Rooting Ability of Eucalyptus dunnii Maiden Mini-Cuttings Is Conditioned by Stock Plant Nighttime Temperature
Abstract
1. Introduction
2. Results
2.1. Anatomy
2.2. Branching and Rooting
2.3. Carbohydrates
2.4. Nutrient Profile
2.5. Gene Expression Analysis
3. Discussion
3.1. Anatomy
3.2. General Productivity
3.3. Carbohydrates
3.4. Mineral Nutrition
3.5. Gene Expression
4. Materials and Methods
4.1. Plant Material, Growing Conditions, and Sampling
4.2. Anatomical Analysis
4.3. Soluble Sugar Quantification
4.4. Starch Quantification
4.5. Leaf Mineral Status
4.6. Gene Expression Analysis
4.7. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Florence, R.G. Ecology and Silviculture of Eucalypt Forests; CSIRO Publishing: Collingwood, Australia, 2004. [Google Scholar]
- Vecchio, M.G.; Loganes, C.; Minto, C. Beneficial and healthy properties of Eucalyptus plants: A great potential use. Open Agric. J. 2016, 10, 52–57. [Google Scholar] [CrossRef] [Scilit]
- Assis, T.F.; Fett-Neto, A.G.; Alfenas, A.C. Current techniques and prospects for the clonal propagation of hardwoods with emphasis on Eucalyptus. In Plantation Forest Biotechnology for the 21th Century; Walter, C., Carson, M., Eds.; Research SignPost: New Delhi, India, 2004; pp. 303–333. [Google Scholar]
- Lee, S.H.; Lum, W.C.; Antov, P.; Krišťák, Ľ.; Rahandi Lubis, M.A.; Fatriasari, W. Eucalyptus Plantation Worldwide, Its Hybridization and Cloning Development. In Eucalyptus; Lee, S.H., Lum, W.C., Antov, P., Krišťák, Ľ., Rahandi Lubis, M.A., Fatriasari, W., Eds.; Springer: Singapore, 2024; pp. 1–15. [Google Scholar] [CrossRef] [Scilit]
- Baker, A.; Walker, S. Assessment of the relative amenability to vegetative propagation by leafy cuttings of 14 tropical and subtropical Eucalyptus and Corymbia species. In Plantation Technology in Tropical Forest Science; Springer: Tokyo, Japan, 2005; pp. 79–87. [Google Scholar] [CrossRef] [Scilit]
- Vilasboa, J.; Da Costa, C.T.; Fett-Neto, A.G. Environmental modulation of mini-clonal gardens for cutting production and propagation of hard- and easy-to-root Eucalyptus spp. Plants 2022, 11, 3281. [Google Scholar] [CrossRef] [Scilit]
- Griffin, A.R. Clones or improved seedlings of Eucalyptus? Not a simple choice. Int. For. Rev. 2014, 16, 216–224. [Google Scholar] [CrossRef] [Scilit]
- Li, S.W.; Xue, L.; Xu, S.; Feng, H.; An, L. Mediators, genes and signaling in adventitious rooting. Bot. Rev. 2009, 75, 230–247. [Google Scholar] [CrossRef] [Scilit]
- De Klerk, G.J.; Van Der Krieken, W.; De Jong, J.C. Review: The formation of adventitious roots—New concepts, new possibilities. Vitr. Cell. Dev. Biol. Plant 1999, 35, 189–199. [Google Scholar] [CrossRef] [Scilit]
- Da Costa, C.T.; De Almeida, M.R.; Ruedell, C.M.; Schwambach, J.; Maraschin, F.S.; Fett-Neto, A.G. When stress and development go hand in hand: Main hormonal controls of adventitious rooting in cuttings. Front. Plant Sci. 2013, 4, 133. [Google Scholar] [CrossRef] [Scilit]
- Ruedell, C.M.; De Almeida, M.R.; Schwambach, J.; Posenato, C.F.; Fett-Neto, A.G. Pre- and post-severance effects of light quality on carbohydrate dynamics and microcutting adventitious rooting of two Eucalyptus species of contrasting recalcitrance. Plant Growth Regul. 2013, 69, 235–245. [Google Scholar] [CrossRef] [Scilit]
