Molecular Mechanisms of Gene Expression Regulation in Response to Heat Stress in Hemerocallis fulva
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Heat Treatments
2.2. Determination of Physiological Indexes of H. fulva Under Heat Stress
2.3. Transcriptome Sequencing
2.4. Transcriptome Data Analysis
2.5. H. fulva Heat-Tolerance-Related Gene Analysis
2.6. WGCNA Analysis
2.7. Real-Time Fluorescence Quantitative PCR (qRT-PCR) Analysis
3. Results
3.1. The Effect of Heat Stress on Physiological Indices of H. fulva
3.2. H. fulva Heat Stress Transcriptome Sequencing
3.3. Enrichment of Heat-Tolerance-Related Genes in H. fulva
3.4. WGCNA Analysis Identified Key Genes for Heat Tolerance in H. fulva
3.4.1. Weighted Gene Co-Expression Network Construction and Module Functional Enrichment Analysis
3.4.2. Core Gene Identification
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Hatfield, J.L.; Prueger, J.H. Temperature extremes: Effect on plant growth and development. Weather. Clim. Extrem. 2015, 10, 4–10. [Google Scholar] [CrossRef]
- Singh, A.K.; Mishra, P.; Kashyap, S.P.; Karkute, S.G.; Singh, P.M.; Rai, N.; Bahadur, A.; Behera, T.K. Molecular insights into mechanisms underlying thermo-tolerance in tomato. Front. Plant Sci. 2022, 13, 1040532. [Google Scholar] [CrossRef] [PubMed]
- Aguirre-Becerra, H.; Feregrino-Perez, A.A.; Esquivel, K.; Perez-Garcia, C.E.; Vazquez-Hernandez, M.C.; Mariana-Alvarado, A. Nanomaterials as an alternative to increase plant resistance to abiotic stresses. Front. Plant Sci. 2022, 13, 1023636. [Google Scholar] [CrossRef] [PubMed]
- Gahlot, T.K. International Year of Camelids, 2024. J. Camel Pract. Res. 2020, 27, IV–V. [Google Scholar]
- Efeolu, B. Heat Shock Proteins and Heat Shock Response in Plants. Gazi Univ. J. Sci. 2010, 22, 67–75. [Google Scholar]
- Xie, H.; Wan, L.; Han, J.; Huang, C.; Li, J.; Yao, Q.; Yang, P.; Zhang, Y.; Gong, Z.; Yu, H. TMT-based proteomic and transcriptomic analysis reveal new insights into heat stress responsive mechanism in edible mushroom Grifola frondosa. Sci. Hortic. 2024, 323, 112542. [Google Scholar] [CrossRef]
- Sharkey, T.D.; Zhang, R. High temperature effects on electron and proton circuits of photosynthesis. J. Integr. Plant Biol. 2010, 52, 712–722. [Google Scholar] [CrossRef]
- Soengas, P.; Rodríguez, V.M.; Velasco, P.; Cartea, M.E. Effect of Temperature Stress on Antioxidant Defenses in Brassica oleracea. ACS Omega 2018, 3, 5237–5243. [Google Scholar] [CrossRef]
- Ren, Y.; Gao, Y.; Zhang, Q. Morning and evening alarm of the circadian clock for flower opening times in Hemerocallis. Plant Sci. 2021, 311, 110992. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.P.; Peng, T.; Zeng, Y.Y.; Cai, Y.Q.; Zuo, Q.; Zhang, L.; Dong, S.S.; Liu, Y. Chromosome-level genome assembly of Niphotrichum japonicum provides new insights into heat stress responses in mosses. Front. Plant Sci. 2023, 14, 1271357. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Zhang, G.L.; Zhao, Y.Q.; Gu, L.Q.; Wang, Y.; Yu, X.H.; Abdullah, S. Hub Gene Identification and Heat-Stress-Related Transcriptional Regulation Mechanism in Cabbage (Brassica oleracea L.). Horticulturae 2023, 9, 977. [Google Scholar] [CrossRef]
