Alleviation of Phytophthora infestans Mediated Necrotic Stress in the Transgenic Potato (Solanum tuberosum L.) with Enhanced Ascorbic acid Accumulation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Phytophthora infestans Disease Resistance Studies
2.3. Histological Studies of Infected Leaves
2.4. Evaluation of Disease Severity
2.5. Gene Expression Studies in Infected Samples
2.6. Estimation of H2O2 and MDA
2.7. Estimation of the Plant Hormones GA and ABA
2.8. Statistical Analysis
3. Results
3.1. GalUR Transgenics with Reduced Necrotic Damage to Fungal Pathogen Infection
3.2. Reduced Levels of H2O2 and MDA and Enhanced Antioxidant Gene Expression in GalUR-Transgenic Potato Plants
3.3. Altered Expression of PR, Phytohomone Genes, and Estimation of Phytohormones Using HPLC
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Zhang, H.; Xu, F.; Wu, Y.; Hu, H.-H.; Dai, X.-F. Progress of potato staple food research and industry development in China. J. Integr. Agric. 2017, 16, 2924–2932. [Google Scholar] [CrossRef]
- Dahal, K.; Li, X.-Q.; Tai, H.; Creelman, A.; Bizimungu, B. Improving potato stress tolerance and tuber yield under a climate change scenario—A current overview. Front. Plant Sci. 2019, 10, 563. [Google Scholar] [CrossRef] [PubMed]
- Zurbriggen, M.D.; Carrillo, N.; Hajirezaei, M.R. ROS signaling in the hypersensitive response: When, where and what for? Plant Signal. Behav. 2010, 5, 393–396. [Google Scholar] [CrossRef] [PubMed]
- Van Breusegem, F.; Dat, J.F. Reactive oxygen species in plant cell death1. Plant Physiol. 2006, 141, 384–390. [Google Scholar] [CrossRef] [PubMed]
- Asada, K. THE water-water cycle in chloroplasts: scavenging of active oxygens and dissipation of excess photons. Annu. Rev. Plant Boil. 1999, 50, 601–639. [Google Scholar] [CrossRef]
- Halliwell, B.; Gutteridge, J.M.C. Free Radicals in Biology and Medicine, 3rd ed.; Oxford University Press: London, UK, 1999. [Google Scholar]
- Lim, B.; Smirnoff, N.; Cobbett, C.S.; Golz, J.F. Ascorbate-deficient vtc2 mutants in Arabidopsis do not exhibit decreased growth. Front. Plant Sci. 2016, 7, 1025. [Google Scholar] [CrossRef] [PubMed]
- Akram, N.A.; Shafiq, F.; Ashraf, M. Ascorbic acid-a potential oxidant scavenger and its role in plant development and abiotic stress tolerance. Front. Plant Sci. 2017, 8, 613. [Google Scholar] [CrossRef] [PubMed]
- Tokunaga, T.; Miyahara, K.; Tabata, K.; Esaka, M. Generation and properties of ascorbic acid-overproducing transgenic tobacco cells expressing sense RNA for L-galactono-1, 4-lactone dehydrogenase. Planta 2005, 220, 854–863. [Google Scholar] [CrossRef] [PubMed]
- Locato, V.; Cimini, S.; De Gara, L. Strategies to increase vitamin C in plants: From plant defense perspective to food biofortification. Front. Plant Sci. 2013, 4, 152. [Google Scholar] [CrossRef] [PubMed]
- Eskling, M.; Arvidsson, P.-O.; Åkerlund, H.-E. The xanthophyll cycle, its regulation and components. Physiol. Plant. 1997, 100, 806–816. [Google Scholar] [CrossRef]