- Menegolla, F.; Hansel, F.A.; Degenhardt, J.; Lazzarotto, M. Mini-cutting condition on the identification of rooting biomarkers in easy- and hard-to-root Ilex paraguariensis clones. Planta 2025, 261, 24. [Google Scholar] [CrossRef] [Scilit]
- De Almeida, M.R.; Aumond, M.; Da Costa, C.T.; Schwambach, J.; Ruedell, C.M.; Correa, L.R.; Fett-Neto, A.G. Environmental control of adventitious rooting in Eucalyptus and Populus cuttings. Trees 2017, 31, 1377–1390. [Google Scholar] [CrossRef] [Scilit]
- Trueman, S.J.; McMahon, T.V.; Bristow, M. Production of cuttings in response to stock plant temperature in the subtropical eucalypts Corymbia citriodora and Eucalyptus dunnii. New For. 2013, 44, 265–279. [Google Scholar] [CrossRef] [Scilit]
- Tombesi, S.; Cincera, I.; Frioni, T.; Ughini, V.; Gatti, M.; Palliotti, A.; Poni, S. Relationship among night temperature, carbohydrate translocation and inhibition of grapevine leaf photosynthesis. Environ. Exp. Bot. 2019, 157, 293–298. [Google Scholar] [CrossRef] [Scilit]
- Druege, U.; Hilo, A.; Pérez-Pérez, J.M.; Klopotek, Y.; Acosta, M.; Shahinnia, F.; Hajirezaei, M.R. Molecular and physiological control of adventitious rooting in cuttings: Phytohormone action meets resource allocation. Ann. Bot. 2019, 123, 929–949. [Google Scholar] [CrossRef] [Scilit]
- Flexas, J.; Badger, M.; Chow, W.S.; Medrano, H.; Osmond, C.B. Analysis of the relative increase in photosynthetic O2 uptake when photosynthesis in grapevine leaves is inhibited following low night temperatures and/or water stress. Plant Physiol. 1999, 121, 675–684. [Google Scholar] [CrossRef] [Scilit]
- Bertamini, M.; Muthuchelian, K.; Rubinigg, M.; Zorer, R.; Nedunchezhian, N. Low-night temperature-induced changes of photosynthesis in grapevine (Vitis vinifera L.) plants. Plant Physiol. Biochem. 2005, 43, 693–699. [Google Scholar] [CrossRef] [Scilit]
- Alvarado-Sanabria, O.H.; Garcés-Varón, G.A.; Restrepo-Díaz, H. The effects of night-time temperatures on physiological and biochemical traits in rice. Not. Bot. Horti Agrobot. 2017, 45, 157–163. [Google Scholar] [CrossRef] [Scilit]
- Schilisting, T.; Sa, A.C.S.; da Silva Filho, D.P.; da Silva, V.M.; Navroski, M.C.; de Oliveira Pereira, M.; Nascimento, B.; Moraes, C.; de Andrade, R.S.; Estopa, R.A.; et al. Developmental and physiological effects of the light source and cultivation environment on mini cuttings of Eucalyptus dunnii Maiden. Forests 2025, 16, 901. [Google Scholar] [CrossRef] [Scilit]
- Franklin, K.A.; Lee, S.H.; Patel, D.; Kumar, S.V.; Spartz, A.; Gu, C.; Ye, S.; Yu, P.; Breen, G.; Cohen, J.D.; et al. Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high temperature. Proc. Natl. Acad. Sci. USA 2011, 108, 20231–20235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Delker, C.; van Zanten, M.; Quint, M. Thermosensing enlightened. Trends Plant Sci. 2017, 22, 185–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Batista, A.F.; Santos, G.A.; Silva, L.D.; Quevedo, F.F.; Assis, T.F. The use of minitunnels and the effects of seasonality in the clonal propagation of Eucalyptus in a subtropical environment. Aust. For. 2015, 78, 65–72. [Google Scholar] [CrossRef] [Scilit]
- Eliyahu, A.; Duman, Z.; Sherf, S.; Genin, O.; Cinnamon, Y.; Abu-Abied, M.; Sadot, E. Vegetative propagation of elite Eucalyptus clones as food source for honeybees (Apis mellifera): Adventitious roots versus callus formation. Isr. J. Plant Sci. 2020, 67, 83–97. [Google Scholar] [CrossRef] [Scilit]
