Identification and Genome Characterization of Begomovirus and Satellite Molecules Associated with Lettuce (Lactuca sativa L.) Leaf Curl Disease
Abstract
1. Introduction
2. Results
2.1. Field Survey and Begomovirus Detection
2.2. Sequence Analysis of the Begomoviral Genome and Satellite DNA
2.3. Specific Detection of Virus and Satellite Molecules in Symptomatic Samples
3. Discussion
4. Materials and Methods
4.1. Field Investigation and Sample Collection
4.2. Begomovirus Detection
4.3. Cloning of the Begomoviral Genome and Satellite Molecules
4.4. Sequence Analysis
4.5. PCR Detection for Virus and Satellite Molecules
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Navas-Castillo, J.; Fiallo-Olivé, E.; Sánchez-Campos, S. Emerging virus diseases transmitted by whiteflies. Annu. Rev. Phytopathol. 2011, 49, 219–248. [Google Scholar] [CrossRef] [PubMed]
- Fiallo-Olivé, E.; Pan, L.L.; Liu, S.S.; Navas-Castillo, J. Transmission of begomoviruses and other whitefly-borne viruses: Dependence on the vector species. Phytopathology 2020, 110, 10–17. [Google Scholar] [CrossRef] [PubMed]
- Mansoor, S.; Briddon, R.W.; Zafar, Y.; Stanley, J. Geminivirus disease complexes: An emerging threat. Trends Plant Sci. 2003, 8, 128–134. [Google Scholar] [CrossRef] [PubMed]
- Brown, J.K.; Zerbini, F.M.; Navas-Castillo, J.; Moriones, E.; Ramos-Sobrinho, R.; Silva, J.C.; Fiallo-Olivé, E.; Briddon, R.W.; Hernández-Zepeda, C.; Idris, A.; et al. Revision of Begomovirus taxonomy based on pairwise sequence comparisons. Arch. Virol. 2015, 160, 1593–1619. [Google Scholar] [CrossRef]
- Hanley-Bowdoin, L.; Settlage, S.B.; Orozco, B.M.; Nagar, S.; Robertson, D. Geminiviruses: Models for plant DNA replication, transcription, and cell cycle regulation. Crit. Rev. Biochem. Mol. Biol. 2000, 2, 105–140. [Google Scholar] [CrossRef]
- Fiallo-Olivé, E.; Lett, J.M.; Martin, D.P.; Roumagnac, P.; Varsani, A.; Zerbini, F.M.; Castillo, J.N.; ICTV Report Consortium. ICTV Virus Taxonomy Profile: Geminiviridae 2021. J. Gen. Virol. 2021, 102, 001696. [Google Scholar] [CrossRef]
- Noueiry, A.O.; Lucas, W.J.; Gilbertson, R.L. Two proteins of a plant DNA virus coordinate nuclear and plasmodesmatal transport. Cell 1994, 76, 925–932. [Google Scholar] [CrossRef]
- Sanderfoot, A.A.; Ingham, D.J.; Lazarowitz, S.G. A viral movement protein as a nuclear shuttle. The geminivirus BR1 movement protein contains domains essential for interaction with BL1 and nuclear localization. Plant Physiol. 1996, 110, 23–33. [Google Scholar] [CrossRef][Green Version]
- Briddon, R.W.; Martin, D.P.; Roumagnac, P.; Navas-Castillo, J.; Fiallo-Olivé, E.; Moriones, E.; Lett, J.M.; Zerbini, M.; Varsani, A. Alphasatellitidae: A new family with two subfamilies for the classification of geminivirus- and nanovirus-associated alphasatellites. Arch. Virol. 2018, 163, 2587–2600. [Google Scholar] [CrossRef]
- Lozano, G.; Trenado, H.P.; Fiallo-Olivé, E.; Chirinos, D.; Geraud-Pouey, F.; Briddon, R.W.; Navas-Castillo, J. Characterization of non-coding DNA satellites associated with sweepoviruses (genus Begomovirus, Geminiviridae)-definition of a distinct class of begomovirus-associated satellites. Front. Microbiol. 2016, 7, 162. [Google Scholar] [CrossRef]
- Nawaz-Ul-Rehman, M.S.; Nahid, N.; Hassan, M.A.S.; Mubin, M. Betasatellites and deltasatelliles (Tolecusatellitidae). In Elsevier eBooks; Elsevier: Amsterdam, The Netherlands, 2021; pp. 239–246. [Google Scholar]
- Saunders, K.; Bedford, I.D.; Briddon, R.W.; Markham, P.G.; Wong, S.M.; Stanley, J. A unique virus complex causes Ageratum yellow vein disease. Proc. Natl. Acad. Sci. USA 2000, 97, 6890–6895. [Google Scholar] [CrossRef] [PubMed]
- Mulabagal, V.; Ngouajio, M.; Nair, A.; Zhang, Y.; Gottumukkala, A.L.; Nair, M.G. In vitro evaluation of red and green lettuce (Lactuca sativa) for functional food properties. Food Chem. 2010, 118, 300–306. [Google Scholar] [CrossRef]