- Davey, M.W.; Van Montagu, M.; Inzé, D.; Sanmartin, M.; Kanellis, A.; Smirnoff, N.; Benzie, I.J.J.; Strain, J.J.; Favell, D.; Fletcher, J. Plant L-ascorbic acid: Chemistry, function, metabolism, bioavailability and effects of processing. J. Sci. Food Agric. 2000, 80, 825–860. [Google Scholar] [CrossRef]
- Carr, A.C.; Maggini, S. Vitamin C and Immune Function. Nutrients 2017, 9, 1211. [Google Scholar] [CrossRef] [PubMed]
- Gallie, D.R. L-ascorbic Acid: A multifunctional molecule supporting plant growth and development. Scientifica 2013, 2013, 795964. [Google Scholar] [CrossRef] [PubMed]
- Romero-Romero, M.T.; López-Delgado, H.A. Ameliorative effects of hydrogen peroxide, ascorbate and dehydroascorbate in Solanum tuberosum infected by Phytoplasma. Am. J. Potato Res. 2009, 86, 218–226. [Google Scholar] [CrossRef]
- Smirnoff, N. Ascorbic acid metabolism and functions: A comparison of plants and mammals. Free. Radic. Biol. Med. 2018, 122, 116–129. [Google Scholar] [CrossRef] [PubMed]
- Botanga, C.J.; Bethke, G.; Chen, Z.; Gallie, D.R.; Fiehn, O.; Glazebrook, J. Metabolite profiling of Arabidopsis inoculated with Alternaria brassicicola reveals that ascorbate reduces disease severity. Mol. Plant-Microbe Interact. 2012, 25, 1628–1638. [Google Scholar] [CrossRef] [PubMed]
- Fujiwara, A.; Togawa, S.; Hikawa, T.; Matsuura, H.; Masuta, C.; Inukai, T. Ascorbic acid accumulates as a defense response to Turnip mosaic virus in resistant Brassica rapa cultivars. J. Exp. Bot. 2016, 67, 4391–4402. [Google Scholar] [CrossRef] [PubMed]
- Zarrillo, A.; Minutolo, M.; Alioto, D.; Errico, A. Ascorbic acid regulation in leaves and fruits of tomato ecotypes infected by Eggplant mottled dwarf virus. Sci. Hortic. 2017, 225, 512–524. [Google Scholar] [CrossRef]
- Mohammed, A.E.; Smit, I.; Pawelzik, E.; Keutgen, A.J.; Horneburg, B. Organically grown tomato (Lycopersicon esculentum Mill.): Bioactive compounds in the fruit and infection with Phytophthora infestans. J. Sci. Food Agric. 2012, 92, 1424–1431. [Google Scholar] [CrossRef]
- Upadhyaya, C.P.; Akula, N.; Kim, H.S.; Jeon, J.H.; Ho, O.M.; Chun, S.C.; Kim, D.H.; Park, S.W. Biochemical analysis of enhanced tolerance in transgenic potato plants overexpressing d-galacturonic acid reductase gene in response to various abiotic stresses. Mol. Breed. 2011, 28, 105–115. [Google Scholar]
- Upadhyaya, C.P.; Young, K.E.; Akula, N.; soon Kim, H.; Heung, J.J.; Oh, O.M.; Aswath, C.R.; Chun, S.C.; Kim, D.H.; Park, S.W. Over-expression of strawberry d-galacturonic acid reductase in potato leads to accumulation of vitamin C with enhanced abiotic stress tolerance. Plant Sci. 2009, 177, 659–667. [Google Scholar]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Roetschi, A.; Si-Ammour, A.; Mauch-Mani, B.; Belbahri, L.; Mauch, F. Characterization of an Arabidopsis-Phytophthora Pathosystem: Resistance requires a functional PAD2 gene and is independent of salicylic acid, ethylene and jasmonic acid signalling. Plant J. 2001, 28, 293–305. [Google Scholar] [CrossRef] [PubMed]