- Zheng, X.; Zhu, Q.; Liu, Y.; Chen, J.; Wang, L.; Xiu, Y.; Zheng, H.; Lin, S.; Ling, P.; Tang, M. Combined Analysis of Transcriptome and Metabolome Provides Insights in Response Mechanism under Heat Stress in Avocado (Persea americana Mill.). Int. J. Mol. Sci. 2024, 25, 312. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Li, P.L.; Tu, S.; Feng, N.X.; Chang, L.Y.; Niu, Q.L. Integrated Analysis of the Transcriptome and Metabolome of Brassica rapa Revealed Regulatory Mechanism under Heat Stress. Int. J. Mol. Sci. 2023, 24, 13993. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.H.; Yin, W.L.; Xia, X.L. Transcriptome Profiles of Populus euphratica upon Heat Shock stress. Curr. Genom. 2014, 15, 326–340. [Google Scholar] [CrossRef] [PubMed]
- Seni, S.; Kaur, S.; Malik, P.; Yadav, I.S.; Sirohi, P.; Chauhan, H.; Kaur, A.; Chhuneja, P. Transcriptome based identification and validation of heat stress transcription factors in wheat progenitor species Aegilops speltoides. Sci. Rep. 2021, 11, 22049. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Chen, Y.; Ye, M.H.; Wang, D.D.; Chen, Q. Evolutionary history of the heat shock protein 90 (Hsp90) family of 43 plants and characterization of Hsp90s in Solanum tuberosum. Mol. Biol. Rep. 2020, 47, 6679–6691. [Google Scholar] [CrossRef]
- Jackson, S.E. Small Heat-Shock Proteins: Paramedics of the Cell. In Molecular Chaperones; Jackson, S., Ed.; Springer: Berlin/Heidelberg, Germany, 2013; Volume 328, pp. 69–98. [Google Scholar]
- Kan, Y.; Mu, X.R.; Gao, J.; Lin, H.X.; Lin, Y. The molecular basis of heat stress responses in plants. Mol. Plant 2023, 16, 1612–1634. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.-L.; Zhu, J.-H.; Zhang, Q.-Q.; Cai, Y.-B. Molecular characterization of an ethephon-induced Hsp70 involved in high and low-temperature responses in Hevea brasiliensis. Plant Physiol. Biochem. 2009, 47, 954–959. [Google Scholar] [CrossRef] [PubMed]
- El-Sappah, A.H.; Rather, S.A.; Wani, S.H.; Elrys, A.S.; Bilal, M.; Huang, Q.L.; Dar, Z.A.; Elashtokhy, M.M.A.; Soaud, N.; Koul, M.; et al. Heat Stress-Mediated Constraints in Maize (Zea mays) Production: Challenges and Solutions. Front. Plant Sci. 2022, 13, 879366. [Google Scholar] [CrossRef] [PubMed]
- Singh, M.B.; Lohani, N.; Bhalla, P.L. The Role of Endoplasmic Reticulum Stress Response in Pollen Development and Heat Stress Tolerance. Front. Plant Sci. 2021, 12, 661062. [Google Scholar] [CrossRef]
- Sun, A.Z.; Guo, F.Q. Chloroplast Retrograde Regulation of Heat Stress Responses in Plants. Front. Plant Sci. 2016, 7, 398. [Google Scholar] [CrossRef] [PubMed]
- Kaur, M.; Karnwal, A. Screening of plant growth-promoting attributes bearing endogenous bacteria from abiotic stress resisting high altitude plants. J. Agric. Food Res. 2023, 11, 100489. [Google Scholar] [CrossRef]
- Eid, A.M.; Fouda, A.; Abdel-Rahman, M.A.; Salem, S.S.; Elsaied, A.; Oelmüller, R.; Hijri, M.; Bhowmik, A.; Elkelish, A.; Hassan, S.E.D. Harnessing Bacterial Endophytes for Promotion of Plant Growth and Biotechnological Applications: An Overview. Plants 2021, 10, 935. [Google Scholar] [CrossRef] [PubMed]
- van Doorn, W.G.; Van Meeteren, U. Flower opening and closure: A review. J. Exp. Bot. 2003, 54, 1801–1812. [Google Scholar] [CrossRef] [PubMed]
