Cytotoxic Potential Evaluation of Innovative Pressurised Cyclic Solid–Liquid Extracts from Withania somnifera
Abstract
1. Introduction
2. Methods
2.1. Plant Materials and Treatments
2.2. Reagents and Materials
2.3. Sample Preparation
2.4. Determination of Total Phenolic Content (TPC)
2.5. Determination of Withaferin a Content by HPLC
2.6. RNA Extraction and qRT-PCR
2.7. Antimicrobial Assay (MIC, MBC)
2.8. Cell Culture and Treatments
2.9. Cell Viability Assay
2.10. Statistical Analysis
3. Results
3.1. Total Phenolic Content (TPC)
3.2. Determination of Withaferin a Content
3.3. Expression Analysis of Genes Involved in Withanolide Pathway
3.4. Antimicrobial Activity
3.5. Cytotoxicity and Potential Anti-Cancer Activity of Withaferin A, Aqueous and Hydroalcoholic Extract of W. somnifera
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ARE | A. galanga rhizomes extract |
| BL | Brown lower layer |
| CAS | Cycloartenol synthase |
| cDNA | Complementary deoxyribonucleic acid |
| CHCl3 | Chloroform |
| CRC | Colorectal cancer |
| CTRL | Control condition |
| DMSO | Dimethyl sulfoxide |
| DMEM | Dulbecco’s Modified Eagle Medium |
| DWARF1 | Sterol C-24 reductase |
| FC | Fold change |
| FBS | Fetal bovine serum |
| HPLC | High-performance liquid chromatography |
| IC50 | Half-maximal inhibitory concentration |
| LB | Luria–Bertani medium |
| M | Methanolic extract |
| MBC | Minimum bactericidal concentration |
| MIC | Minimum inhibitory concentration |
| MTT | 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay |
| NMR | Nuclear magnetic resonance |
| PAO1 | Pseudomonas aeruginosa strain PAO1 |
| PCSLE | Pressurized Cyclic Solid–Liquid Extraction |
| qRT-PCR | Quantitative reverse-transcription polymerase chain reaction |
| RNAi | RNA interference |
| RPM | Revolutions per minute |
| RT-PCR | Reverse transcription polymerase chain reaction |
| SEM | Standard error of the mean |
| SH-SY5Y | Human neuroblastoma cell line |
| SMT1 | Sterol-C24-methyltransferase type 1 |
| TLC | Thin-layer chromatography |
| UV | Ultraviolet detection |
References
- Singh, R.; Gupta, P.; Khan, F.; Singh, S.K.; Sanchita; Mishra, T.; Kumar, A.; Dhawan, S.S.; Shirke, P.A. Modulations in primary and secondary metabolic pathways and adjustment in physiological behaviour of Withania somnifera under drought stress. Plant Sci. 2018, 272, 42–54. [Google Scholar] [CrossRef] [PubMed]
- Prakash, J.; Chouhan, S.; Yadav, S.K.; Westfall, S.; Rai, S.N.; Singh, S.P. Withania somnifera alleviates parkinsonian phenotypes by inhibiting apoptotic pathways in dopaminergic neurons. Neurochem. Res. 2014, 39, 2527–2536. [Google Scholar] [CrossRef] [PubMed]
- Sankar, S.R.; Manivasagam, T.; Krishnamurti, A.; Ramanathan, M. The neuroprotective effect of Withania somnifera root extract in MPTP-intoxicated mice: An analysis of behavioral and biochemical variables. Cell. Mol. Biol. Lett. 2007, 12, 473–481. [Google Scholar] [CrossRef] [PubMed]
- Tetali, S.D.; Acharya, S.; Ankari, A.B.; Nanakram, V.; Raghavendra, A.S. Metabolomics of Withania somnifera (L.) Dunal: Advances and applications. J. Ethnopharmacol. 2021, 1, 113469. [Google Scholar] [CrossRef]