- Alejo-Iturvide, F.; Marquez-Lucio, M.A.; Morales-Ramirez, I.; Vazquez-Garciduenas, M.S.; Olalde-Portugal, V. Mycorrhizal protection of chili plants challenged by Phytophthora capsici. Eur. J. Plant Pathol. 2008, 120, 13–20. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Chung, I.-M.; Venkidasamy, B.; Thiruvengadam, M. Nickel oxide nanoparticles cause substantial physiological, phytochemical, and molecular-level changes in Chinese cabbage seedlings. Plant Physiol. Biochem. 2019, 139, 92–101. [Google Scholar] [CrossRef] [PubMed]
- Chung, I.M.; Rekha, K.; Rajakumar, G.; Thiruvengadam, M. Elicitation of silver nanoparticles enhanced the secondary metabolites and pharmacological activities in cell suspension cultures of bitter gourd. 3 Biotech 2018, 8, 412. [Google Scholar] [CrossRef]
- Tang, Y.; Wang, L.; Ma, C.; Liu, J.; Liu, B.; Li, H. The Use of HPLC in determination of endogenous hormones in anthers of bitter melon. J. Life Sci. 2011, 5, 139–142. [Google Scholar]
- Gururani, M.A.; Upadhyaya, C.P.; Baskar, V.; Venkatesh, J.; Nookaraju, A.; Park, S.W. Plant growth-promoting rhizobacteria enhance abiotic stress tolerance in Solanum tuberosum through inducing changes in the expression of ROS-scavenging enzymes and improved photosynthetic performance. J. Plant Growth Regul. 2012, 32, 245–258. [Google Scholar] [CrossRef]
- Sarowar, S.; Kim, E.N.; Kim, Y.J.; Ok, S.H.; Kim, K.D.; Hwang, B.K.; Shin, J.S. Overexpression of a pepper ascorbate peroxidase-like 1 gene in tobacco plants enhances tolerance to oxidative stress and pathogens. Plant Sci. 2005, 169, 55–63. [Google Scholar] [CrossRef]
- Zhu, F.; Yuan, S.; Wang, S.-D.; Xi, D.-H.; Lin, H.-H. The higher expression levels of dehydroascorbate reductase and glutathione reductase in salicylic acid-deficient plants may contribute to their alleviated symptom infected with RNA viruses. Plant Signal. Behav. 2011, 6, 1402–1404. [Google Scholar] [CrossRef] [Green Version]
- Haggag, W.M.; El-Khair, H.A. Application of some natural compounds for management of potato late and early blights. J. Food Agric. Environ. 2007, 5, 157–163. [Google Scholar]
- Wang, S.-D.; Zhu, F.; Yuan, S.; Yang, H.; Xu, F.; Shang, J.; Xu, M.-Y.; Jia, S.-D.; Zhang, Z.-W.; Wang, J.-H.; et al. The roles of ascorbic acid and glutathione in symptom alleviation to SA-deficient plants infected with RNA viruses. Planta 2011, 234, 171–181. [Google Scholar] [CrossRef]
- Wang, X.; Hadrami, A.E.I.; Adam, L.R.; Daayf, F. Differential activation and suppression of potato defence responses by Phytophthora infestans isolates representing US-1 and US-8 genotypes. Plant Pathol. 2008, 57, 1026–1037. [Google Scholar] [CrossRef]
- Barth, C.; De Tullio, M.; Conklin, P.L. The role of ascorbic acid in the control of flowering time and the onset of senescence. J. Exp. Bot. 2006, 57, 1657–1665. [Google Scholar] [CrossRef]
- Agrawal, G.K.; Rakwal, R.; Jwa, N.S.; Agrawal, V.P. Signaling molecules and blast pathogen attack activates rice OsPR1a and OsPR1b genes: A model illustrating components participating during defense/stress response. Plant Physiol. Biochem. 2001, 39, 1095–1103. [Google Scholar] [CrossRef]