- Kao, F.J.; Chiang, W.D.; Liu, H.M. Inhibitory effect of daylily buds at various stages of maturity on nitric oxide production and the involved phenolic compounds. LWT-Food Sci. Technol. 2015, 61, 130–137. [Google Scholar] [CrossRef]
- Ma, Y.M.; Zhou, J.L.; Hu, Z.; Zhong, J.; Zhu, J.Z. First Report of Epicoccum sorghinum Causing Leaf Spot on Hemerocallis citrina in China. Plant Dis. 2021, 105, 2251. [Google Scholar] [CrossRef]
- Lin, S.H.; Chang, H.C.; Chen, P.J.; Hsieh, C.L.; Su, K.P.; Sheen, L.Y. The Antidepressant-like Effect of Ethanol Extract of Daylily Flowers (Jīn Zhēn Huā) in Rats. J. Tradit. Complement. Med. 2013, 3, 53–61. [Google Scholar] [CrossRef]
- Zhao, R.; Luo, J.; Xu, B. Insights into secondary metabolites and health promoting effects of edible flower Hemerocallis citrina Baroni. J. Funct. Foods 2024, 116, 106133. [Google Scholar] [CrossRef]
- Sun, J.; Liu, W.; Zhang, M.; Geng, P.; Shan, Y.; Li, G.; Zhao, Y.; Chen, P. The analysis of phenolic compounds in daylily using UHPLC-HRMSn and evaluation of drying processing method by fingerprinting and metabolomic approaches. J. Food Process. Preserv. 2017, 42, e13325. [Google Scholar] [CrossRef]
- Yan, J.; Ma, H.; Lai, X.; Wu, J.; Zhang, Y. Artemisinin Attenuated Oxidative Stress and Apoptosis by Inhibiting Autophagy in MPP+-treated SH-SY5Y Cell. J. Biol. Res. Thessalon. 2021, 28, 6. [Google Scholar] [CrossRef] [PubMed]
- Huan, X.; Wang, X.; Zou, S.; Zhao, K.; Han, Y.; Wang, S. Transcription Factor ERF194 Modulates the Stress-Related Physiology to Enhance Drought Tolerance of Poplar. Int. J. Mol. Sci. 2023, 24, 788. [Google Scholar] [CrossRef]
- Abrahám, E.; Hourton-Cabassa, C.; Erdei, L.; Press, L.S.J.H. Methods for determination of proline in plants. In Plant Stress Tolerance: Methods and Protocols; Humana Press: Totowa, NJ, USA, 2010. [Google Scholar]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.D.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef]
- Simao, F.A.; Waterhouse, R.M.; Ioannidis, P.; Kriventseva, E.V.; Zdobnov, E.M. BUSCO: Assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics 2015, 31, 3210–3212. [Google Scholar] [CrossRef] [PubMed]
- Deng, Y.Y.; Li, J.Q.; Wu, S.F.; Zhu, Y.P.; Cai, Y.W.; He, F.C. Integrated nr Database in Protein Annotation System and Its Localization. Comput. Eng. 2006, 32, 71–72. [Google Scholar]
- Apweiler, R.; Bairoch, A.; Wu, C.H.; Barker, W.C.; Boeckmann, B.; Ferro, S.; Gasteiger, E.; Huang, H.Z.; Lopez, R.; Magrane, M.; et al. UniProt: The Universal Protein knowledgebase. Nucleic Acids Res. 2004, 32, D115–D119. [Google Scholar] [CrossRef]
- Tatusov, R.L.; Galperin, M.Y.; Natale, D.A.; Koonin, E.V. The COG database: A tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res. 2000, 28, 33–36. [Google Scholar] [CrossRef] [PubMed]
- Koonin, E.V.; Fedorova, N.D.; Jackson, J.D.; Jacobs, A.R.; Krylov, D.M.; Makarova, K.S.; Mazumder, R.; Mekhedov, S.L.; Nikolskaya, A.N.; Rao, B.S.; et al. A comprehensive evolutionary classification of proteins encoded in complete eukaryotic genomes. Genome Biol. 2004, 5, R7. [Google Scholar] [CrossRef] [PubMed]