- Narayanan, A.K.; Nagegowda, D.A. Biosynthesis of the triterpenoid withanolides in Withania somnifera. Curr. Opin. Plant Biol. 2024, 81, 102576. [Google Scholar] [CrossRef]
- Bashir, A.; Nabi, M.; Tabassum, N.; Afzal, S.; Ayoub, M. An updated review on phytochemistry and molecular targets of Withania somnifera (L.) Dunal (Ashwagandha). Front. Pharmacol. 2023, 14, 1049334. [Google Scholar] [CrossRef]
- Scartezzini, P.; Speroni, E. Review on some plants of Indian traditional medicine with antioxidant activity. J. Ethnopharmacol. 2000, 71, 23–43. [Google Scholar] [CrossRef]
- Kumar, V.; Dey, A.; Hadimani, M.B.; Marcovic, T.; Emerald, M. Chemistry and pharmacology of Withania somnifera: An update. Cell Med. 2015, 5, 1. [Google Scholar] [CrossRef]
- Bolleddula, J.; Fitch, W.; Vareed, S.K.; Nair, M.G. Identification of metabolites in Withania somnifera fruits by liquid chromatography and high-resolution mass spectrometry. Rapid Commun. Mass Spectrom. 2012, 26, 1277–1290. [Google Scholar] [CrossRef]
- Mirjalili, M.H.; Moyano, E.; Bonfill, M.; Cusido, R.M.; Palazón, J. Steroidal lactones from Withania somnifera, an ancient plant for novel medicine. Molecules 2009, 14, 2373–2393. [Google Scholar] [CrossRef]
- Zhang, Q.; Yuan, Y.; Cao, S.; Kang, N.; Qiu, F. Withanolides: Promising candidates for cancer therapy. Phytother. Res. 2024, 38, 1104–1158. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Mathew, S.O.; Aharwal, R.P.; Tulli, H.S.; Mohan, C.D.; Sethi, G.; Ahn, K.-S.; Webber, K.; Sandhu, S.S.; Bishayee, A. Withaferin A: A pleiotropic anticancer agent from the Indian medicinal plant Withania somnifera (L.) Dunal. Pharmaceuticals 2023, 16, 160. [Google Scholar] [CrossRef] [PubMed]
- Xing, Z.; Su, A.; Mi, L.; Zhang, Y.; He, T.; Qiu, Y.; Wei, T.; Li, Z.; Zhu, J.; Wu, W. Withaferin A: A dietary supplement with promising potential as an anti-tumor therapeutic for cancer treatment-pharmacology and mechanisms. Drug Des. Devel. Ther. 2023, 17, 2909–2929. [Google Scholar] [CrossRef] [PubMed]
- Shilpashree, H.B.; Sudharshan, S.J.; Shasany, A.K.; Nagegowda, D.A. Molecular characterization of three CYP450 genes reveals their role in withanolides formation and defense in Withania somnifera, the Indian Ginseng. Sci. Rep. 2022, 12, 1602. [Google Scholar] [CrossRef]
- Sanchita; Singh, R.; Mishra, A.; Dhawan, S.S.; Shirke, P.A.; Gupta, M.M.; Sharma, A. Physiological performance, secondary metabolite and expression profiling of genes associated with drought tolerance in Withania somnifera. Protoplasma 2015, 252, 1439–1450. [Google Scholar] [CrossRef]
- Mishra, B.; Bansal, S.; Tripathi, S.; Mishra, S.; Yadav, R.K.; Sangwan, N.S. Differential regulation of key triterpene synthase gene under abiotic stress in Withania somnifera L. Dunal and its co-relation to sterols and withanolides. Plant Physiol. Biochem. 2024, 208, 108419. [Google Scholar] [CrossRef]
- Naviglio, D.; Formato, A.; Vitulano, M.; Cozzolino, I.; Ferrara, L.; Zanoelo, E.F.; Gallo, M. Comparison between the kinetics of conventional maceration and a cyclic pressurization extraction process for the production of lemon liqueur using a numerical model. J. Food Process Eng. 2017, 40, e12350. [Google Scholar] [CrossRef]