- Moreno, A.; Fereres, A. Virus diseases in lettuce in the Mediterranean basin. Adv. Virus Res. 2012, 84, 247–288. [Google Scholar]
- Moreno, A.; Blas, C.; Biurrun, R.; Nebreda, M.; Palacios, I.; Duque, M.; Fereres, A. The incidence and distribution of viruses infecting lettuce, cultivated Brassica and associated natural vegetation in Spain. Ann. Appl. Biol. 2004, 144, 339–346. [Google Scholar] [CrossRef]
- Karapetsi, L.; Chatzivaailiou, E.K.; Katis, N.I.; Maliogka, V. Artichoke yellow ringspot virus as the causal agent of a new viral disease of lettuce: Epidemiology and molecular variability. Plant Pathol. 2020, 70, 594–603. [Google Scholar] [CrossRef]
- Roggero, P.; Lot, H.; Souche, S.; Lenzi, R.; Milne, R.G. Occurrence of Mirafiori lettuce virus and Lettuce big-vein virus in relation to development of big-vein symptoms in lettuce crops. Eur. J. Plant Pathol. 2003, 109, 261–267. [Google Scholar] [CrossRef]
- Duffus, J.E.; Liu, H.Y.; Wisler, G.C.; Li, R.H. Lettuce chlorosis virus: A new whitefly-transmitted closterovirus. Eur. J. Plant Pathol. 1996, 102, 591–596. [Google Scholar] [CrossRef]
- Nebreda, M.; Moreno, A.; Pérez, N.; Palacios, I.; Seco Fernández, M.V.; Fereres, A. Activity of aphids associated with lettuce and broccoli in Spain and their efficiency as vector of Lettuce mosaic virus. Virus Res. 2004, 100, 83–88. [Google Scholar] [CrossRef]
- Zhang, Y.; Xie, Z.; Fletcher, J.D.; Wang, Y.; Wang, R.; Guo, Z.; He, Y. Rapid and sensitive detection of lettuce necrotic yellows virus and cucumber mosaic virus infecting lettuce (lactuca sativa l.) by reverse transcription loop-mediated isothermal amplification. Plant Pathol. J. 2020, 36, 76–86. [Google Scholar] [CrossRef]
- Ciuffo, M.; Mammella, M.; Vallino, M.; Caciagli, P.; Turina, M. Molecular identification and biological characterization of a new potyvirus in lettuce. Arch. Virol. 2006, 161, 2549–2554. [Google Scholar] [CrossRef]
- Dizadji, A.; Koohi-Habibi, M.; Izadpanah, K.; Dietrich, C.; Mossahebi, G.H.; Winter, S. Characterisation of lettuce virus X, a new potexvirus infecting lettuce in Iran. Arch. Virol. 2008, 153, 1867–1875. [Google Scholar] [CrossRef] [PubMed]
- Sasaya, T.; Fujii, H.; Ishikawa, K.; Koganezawa, H. Further evidence of Mirafiori lettuce big-vein virus but not of Lettuce big-vein associated virus with big-vein disease in lettuce. Phytopathology 2008, 98, 464–468. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Yardimci, N.; Kiliç, H.C. Tomato spotted wilt virus in vegetable growing areas in the west Mediterranean region of Turkey. Afr. J. Biotechnol. 2009, 8, 4539–4541. [Google Scholar]
- Sanchez, F.; Rodriguez-Mateos, M.; Tourino, A.; Fresno, J.; Gomez-Campo, C.; Jenner, C.E.; Walsh, J.A.; Ponz, F. Identification of new isolates of Turnip mosaic virus that cluster with less common viral strains. Arch. Virol. 2007, 152, 1061–1068. [Google Scholar] [CrossRef]
- Ribeiro-Junior, M.R.; Cruciol, G.C.D.; Moura, M.F.; Marchi, B.R.D.; Pavan, M.A.; Krause-Sakate, R. First report of turnip mosaic virus naturally infecting lettuce and chard plants in brazil. J. Plant Pathol. 2019, 101, 189. [Google Scholar] [CrossRef]
- Abtahi, F.S.; Koohi-Habibi, M. Host range and some characterization of Tobacco streak virus isolated from lettuce in Iran. Afr. J. Biotechnol. 2008, 7, 4260–4264. [Google Scholar]
- Hu, T.; Song, Y.; Wang, Y.Q.; Zhou, X.P. Functional analysis of a novel βV1 gene identified in a geminivirus betasatellite. Sci. China Life Sci. 2020, 63, 688–696. [Google Scholar] [CrossRef]
- Briddon, R.W.; Brown, J.K.; Moriones, E.; Stanley, J.; Zerbini, M.; Zhou, X.P.; Fauquet, C.M. Recommendations for the classification and nomenclature of the DNA-β satellites of begomoviruses. Arch. Virol. 2008, 153, 763–781. [Google Scholar] [CrossRef]