- Rossi, S.; Isabel, N. Bud break responds more strongly to daytime than night-time temperature under asymmetric experimental warming. Glob. Change Biol. 2017, 23, 446–454. [Google Scholar] [CrossRef] [Scilit]
- Rolland, F.; Baena-Gonzalez, E.; Sheen, J. Sugar sensing and signaling in plants: Conserved and novel mechanisms. Annu. Rev. Plant Biol. 2006, 57, 675–709. [Google Scholar] [CrossRef] [Scilit]
- Mishra, B.S.; Singh, M.; Aggrawal, P.; Laxmi, A. Glucose and auxin signaling interaction in controlling Arabidopsis thaliana seedling root growth and development. PLoS ONE 2009, 4, e4502. [Google Scholar] [CrossRef] [Scilit]
- Domingues-Junior, A.P.; Daloso, D.D.M.; Machado, M.; Rosado-Souza, L.; de Souza, L.P.; Fernie, A.R.; Mazzafera, P. A cold change: How short low temperature exposure affects primary metabolism in leaves and stems of two Eucalyptus species. Theor. Exp. Plant Physiol. 2019, 31, 429–444. [Google Scholar] [CrossRef] [Scilit]
- Miao, M.; Xu, X.; Chen, X.; Xue, L.; Cao, B. Cucumber carbohydrate metabolism and translocation under chilling night temperature. J. Plant Physiol. 2007, 164, 621–628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cunha, A.C.; Paiva, H.N.; Xavier, A.; Otoni, W.C. The role of mineral nutrition on adventitious rooting in woody plant species. Pesq. Flor. Bras. 2009, 58, 35. [Google Scholar] [CrossRef] [Scilit]
- Schwambach, J.; Fadanelli, C.; Fett-Neto, A.G. Mineral nutrition and adventitious rooting in microcuttings of Eucalyptus globulus. Tree Physiol. 2005, 25, 487–494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oberschelp, G.P.J.; Gonçalves, A.N. Assessing the effects of basal media on the in vitro propagation and nutritional status of Eucalyptus dunnii Maiden. Vitr. Cell. Dev. Biol. Plant 2016, 52, 28–37. [Google Scholar] [CrossRef] [Scilit]
- Marschner, H. Mineral Nutrition of Higher Plants, 2nd ed.; Academic Press: San Diego, CA, USA, 1995. [Google Scholar]
- Sharma, P.N.; Kumar, P.; Tewari, R.K. Early signs of oxidative stress in wheat plants subjected to zinc deficiency. J. Plant Nutr. 2004, 27, 451–463. [Google Scholar] [CrossRef] [Scilit]
- Dell, B.; Wilson, S.A. Effect of zinc supply on growth of three species of Eucalyptus seedlings and wheat. Plant Soil 1985, 88, 377–384. [Google Scholar] [CrossRef] [Scilit]
- Blazich, F.A. Mineral nutrition and adventitious rooting. In Adventitious Root Formation in Cuttings, Advances in Plant Sciences Series; Davis, T., Haissig, B.E., Sankhla, N., Eds.; Dioscorides Press: Portland, OR, USA, 1988; Volume 2, pp. 61–69. [Google Scholar]
- Morgan, M.J.; Lehmann, M.; Schwarzländer, M.; Baxter, C.J.; Sienkiewicz-Porzucek, A.; Williams, T.C.; Finkemeier, I. Decrease in manganese superoxide dismutase leads to reduced root growth and affects tricarboxylic acid cycle flux and mitochondrial redox homeostasis. Plant Physiol. 2008, 147, 101–114. [Google Scholar] [CrossRef] [Scilit]
- Requesens, D.; Malone, R.P.; Dix, P. Expression of a barley peroxidase in transgenic apple (Malus domestica L.) results in altered growth, xylem formation and tolerance to heat stress. J. Plant Sci. 2014, 9, 58–66. [Google Scholar] [CrossRef] [Scilit]
