Characterization of JsWOX1 and JsWOX4 during Callus and Root Induction in the Shrub Species Jasminum sambac
Abstract
:1. Introduction
2. Results
2.1. Establishment of J. sambac Callus Culture and the Role of Auxin and Cytokinin
2.2. Analysis of WOX Gene Expression during Callus Induction
2.3. In Situ Detection of JsWOX1 and JsWOX4 Transcripts in Calli
2.4. Effects of Ectopic Expression of JsWOX1 and JsWOX4 on Callus Morphogenesis and Gene Expressions
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Culture Conditions
4.2. Transverse Sections, Histological Observation and Scanning Electron Microscopy (SEM)
4.3. Full-Length cDNA Cloning and Agrobacterium-Mediated Transformation
4.4. In situ mRNA Hybridization
4.5. Quantitative RT-PCR
4.6. Sequence Alignment and Phylogenetic Tree
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Verdeil, J.L.; Alemanno, L.; Niemenak, N.; Tranbarger, T.J. Pluripotent versus totipotent plant stem cells: Dependence versus autonomy? Trends Plant Sci. 2007, 12, 245–252. [Google Scholar] [CrossRef] [PubMed]
- Kareem, A.; Radhakrishnan, D.; Sondhi, Y.; Aiyaz, M.; Roy, M.V.; Sugimoto, K.; Prasad, K. De novo assembly of plant body plan: A step ahead of deadpool. Regeneration 2016, 3, 182–197. [Google Scholar] [CrossRef]
- Ikeuchi, M.; Ogawa, Y.; Iwase, A.; Sugimoto, K. Plant regeneration: Cellular origins and molecular mechanisms. Development 2016, 143, 1442–1451. [Google Scholar] [CrossRef]
- Ikeuchi, M.; Sugimoto, K.; Iwase, A. Plant callus: Mechanisms of induction and repression. Plant Cell 2013, 25, 3159–3173. [Google Scholar] [CrossRef] [PubMed]
- Sugimoto, K.; Jiao, Y.; Meyerowitz, E.M. Arabidopsis regeneration from multiple tissues occurs via a root development pathway. Dev. Cell 2010, 18, 463–471. [Google Scholar] [CrossRef] [PubMed]
- Atta, R.; Laurens, L.; Boucheron-Dubuisson, E.; Guivarc’h, A.; Carnero, E.; Giraudat-Pautot, V.; Rech, P.; Chriqui, D. Pluripotency of arabidopsis xylem pericycle underlies shoot regeneration from root and hypocotyl explants grown in vitro. Plant J. 2009, 57, 626–644. [Google Scholar] [CrossRef]
- Sugimoto, K.; Gordon, S.P.; Meyerowitz, E.M. Regeneration in plants and animals: Dedifferentiation, transdifferentiation, or just differentiation? Trends Cell Biol. 2011, 21, 212–218. [Google Scholar] [CrossRef]
- Zhou, Y.; Liu, X.; Engstrom, E.M.; Nimchuk, Z.L.; Pruneda-Paz, J.L.; Tarr, P.T.; Yan, A.; Kay, S.A.; Meyerowitz, E.M. Control of plant stem cell function by conserved interacting transcriptional regulators. Nature 2015, 517, 377–380. [Google Scholar] [CrossRef]
- Sang, Y.L.; Cheng, Z.J.; Zhang, X.S. Plant stem cells and de novo organogenesis. New Phytol. 2018, 218, 1334–1339. [Google Scholar] [CrossRef]
- Greb, T.; Lohmann, J.U. Plant stem cells. Curr. Biol. 2016, 26, R816–R821. [Google Scholar] [CrossRef] [PubMed]
