PLRV/PVX | 7 | 14 |
PVX/PVS | 5 | 10 | ||
PLRV/PVX/PVS | 7 | 14 | ||
PLRV/PVX/PVY | 6 | 12 | ||
PLRV/PVY/PVS | 6 | 12 | ||
Jessore | 50 | PLRV/PVX | 3 | 6 |
PVX/PVS | 5 | 10 | ||
PVX/PAMV | 6 | 12 | ||
PLRV/PVX/PVS | 3 | 6 | ||
PLRV/PVY/PVS | 5 | 10 | ||
PVX/PVH/PAMV | 4 | 8 | ||
PLRV/PVX/PVH/PAMV | 5 | 10 | ||
PVX/PVS/PVH/PAMV | 3 | 6 | ||
PLRV/PVX/PVS/PVH/PAMV | 1 | 2 | ||
Bogra | 120 | PVX/PAMV | 4 | 3.33 |
PLRV/PVX/PVS | 5 | 4.17 | ||
PLRV/PVX/PVY | 4 | 3.33 | ||
PLRV/PVY/PVS | 4 | 3.33 | ||
PVX/PVH/PAMV | 11 | 9.17 | ||
PLRV/PVX/PVH/PAMV | 15 | 12.50 | ||
PVX/PVS/PVH/PAMV | 7 | 5.83 | ||
PLRV/PVX/PVS/PVH/PAMV | 4 | 3.33 | ||
PLRV/PVX/PVS/PVH/PAMV/PVM | 10 | 8.33 |
Virus Name | GenBank Accession No. | Sample Collected Regions | ||
---|---|---|---|---|
Bogra | Munshiganj | Jessore | ||
PLRV | MK445318 | + | - | - |
PLRV | MK445319 | + | + | + |
PVX | MK587458 | + | - | - |
PVX | MK587459 | + | - | - |
PVX | MF589763 | - | + | + |
PVY | MF589764 | + | + | + |
PVS | MF589762 | - | + | + |
PVS | MK587460 | + | - | - |
PVH | MK561855 | + | - | + |
PAMV | MK445320 | + | - | + |
PAMV | MK445321 | + | - | - |
PAMV | MK445322 | + | - | - |
PVM | MK445316 | + | - | - |
PVM | MK445317 | + | - | - |
Primer | Sequence (5′ to 3′) |
---|---|
PLRV-CPF | ATGAGTACGGTCGTGGTTAA |
PLRV-CPR | CTATTTGGGGTTTTGCAAAG |
PVX-CPF | TAGCCACAACACAGGCCACAG |
PVX-CPR | TTATGGTGGTGGGAGAGTGACAA |
PVY-CPF | ACGTCCAAAATGAGAATGCC |
PVY-CPR | TGGTGTTCGTGATGTGACCT |
PVS-CPF | ATGCCGCCCAAACCGGAT |
PVS-CPR | TCATTGGTTGATCGCATTAC |
PVH-CPF | ATGGATGTTGCTACTTC |
PVH-CPR | ATTGCCGCTTGTTATTC |
PAMV-CPF | ATGGTTGATTCTAAGAAAAC |
PAMV-CPR | TTAGGATGGTGGTGCCATGA |
PVM-CPF | ATGGGAGATTCAACTAAGAA |
PVM-CPR | CTTCATTTGTTATTCGACTT |
PVA-CPF | AGCCGAAACTCTTGATGCAA |
PVA-CPR | GCACTTCGGTTACACCCCCT |
PVH-TGB1F | AACTGCAGATGGATGTGCTGGTAG |
PVH-TGB1R | CGGGATCAGGCGGCGGTGAAAGTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rashid, M.-O.; Wang, Y.; Han, C.-G. Molecular Detection of Potato Viruses in Bangladesh and Their Phylogenetic Analysis. Plants 2020, 9, 1413. https://doi.org/10.3390/plants9111413
Rashid M-O, Wang Y, Han C-G. Molecular Detection of Potato Viruses in Bangladesh and Their Phylogenetic Analysis. Plants. 2020; 9(11):1413. https://doi.org/10.3390/plants9111413
Chicago/Turabian StyleRashid, Mamun-Or, Ying Wang, and Cheng-Gui Han. 2020. "Molecular Detection of Potato Viruses in Bangladesh and Their Phylogenetic Analysis" Plants 9, no. 11: 1413. https://doi.org/10.3390/plants9111413