- Steffens, B.; Rasmussen, A. The physiology of adventitious roots. Plant Physiol. 2016, 170, 603–617. [Google Scholar] [CrossRef] [Scilit]
- Druege, U.; Franken, P.; Hajirezaei, M.R. Plant hormone homeostasis, signaling, and function during adventitious root formation in cuttings. Front. Plant Sci. 2016, 7, 381. [Google Scholar] [CrossRef] [Scilit]
- Druege, U.; Franken, P.; Lischewski, S.; Ahkami, A.H.; Zerche, S.; Hause, B.; Hajirezaei, M.R. Transcriptomic analysis reveals ethylene as stimulator and auxin as regulator of adventitious root formation in petunia cuttings. Front. Plant Sci. 2014, 5, 494. [Google Scholar] [CrossRef] [Scilit]
- De Almeida, M.R.; de Bastiani, D.; Gaeta, M.L.; de Araújo Mariath, J.E.; de Costa, F.; Retallick, J.; Fett-Neto, A.G. Comparative transcriptional analysis provides new insights into the molecular basis of adventitious rooting recalcitrance in Eucalyptus. Plant Sci. 2015, 239, 155–165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dharmasiri, N.; Dharmasiri, S.; Weijers, D.; Lechner, E.; Yamada, M.; Hobbie, L.; Estelle, M. Plant development is regulated by a family of auxin receptor F box proteins. Dev. Cell 2005, 9, 109–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johansen, D. Plant Microtechnique; McGraw-Hill: New York, NY, USA, 1940. [Google Scholar]
- D’Ambrogio de Argüeso, A. Manual de Técnicas en Histología Vegetal; Hemisferio Sur: Buenos Aires, Argentina, 1986. [Google Scholar]
- DuBois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef] [Scilit]
- McCready, R.M.; Guggolz, J.; Silviera, V.; Owens, H.S. Determination of starch and amylose in vegetables. Anal. Chem. 1950, 22, 1156–1158. [Google Scholar] [CrossRef] [Scilit]
- Murphy, J.; Riley, J.P. A modified single solution method for determination of phosphate in natural waters. Anal. Chim. Acta 1962, 27, 31–36. [Google Scholar] [CrossRef] [Scilit]
- Malavolta, E.; Vitti, G.C.; De Oliveira, S.A. Avaliação do Estado Nutricional das Plantas: Princípios e Aplicações, 2nd ed.; Associação Brasileira para Pesquisa da Potassa e do Fosfato: Piracicaba, Brazil, 1997. [Google Scholar]
- Isaac, R.A.; Kerber, J.D. Atomic absorption and flame photometry: Techniques and uses in soil, plant, and water analysis. In Instrumental Methods for Analysis of Soil and Plant Tissues; Walsh, L.M., Ed.; SSSA: Madison, WI, USA, 1971; pp. 17–37. [Google Scholar]
- De Almeida, M.R.; Ruedell, C.M.; Ricachenevsky, F.K.; Sperotto, R.A.; Pasquali, G.; Fett-Neto, A.G. Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill. BMC Mol. Biol. 2010, 11, 73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perkins, J.R.; Dawes, J.M.; McMahon, S.B.; Bennett, D.L.H.; Orengo, C.; Kohl, M. ReadqPCR and NormqPCR: R packages for the reading, quality checking and normalization of RT-qPCR quantification cycle (Cq) data. BMC Genom. 2012, 13, 296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ritz, C.; Spiess, A.N. qpcR: An R package for sigmoidal model selection in quantitative real-time polymerase chain reaction analysis. Bioinformatics 2008, 24, 1549–1551. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- R Core Team. R: A Language and Environment for Statistical Computing; The R Foundation: Kaysville, UT, USA, 2017; Available online: https://www.R-project.org (accessed on 1 March 2019).