- Yu, H.J.; Mun, J.H.; Kwon, Y.M.; Lee, J.S.; Kim, S.G. Two cDNAs encoding pathogenesis-related proteins of Lithospermum erythrorhizon display different expression patterns in suspension cultures. J. Plant Physiol. 1999, 155, 364–370. [Google Scholar] [CrossRef]
- Mohr, P.G.; Cahill, D.M. Suppression by ABA of salicylic acid and lignin accumulation and the expression of multiple genes, in Arabidopsis infected with Pseudomonas syringae pv. tomato. Funct. Integr. Genom. 2007, 7, 181–191. [Google Scholar] [CrossRef]
- Navarro, L. A Plant miRNA Contributes to antibacterial resistance by repressing auxin signaling. Science 2006, 312, 436–439. [Google Scholar] [CrossRef]
- Achard, P.; Renou, J.-P.; Berthomé, R.; Harberd, N.P.; Genschik, P. Plant DELLAs Restrain growth and promote survival of adversity by reducing the levels of reactive oxygen species. Curr. Boil. 2008, 18, 656–660. [Google Scholar] [CrossRef]
- Tanaka, N.; Matsuoka, M.; Kitano, H.; Asano, T.; Kaku, H.; Komatsu, S. gid1, a gibberellin-insensitive dwarf mutant, shows altered regulation of probenazole-inducible protein (PBZ1) in response to cold stress and pathogen attack. Plant Cell Environ. 2006, 29, 619–631. [Google Scholar] [CrossRef]
NCBI Accession Number | Primer Name | Sequence (5′–3′) |
---|---|---|
X55749 | Actin | F: CTGGTGGTGCAACAACCTTA |
R: GAATGGAAGCAGCTGGAATC | ||
AB041343 | APx | F: ACCAATTGGCTGGTGTTGTT |
R: TCACAAACACGTCCCTCAAA | ||
AY442179 | CAT | F: TGCCCTTCTATTGTGGTTCC |
R: GATGAGCACACTTTGGAGGA | ||
AF354748 | SOD | F: GTTTGTGGCACCATCCTCTT |
R: GTGGTCCTGTTGACATGCAG | ||
X76533 | GR | F: GGATCCTCATACGGTGGATG |
R: TTAGGCTTCGTTGGCAAATC | ||
DQ512964 | DHAR | F: AGGTGAACCCAGAAGGGAAA |
R: TATTTTCGAGCCCACAGAGG | ||
AJ250136 | PR1 | F: GCATCCCGAGCACAAAATTA |
R: GAAATCACCACTTCCCTTGG | ||
X63103 | PAL1 | F: TTGCACAAGTTGCATCCATT |
R: CACCAGCTCTTGCACTTTCA | ||
AJ291453 | GA20OX1 | F: CAAGATTGTGTTGGCGGACT |
R: ACTGCTCTGTGCAGGCAACT | ||
AY662342 | StNCED1 | F: GGAAATCAACAAGAAAAGCCA |
R: ATATTTGTTGTCACCATAAATGAA | ||
AY662343 | StNCED2 | F: GGGACTTTCATTAGCTCAAAGGACTTGC |
R: GCGATGTAAATTTGAATTACTATTATTCGCTCA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chung, I.-M.; Venkidasamy, B.; Upadhyaya, C.P.; Packiaraj, G.; Rajakumar, G.; Thiruvengadam, M. Alleviation of Phytophthora infestans Mediated Necrotic Stress in the Transgenic Potato (Solanum tuberosum L.) with Enhanced Ascorbic acid Accumulation. Plants 2019, 8, 365. https://doi.org/10.3390/plants8100365
Chung I-M, Venkidasamy B, Upadhyaya CP, Packiaraj G, Rajakumar G, Thiruvengadam M. Alleviation of Phytophthora infestans Mediated Necrotic Stress in the Transgenic Potato (Solanum tuberosum L.) with Enhanced Ascorbic acid Accumulation. Plants. 2019; 8(10):365. https://doi.org/10.3390/plants8100365
Chicago/Turabian StyleChung, Ill-Min, Baskar Venkidasamy, Chandrama Prakash Upadhyaya, Gurusaravanan Packiaraj, Govindasamy Rajakumar, and Muthu Thiruvengadam. 2019. "Alleviation of Phytophthora infestans Mediated Necrotic Stress in the Transgenic Potato (Solanum tuberosum L.) with Enhanced Ascorbic acid Accumulation" Plants 8, no. 10: 365. https://doi.org/10.3390/plants8100365