- Naviglio, D. Naviglio’s principle and presentation of an innovative solid–liquid extraction technology: Extractor Naviglio®. Anal. Lett. 2003, 36, 1647–1659. [Google Scholar] [CrossRef]
- Perez, M.; Dominguez-López, I.; Lamuela-Raventós, R.M. The chemistry behind the Folin–Ciocalteu method for the estimation of (poly)phenol content in food: Total phenolic intake in a Mediterranean dietary pattern. J. Agric. Food Chem. 2023, 71, 17543–17553. [Google Scholar] [CrossRef]
- Pal, S.; Singh, S.; Shukla, A.K.; Gupta, M.M.; Khanuja, S.P.S.; Shasany, A.K.S. Comparative withanolide profiles, gene isolation, and differential gene expression in the leaves and roots of Withania somnifera. J. Hortic. Sci. Biotechnol. 2011, 86, 391–397. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Cafaro, V.; Bosso, A.; Di Nardo, I.; D’Amato, A.; Izzo, I.; De Riccardis, F.; Siepi, M.; Culurciello, R.; D’Urzo, N.; Chiarot, E.; et al. The antimicrobial, antibiofilm and anti-inflammatory activities of P13#1, a Cathelicidin-like achiral peptoid. Pharmaceuticals 2023, 16, 1386. [Google Scholar] [CrossRef]
- Bosso, A.; Di Nardo, I.; Culurciello, R.; Palumbo, I.; Gaglione, R.; Zannella, C.; Pinto, G.; Siciliano, A.; Carraturo, F.; Amoresano, A.; et al. KNR50: A moonlighting bioactive peptide hidden in the C-terminus of bovine casein αS2 with powerful antimicrobial, antibiofilm, antiviral and immunomodulatory activities. Int. J. Biol. Macromol. 2025, 311, 143718. [Google Scholar] [CrossRef]
- Culurciello, R.; Di Nardo, I.; Bosso, A.; Tortora, F.; Troisi, R.; Sica, F.; Arciello, A.; Notomista, E.; Pizzo, E. Tailoring the stress response of human skin cells by substantially limiting the nuclear localization of angiogenin. Heliyon 2024, 10, e24556. [Google Scholar] [CrossRef] [PubMed]
- Kuboyama, T.; Tohda, C.; Komatsu, K. Neuritic regeneration and synaptic reconstruction induced by withanolide A. Br. J. Pharmacol. 2005, 144, 961–971. [Google Scholar] [CrossRef] [PubMed]
- Pal, S.; Rastogi, S.; Nagegowda, D.A.; Gupta, M.M.; Shasany, A.K.; Chanotiya, C.S. RNAi of Sterol Methyl Transferase1 reveals its direct role in diverting intermediates towards withanolide/phytosterol biosynthesis in Withania somnifera. Plant Cell Physiol. 2019, 60, 672–686. [Google Scholar] [CrossRef]
- Razdan, S.; Bhat, W.W.; Dhar, N.; Rana, S.; Pandith, S.A.; Wani, T.A.; Vishwakarma, R.; Lattoo, S.K. Molecular characterization of DWF1 from Withania somnifera (L.) Dunal: Its implications in withanolide biosynthesis. J. Plant Biochem. Biotechnol. 2017, 26, 52–63. [Google Scholar] [CrossRef]
- Rehman, S.; Hussain, A.; Ullah, M.; Ali, E.; Mojzych, M.; Naqvi, S.A.R.; Ali, A.; Ali, M.; Gomaa, E.; Ghoneim, S.S.M.; et al. Agrobacterium-mediated genetic transformation of Withania coagulans (Dunal) with rolA genes and its antioxidant potential. ACS Omega 2023, 8, 41918–41929. [Google Scholar] [CrossRef]
- Ezez, D.; Mekonnen, N.; Tefera, M. Phytochemical analysis of Withania somnifera leaf extracts by GC-MS and evaluating antioxidants and antibacterial activities. Int. J. Food Prop. 2023, 26, 581–590. [Google Scholar] [CrossRef]