- Kenyon, L.; Tsai, W.S.; Shih, S.L.; Lee, L.M. Emergence and diversity of begomoviruses infecting solanaceous crops in East and Southeast Asia. Virus Res. 2014, 186, 104–113. [Google Scholar] [CrossRef]
- Nagendran, K.; Mohankumar, S.; Aravintharaj, R.; Balaji, C.G.; Manoranjitham, S.K.; Singh, A.K.; Rai, A.B.; Karthikeyan, G. The occurrence and distribution of major viruses infecting cucurbits in Tamil Nadu state, India. Crop Prot. 2017, 99, 10–16. [Google Scholar] [CrossRef]
- Charoenvilaisiri, S.; Seepoban, C.; Phironrit, N.; Phuangrat, B.; Yoohat, K.; Deeto, R.; Chatchawankanphanich, O.; Gajanandana, O. Occurrence and distribution of begomoviruses infecting tomatoes, peppersand cucurbits in Thailand. Crop Prot. 2020, 127, 104948. [Google Scholar] [CrossRef]
- Li, F.F.; Qiao, R.; Wang, Z.Q.; Yang, X.L.; Zhou, X.P. Occurrence and distribution of geminiviruses in China. Sci. China Life Sci. 2022, 65, 1498–1503. [Google Scholar] [CrossRef] [PubMed]
- Li, F.F.; Qiao, R.; Yang, X.L.; Gong, p.; Zhou, X.P. Occurrence, distribution, and management of tomato yellow leaf curl virus in China. Phytopathol. Res. 2022, 4, 28. [Google Scholar] [CrossRef]
- Wyatt, S.D.; Brown, J.K. Detection of subgroup III Geminivirus isolates in leaf extracts by degenerate primers and polymerase chain reaction. Phytopathology 1996, 12, 1288–1293. [Google Scholar] [CrossRef]
- He, Z.F.; Yu, H.; Luo, F.F. Detection of Whitefly-transmitted Geminiviruses from Tomato by PCR. Virol. Sin. 2004, 1, 67–69. (In Chinese) [Google Scholar]
- Briddon, R.W.; Bull, S.E.; Mansoor, S.; Amin, I.; Markham, P.G. Universal primers for the PCR-mediated amplification of DNA β; a molecule associated with some monopartite begomoviruses. Mol. Biotechnol. 2002, 20, 315–318. [Google Scholar] [CrossRef]
- Muhire, B.; Varsani, A.; Martin, D.P. SDT: A virus classification tool based on pairwise sequence alignment and identity calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Peterson, D.S.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′–3′) | Target | Annealing Temperature (°C) | Size (bp) |
---|---|---|---|---|
PepLCYnV-F | TGCCAGGGATTATGTCGAAG | PepLCYnV | 54 | 729 |
PepLCYnV-R | CAGGATTACTCGCATGAGTAG | |||
beta-F | CCCCTACATCTATATCTTCTACTG | ToLCCNB | 53 | 641 |
beta-R | GCGCTCCCTTTTGTTTCTTAAA | |||
alpha1-F | TTTCACCGTCTTCTTCCTTTCTG | AYVA | 53 | 527 |
alpha1-R | GACCATACACCCAGAAGATAGTG | |||
alpha2-F | GGCTGCCCTTAAGAGTGTAT | PepLCYnA | 53 | 797 |
alpha2-R | CTAGGGCATCAATAAACCCAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, Y.; Du, M.; Li, Z.; Yu, L.; Lan, G.; Ding, S.; Farooq, T.; He, Z.; She, X. Identification and Genome Characterization of Begomovirus and Satellite Molecules Associated with Lettuce (Lactuca sativa L.) Leaf Curl Disease. Plants 2025, 14, 782. https://doi.org/10.3390/plants14050782
Tang Y, Du M, Li Z, Yu L, Lan G, Ding S, Farooq T, He Z, She X. Identification and Genome Characterization of Begomovirus and Satellite Molecules Associated with Lettuce (Lactuca sativa L.) Leaf Curl Disease. Plants. 2025; 14(5):782. https://doi.org/10.3390/plants14050782
Chicago/Turabian StyleTang, Yafei, Mengdan Du, Zhenggang Li, Lin Yu, Guobing Lan, Shanwen Ding, Tahir Farooq, Zifu He, and Xiaoman She. 2025. "Identification and Genome Characterization of Begomovirus and Satellite Molecules Associated with Lettuce (Lactuca sativa L.) Leaf Curl Disease" Plants 14, no. 5: 782. https://doi.org/10.3390/plants14050782
APA StyleTang, Y., Du, M., Li, Z., Yu, L., Lan, G., Ding, S., Farooq, T., He, Z., & She, X. (2025). Identification and Genome Characterization of Begomovirus and Satellite Molecules Associated with Lettuce (Lactuca sativa L.) Leaf Curl Disease. Plants, 14(5), 782. https://doi.org/10.3390/plants14050782