- Dolzblasz, A.; Nardmann, J.; Clerici, E.; Causier, B.; van der Graaff, E.; Chen, J.; Davies, B.; Werr, W.; Laux, T. Stem cell regulation by arabidopsis wox genes. Mol. Plant 2016, 9, 1028–1039. [Google Scholar] [CrossRef] [PubMed]
- Nardmann, J.; Reisewitz, P.; Werr, W. Discrete shoot and root stem cell-promoting wus/wox5 functions are an evolutionary innovation of angiosperms. Mol. Biol. Evol. 2009, 26, 1745–1755. [Google Scholar] [CrossRef]
- van der Graaff, E.; Laux, T.; Rensing, S.A. The wus homeobox-containing (wox) protein family. Genome Biol. 2009, 10, 248. [Google Scholar] [CrossRef] [PubMed]
- Mayer, K.F.; Schoof, H.; Haecker, A.; Lenhard, M.; Jurgens, G.; Laux, T. Role of wuschel in regulating stem cell fate in the arabidopsis shoot meristem. Cell 1998, 95, 805–815. [Google Scholar] [CrossRef]
- Laux, T.; Mayer, K.F.; Berger, J.; Jurgens, G. The wuschel gene is required for shoot and floral meristem integrity in arabidopsis. Development 1996, 122, 87–96. [Google Scholar]
- Daum, G.; Medzihradszky, A.; Suzaki, T.; Lohmann, J.U. A mechanistic framework for noncell autonomous stem cell induction in arabidopsis. Proc. Natl. Acad. Sci. USA 2014, 111, 14619–14624. [Google Scholar] [CrossRef] [PubMed]
- Schoof, H.; Lenhard, M.; Haecker, A.; Mayer, K.F.; Jurgens, G.; Laux, T. The stem cell population of arabidopsis shoot meristems in maintained by a regulatory loop between the clavata and wuschel genes. Cell 2000, 100, 635–644. [Google Scholar] [CrossRef]
- Lohmann, J.U.; Hong, R.L.; Hobe, M.; Busch, M.A.; Parcy, F.; Simon, R.; Weigel, D. A molecular link between stem cell regulation and floral patterning in arabidopsis. Cell 2001, 105, 793–803. [Google Scholar] [CrossRef]
- Lenhard, M.; Bohnert, A.; Jurgens, G.; Laux, T. Termination of stem cell maintenance in arabidopsis floral meristems by interactions between wuschel and agamous. Cell 2001, 105, 805–814. [Google Scholar] [CrossRef]
- Deyhle, F.; Sarkar, A.K.; Tucker, E.J.; Laux, T. Wuschel regulates cell differentiation during anther development. Dev. Biol. 2007, 302, 154–159. [Google Scholar] [CrossRef]
- Gross-Hardt, R.; Lenhard, M.; Laux, T. Wuschel signaling functions in interregional communication during arabidopsis ovule development. Genes Dev. 2002, 16, 1129–1138. [Google Scholar] [CrossRef] [PubMed]
- Kucukoglu, M.; Nilsson, J.; Zheng, B.; Chaabouni, S.; Nilsson, O. Wuschel-related homeobox4 (wox4)-like genes regulate cambial cell division activity and secondary growth in populus trees. New Phytol. 2017, 215, 642–657. [Google Scholar] [CrossRef] [PubMed]
- Suer, S.; Agusti, J.; Sanchez, P.; Schwarz, M.; Greb, T. Wox4 imparts auxin responsiveness to cambium cells in arabidopsis. Plant Cell 2011, 23, 3247–3259. [Google Scholar] [CrossRef] [PubMed]
- Ji, J.; Strable, J.; Shimizu, R.; Koenig, D.; Sinha, N.; Scanlon, M.J. Wox4 promotes procambial development. Plant Physiol. 2010, 152, 1346–1356. [Google Scholar] [CrossRef]
- Skylar, A.; Hong, F.; Chory, J.; Weigel, D.; Wu, X. Stimpy mediates cytokinin signaling during shoot meristem establishment in arabidopsis seedlings. Development 2010, 137, 541–549. [Google Scholar] [CrossRef] [PubMed]