- Alam, N.; Hossain, M.; Khalil, M.I.; Moniruzzaman, M.; Sulaiman, S.A.; Gan, S.H. High catechin concentrations detected in Withania somnifera (ashwagandha) by high performance liquid chromatography analysis. BMC Complement. Altern. Med. 2011, 11, 65. [Google Scholar] [CrossRef]
- Widodo, N.; Kaur, K.; Shrestha, B.G.; Takagi, Y.; Ishii, T.; Wadhwa, R.; Kaul, S.C. Selective killing of cancer cells by leaf extract of Ashwagandha: Identification of a tumor-inhibitory factor and the first molecular insights to its effect. Clin. Cancer Res. 2007, 13, 2298–2306. [Google Scholar] [CrossRef] [PubMed]
- Widodo, N.; Priyandoko, D.; Shah, N.; Wadhwa, R.; Kaul, S.C. Selective killing of cancer cells by Ashwagandha leaf extract and its component withanone involves ros signaling. PLoS ONE 2010, 5, e13536. [Google Scholar] [CrossRef] [PubMed]
- Allen, M.; Bjerke, M.; Edlund, H.; Nelander, S.; Westermark, B. Origin of the U87MG glioma cell line: Good news and bad news. Sci. Transl. Med. 2016, 8, 354re3. [Google Scholar] [CrossRef] [PubMed]
- Rossato Viana, A.; Godoy Noro, B.; Lenz, J.C.; Machado Teixeira, M.L.; Bolson Serafin, M.; Hörner, R.; Franco, C.; Fontanari Krause, L.M.; Stefanello Vizzotto, B.; Maraschin, B.J. Cytotoxic screening and antibacterial activity of Withaferin A. J. Toxicol. Environ. Health A 2022, 85, 685–698. [Google Scholar] [CrossRef]
- Kulavi, S.; Dhar, D.; Iyer, K.; Ghosh, A.K.; Bandyopadhyay, J. Unveiling the potentials of Withania somnifera (L.) Dunal as a precise therapeutic intervention against glioblastoma multiforme. In Life as Basic Science: An Overview and Prospects for the Future; International Academic Publishing House: West Bengal, India, 2024; Volume 1, pp. 68–91. [Google Scholar] [CrossRef]
- Singh, N.; Singh, A.R.J. Anti-cancer activity of ethanolic extract of Withania somnifera against T-24 urinary bladder cell line, Hela-cervical adeno carcinoma and AGS-human adeno gastric carcinoma cell lines. Ind. J. Nat. Sci. 2025, 15, 87479–87484. [Google Scholar]
- Munagala, R.; Kausar, H.; Munjal, C.; Gupta, R.C. Withaferin A induces p53-dependent apoptosis by repression of HPV oncogenes and upregulation of tumor suppressor proteins in human cervical cancer cells. Carcinogenesis 2011, 32, 1697–1705. [Google Scholar] [CrossRef]
- Di Domenico, M.; Feola, A.; Ambrosio, P.; Pinto, F.; Galasso, G.; Zarrelli, A.; Di Fabio, G.; Porcelli, M.; Scacco, S.; Inchingolo, F.; et al. Antioxidant effect of beer polyphenols and their bioavailability in dental-derived stem cells (D-dSCs) and human intestinal epithelial lines (CaCo-2) cells. Stem Cells Int. 2020, 2020, 8835813. [Google Scholar] [CrossRef]
- Behl, T.; Sharma, A.; Sharma, L.; Sehgal, A.; Zengin, G.; Brata, R.; Fratila, O.; Bungau, S. Exploring the Multifaceted Therapeutic Potential of Withaferin A and Its Derivatives. Biomedicines 2020, 8, 571. [Google Scholar] [CrossRef]
- Grogan, P.T.; Sleder, K.D.; Samadi, A.K.; Zhang, H.; Timmermann, B.N.; Cohen, M.S. Cytotoxicity of withaferin A in glioblastomas involves induction of an oxidative stress-mediated heat shock response while altering Akt/mTOR and MAPK signaling pathways. Investig. New Drugs 2013, 31, 545–557. [Google Scholar] [CrossRef]