- Lenth, R.V. Least-Squares Means: The R Package lsmeans. J. Stat. Softw. 2016, 69, 1–33. [Google Scholar] [CrossRef] [Scilit]





| Stock Plant | Mini-Cuttings | |
|---|---|---|
| Photoperiod (day/night) | 12/12 | 12/12 |
| Humidity (%) | 62.4 ± 10.9 | 92.7 ± 5.6 |
| Chamber temperature (day/night °C) | Δ0: 25.2 ± 2.2/25.4 ± 1.0 Δ10: 24.8 ± 3.0/16.7 ± 1.7 | 21.3 ± 1.6 |
| Bottom heat (°C) | OFF | ON at 22.2 ± 0.2 |
| Light flux quality (µmol m−2 s−1) | 340—Full Spectrum | 100—Full Spectrum |
| Gene Symbol | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
|---|---|---|
| H2B | CGTCTCAGAAGGGACCAAGG | ACGGGTAACACACAACTTCC |
| ACT2 | GCACCGCCAGAGAGGAAATA | CGACTTTGTTGGATTTAGAAGCAC |
| PIN1 | TTTGCCCATAACGCTCGTCT | CACCATCCCACCATGTCCAA |
| DAO | AGTGATGGACAAGTCGGGTT | GCTGCCTTCTTTGGACTCAAC |
| TIR1 | GTGGCACTATGGTGTGGTGA | AGCTCAGCCAAGTGCAAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Nión, M.; Ross, S.; González-Tálice, J.; Torres, L.; Bottarro, S.; Sotelo-Silveira, M.; Píriz-Pezzutto, S.; Antonelo, F.A.; Fett-Neto, A.G. Rooting Ability of Eucalyptus dunnii Maiden Mini-Cuttings Is Conditioned by Stock Plant Nighttime Temperature. Plants 2026, 15, 335. https://doi.org/10.3390/plants15020335
Nión M, Ross S, González-Tálice J, Torres L, Bottarro S, Sotelo-Silveira M, Píriz-Pezzutto S, Antonelo FA, Fett-Neto AG. Rooting Ability of Eucalyptus dunnii Maiden Mini-Cuttings Is Conditioned by Stock Plant Nighttime Temperature. Plants. 2026; 15(2):335. https://doi.org/10.3390/plants15020335
Chicago/Turabian StyleNión, Matías, Silvia Ross, Jaime González-Tálice, Leopoldo Torres, Sofía Bottarro, Mariana Sotelo-Silveira, Selene Píriz-Pezzutto, Fábio Antônio Antonelo, and Arthur Germano Fett-Neto. 2026. "Rooting Ability of Eucalyptus dunnii Maiden Mini-Cuttings Is Conditioned by Stock Plant Nighttime Temperature" Plants 15, no. 2: 335. https://doi.org/10.3390/plants15020335
APA StyleNión, M., Ross, S., González-Tálice, J., Torres, L., Bottarro, S., Sotelo-Silveira, M., Píriz-Pezzutto, S., Antonelo, F. A., & Fett-Neto, A. G. (2026). Rooting Ability of Eucalyptus dunnii Maiden Mini-Cuttings Is Conditioned by Stock Plant Nighttime Temperature. Plants, 15(2), 335. https://doi.org/10.3390/plants15020335