- Breuninger, H.; Rikirsch, E.; Hermann, M.; Ueda, M.; Laux, T. Differential expression of wox genes mediates apical-basal axis formation in the arabidopsis embryo. Dev. Cell 2008, 14, 867–876. [Google Scholar] [CrossRef] [PubMed]
- Romera-Branchat, M.; Ripoll, J.J.; Yanofsky, M.F.; Pelaz, S. The wox13 homeobox gene promotes replum formation in the arabidopsis thaliana fruit. Plant J. 2013, 73, 37–49. [Google Scholar] [CrossRef]
- Skoog, F.; Miller, C.O. Chemical regulation of growth and organ formation in plant tissues cultured in vitro. Symp. Soc. Exp. Biol. 1957, 11, 118–130. [Google Scholar]
- Hirakawa, Y.; Kondo, Y.; Fukuda, H. Tdif peptide signaling regulates vascular stem cell proliferation via the wox4 homeobox gene in arabidopsis. Plant Cell 2010, 22, 2618–2629. [Google Scholar] [CrossRef] [PubMed]
- Deveaux, Y.; Toffano-Nioche, C.; Claisse, G.; Thareau, V.; Morin, H.; Laufs, P.; Moreau, H.; Kreis, M.; Lecharny, A. Genes of the most conserved wox clade in plants affect root and flower development in arabidopsis. BMC Evol. Biol. 2008, 8, 291. [Google Scholar] [CrossRef]
- Minh-Thu, P.T.; Kim, J.S.; Chae, S.; Jun, K.M.; Lee, G.S.; Kim, D.E.; Cheong, J.J.; Song, S.I.; Nahm, B.H.; Kim, Y.K. A wuschel homeobox transcription factor, oswox13, enhances drought tolerance and triggers early flowering in rice. Mol. Cells 2018, 41, 781–798. [Google Scholar] [PubMed]
- Nakata, M.; Matsumoto, N.; Tsugeki, R.; Rikirsch, E.; Laux, T.; Okada, K. Roles of the middle domain-specific wuschel-related homeobox genes in early development of leaves in arabidopsis. Plant Cell 2012, 24, 519–535. [Google Scholar] [CrossRef] [PubMed]
- Kong, D.; Hao, Y.; Cui, H. The wuschel related homeobox protein wox7 regulates the sugar response of lateral root development in arabidopsis thaliana. Mol. Plant 2016, 9, 261–270. [Google Scholar] [CrossRef]
- Liu, J.; Sheng, L.; Xu, Y.; Li, J.; Yang, Z.; Huang, H.; Xu, L. Wox11 and 12 are involved in the first-step cell fate transition during de novo root organogenesis in arabidopsis. Plant Cell 2014, 26, 1081–1093. [Google Scholar] [CrossRef] [PubMed]
- Lloyd, G.B.; McCown, B.H. Commercially-feasible micropropagation of mountain laurel, kalmia latifolia, by use of shoot-tip culture. Proc. Int. Plant Propag. Soc. 1980, 30, 421–427. [Google Scholar]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Karimi, M.; Inze, D.; Depicker, A. Gateway vectors for agrobacterium-mediated plant transformation. Trends Plant Sci. 2002, 7, 193–195. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time pcr data by the comparative c(t) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
Treatment | WPM Medium + NAA + BA (M) | Ratio NAA/BA | Percent Explant with Callus (%) (1 Month) | Percent Explant with Rooted Callus (%) (2 Months) | Extended Callus Culture (up to 6 months) | |
---|---|---|---|---|---|---|