| Locus | Primer |
|---|---|
| WsCyp76Fw | AGCCTGAGAGGTTTCTTGGC |
| WsCyp76Rv | CAACACACATCCTCCGTCCA |
| WsCyp71Fw | GAGTTGCCGTGTGGAATGAA |
| WsCyp71Rv | TCTGGGAACAAGGCACAGAG |
| WsSMT1 Fw | GTGGGACTTGCTCCTAAAGGT |
| WsSMT1 Rv | TGGCGTGAAGATCCCTTTCT |
| WsDWF1 Fw | TTAAGGCCACCCAAAGCGA |
| WsDWF1 Rv | GAGGGTATCCGCAACCTTGT |
| WsCyclophillin Fw | AGGTCCAGCATTAGCCATCG |
| WsCyclophillin Rv | GAGAATCAATCTACGGCGCA |
| WsCAS Fw | GGTCCTATCACGCCAACAGT |
| WsCAS Rv | GCACACTCATTGCGAGCTTT |
| Bacterial Strain | Sample | MIC mg/mL | MBC mg/mL | MBC/ MIC | Activity |
|---|---|---|---|---|---|
| Gram-negative | |||||
| Pseudomonas aeruginosa PAO1 | A * | 3.125 | 3.125 | 1 | bactericidal |
| B * | >12.5 | >12.5 | nd | ||
| C * | 3.125 | 6.25 | 2 | bactericidal | |
| D * | 9.9 × 10−5 | 9.9 × 10−5 | 1 | bactericidal | |
| E * | 1.7 × 10−5 | 1.7 × 10−5 | 1 | bactericidal | |
| Escherichia coli ATCC 25922 | A * | 1.56 | 1.56 | 1 | bactericidal |
| B * | >12.5 | >12.5 | nd | ||
| C * | 3.12 | 6.25 | 2 | bactericidal | |
| D * | 2.3 × 10−5 | 4.6 × 10−5 | 2 | bactericidal | |
| E * | 7 × 10−6 | 7 × 10−6 | 1 | bactericidal | |
| Gram-positive | |||||
| Staphylococcus aureus ATCC 6538P | A * | 3.125 | 3.125 | 1 | bactericidal |
| B * | 6.25 | >12.5 | nd | ||
| C * | 3.125 | 6.25 | 2 | bactericidal | |
| D * | 1.9 × 10−4 | 1.9 × 10−4 | 1 | bactericidal | |
| E * | 3.2 × 10−5 | 3.2 × 10−5 | 1 | bactericidal | |
| Listeria monocytogenes ATCC 7644 | A * | 0.78 | 0.78 | 1 | bactericidal |
| B * | 12.5 | >12.5 | nd | ||
| C * | 3.125 | 6.25 | 2 | bactericidal | |
| D * | 9.9 × 10−5 | 9.9 × 10−5 | 1 | 9.9 × 10−5 | |
| E * | 7 × 10−5 | 7 × 10−5 | 1 | 1.7 × 10−5 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Culurciello, R.; Power, K.; Esposito, S.; Di Nardo, I.; Landi, S.; De Vico, G.; Palatucci, D.; Pizzo, E.; Naviglio, D.; Zarrelli, A. Cytotoxic Potential Evaluation of Innovative Pressurised Cyclic Solid–Liquid Extracts from Withania somnifera. Plants 2026, 15, 1027. https://doi.org/10.3390/plants15071027
Culurciello R, Power K, Esposito S, Di Nardo I, Landi S, De Vico G, Palatucci D, Pizzo E, Naviglio D, Zarrelli A. Cytotoxic Potential Evaluation of Innovative Pressurised Cyclic Solid–Liquid Extracts from Withania somnifera. Plants. 2026; 15(7):1027. https://doi.org/10.3390/plants15071027
Chicago/Turabian StyleCulurciello, Rosanna, Karen Power, Sergio Esposito, Ilaria Di Nardo, Simone Landi, Gionata De Vico, Domenico Palatucci, Elio Pizzo, Daniele Naviglio, and Armando Zarrelli. 2026. "Cytotoxic Potential Evaluation of Innovative Pressurised Cyclic Solid–Liquid Extracts from Withania somnifera" Plants 15, no. 7: 1027. https://doi.org/10.3390/plants15071027
APA StyleCulurciello, R., Power, K., Esposito, S., Di Nardo, I., Landi, S., De Vico, G., Palatucci, D., Pizzo, E., Naviglio, D., & Zarrelli, A. (2026). Cytotoxic Potential Evaluation of Innovative Pressurised Cyclic Solid–Liquid Extracts from Withania somnifera. Plants, 15(7), 1027. https://doi.org/10.3390/plants15071027