1 | 8.06 | 0 | 100/0 | 80 (n = 22) | 0 | browning, dying |
2 | 6.04 | 1.67 | 78/22 | 83 (n = 20) | 0 | browning, dying |
3 | 4.03 | 3.33 | 55/45 | 85 (n = 30) | 0 | browning, dying |
4 | 2.01 | 5.00 | 29/71 | 65 (n = 18) | 0 | browning, dying |
5 | 0 | 6.66 | 0/100 | 15 (n = 18) | 0 | browning, dying |
6 | 2.69 | 8.88 | 23/77 | 86 (n = 400) | 3 | most browning |
7 | 1.07 | 8.88 | 11/89 | 98 (n = 450) | 6 | pale green, stable |
8 | 0 | 8.88 | 0/100 | 10 (n = 400) | 1 | browning, dying |
9 | 16.11 | 0 | 100/0 | 86 (n = 23) | 13 | some browning |
10 | 12.08 | 3.33 | 78/22 | 96 (n = 24) | 12.5 | browning |
11 | 8.06 | 6.66 | 55/45 | 98 (n = 23) | 13 | dark green, stable |
12 | 4.03 | 9.99 | 29/71 | 98 (n = 126) | 30 | pale green, stable |
13 | 0 | 13.32 | 0/100 | 40 (n = 23) | 0 | browning, dying |
14 | 48.34 | 0 | 100/0 | 60 (n = 19) | 0 | browning, dying |
15 | 36.25 | 9.99 | 78/22 | 68 (n = 18) | 0 | browning, dying |
16 | 24.17 | 19.98 | 55/45 | 85 (n = 25) | 4 | some browning |
17 | 12.08 | 29.97 | 29/71 | 34 (n = 29) | 7 | some browning |
18 | 0 | 39.96 | 0/100 | 10 (n = 23) | 0 | browning, dying |
19 | 112.78 | 0 | 100/0 | 14 (n = 13) | 0 | browning, dying |
20 | 84.59 | 23.31 | 78/22 | 15 (n = 18) | 0 | browning, dying |
21 | 56.39 | 46.63 | 55/45 | 8 (n = 14) | 0 | browning, dying |
22 | 28.20 | 69.94 | 29/71 | 40 (n = 22) | 4.5 | browning, dying |
23 | 0 | 93.25 | 0/100 | 4 (n = 10) | 0 | browning, dying |
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
JsWOX1 | ACACCGTCGGCTGATCAAAT | ATTCCAGTTGACGTCGCCTT |
JsWOX4 | TAGAGGAGGAATGCGAACGC | TTCTGTCTCTCGCGTGCTTT |
JsWOX13x1 | ATTACGGGCAGGCAGAGATG | CCGTGTTGGCATAACTCTGC |
JsWOX13x2 | TGTACCCTGGTGGCCATAGA | TCTGCTTGCTTGGAGTTCCA |
c92402 | TTTTCGCAGCTTGCTTCCAC | CGGGACCCAACGATGAGAAT |
c76574 | GCTCAAGTGGGCATGGGATT | GCACCTCTCTCGTATCGTGT |
c19299 | GCTGTGTCTAGGTGCATGGT | TCCGCTTCATCGTACACTCC |
c16725 | AAAGTTGTGGTGGAGTGGCA | CGACAGTCCCGAAACCAAGA |
JsActin2 | TCTCTATGGTAACATTGTCCTG | TCTCTATGGTAACATTGTCCTG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, Y.; Liu, Z.; Lyu, M.; Yuan, Y.; Wu, B. Characterization of JsWOX1 and JsWOX4 during Callus and Root Induction in the Shrub Species Jasminum sambac. Plants 2019, 8, 79. https://doi.org/10.3390/plants8040079
Lu Y, Liu Z, Lyu M, Yuan Y, Wu B. Characterization of JsWOX1 and JsWOX4 during Callus and Root Induction in the Shrub Species Jasminum sambac. Plants. 2019; 8(4):79. https://doi.org/10.3390/plants8040079
Chicago/Turabian StyleLu, Ying, Zhuoyi Liu, Meiling Lyu, Yuan Yuan, and Binghua Wu. 2019. "Characterization of JsWOX1 and JsWOX4 during Callus and Root Induction in the Shrub Species Jasminum sambac" Plants 8, no. 4: 79. https://doi.org/10.3390/plants8040079
APA StyleLu, Y., Liu, Z., Lyu, M., Yuan, Y., & Wu, B. (2019). Characterization of JsWOX1 and JsWOX4 during Callus and Root Induction in the Shrub Species Jasminum sambac. Plants, 8(4), 79. https://doi.org/10.3390/plants8040079