- Huerta-Cepas, J.; Szklarczyk, D.; Forslund, K.; Cook, H.; Heller, D.; Walter, M.C.; Rattei, T.; Mende, D.R.; Sunagawa, S.; Kuhn, M.; et al. eggNOG 4.5: A hierarchical orthology framework with improved functional annotations for eukaryotic, prokaryotic and viral sequences. Nucleic Acids Res. 2016, 44, D286–D293. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S.; Kawashima, S.; Okuno, Y.; Hattori, M. The KEGG resource for deciphering the genome. Nucleic Acids Res. 2004, 32, D277–D280. [Google Scholar] [CrossRef]
- Buchfink, B.; Xie, C.; Huson, D.H. Fast and sensitive protein alignment using DIAMOND. Nat. Methods 2015, 12, 59–60. [Google Scholar] [CrossRef]
- Xie, C.; Mao, X.Z.; Huang, J.J.; Ding, Y.; Wu, J.M.; Dong, S.; Kong, L.; Gao, G.; Li, C.Y.; Wei, L.P. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef] [PubMed]
- Jones, P.; Binns, D.; Chang, H.Y.; Fraser, M.; Li, W.Z.; McAnulla, C.; McWilliam, H.; Maslen, J.; Mitchell, A.; Nuka, G.; et al. InterProScan 5: Genome-scale protein function classification. Bioinformatics 2014, 30, 1236–1240. [Google Scholar] [CrossRef]
- Bateman, A.; Coin, L.; Durbin, R.; Finn, R.D.; Hollich, V.; Griffiths-Jones, S.; Khanna, A.; Marshall, M.; Moxon, S.; Sonnhammer, E.L.; et al. The Pfam protein families database. Nucleic Acids Res. 2008, 32, D138. [Google Scholar] [CrossRef] [PubMed]
- Bioinformatics, E.J. Profile hidden Markov models. Bioinformatics 1998, 14, 755–763. [Google Scholar]
- Leng, N.; Dawson, J.A.; Thomson, J.A.; Ruotti, V.; Rissman, A.I.; Smits, B.M.G.; Haag, J.D.; Gould, M.N.; Stewart, R.M.; Kendziorski, C. EBSeq: An empirical Bayes hierarchical model for inference in RNA-seq experiments. Bioinformatics 2013, 29, 1035–1043. [Google Scholar] [CrossRef]
- Langfelder, P.; Horvath, S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [PubMed]
- Natarajan, S. High Temperature Stress Responses of Salvia Splendens and Viola X Wittrockiana. Ph.D. Thesis, Louisiana State University, Baton Rouge, LA, USA, 2005. [Google Scholar]
- Suleman, P.; Redha, A.; Afzal, M.; Al-Hasan, R. Temperature-induced changes of malondialdehyde, heat-shock proteins in relation to chlorophyll fluorescence and photosynthesis in Conocarpus lancifolius (Engl.). Acta Physiol. Plant. 2013, 35, 1223–1231. [Google Scholar] [CrossRef]
- Huang, Y.C.; Qin, Y.X. Advances on Reactive Oxygen Species in Plants. Chin. Agric. Sci. Bull. 2012, 28, 219–226. [Google Scholar]
- Shang, Q.M.; Chen, S.F.; Zhang, Z.G. Regulation of Selenium on Antioxidative Enzymes Activity in Pepper Leaves under High Temperature Stress. Acta Hortic. Sin. 2005, 32, 35. [Google Scholar]
- Ben Salem, J.; Smiti, S.A.; Petrivalsky, M. Effects of high growth-medium temperature under controlled conditions on characteristics of tomato leaves. Biol. Plant. 2022, 66, 132–145. [Google Scholar] [CrossRef]
- Gong, M.; Jiang, D.; Liu, R.; Tian, S.; Xing, H.; Chen, Z.; Shi, R.; Li, H.L. Influence of High-Temperature and Intense Light on the Enzymatic Antioxidant System in Ginger (Zingiber officinale Roscoe) Plantlets. Metabolites 2023, 13, 992. [Google Scholar] [CrossRef]
- Du, X.H.; Zhu, X.P.; Yang, Y.P.; Wang, Y.L.; Arens, P.; Liu, H.C. De novo transcriptome analysis of Viola xwittrockiana exposed to high temperature stress. PLoS ONE 2019, 14, e0222344. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.Q.; Xiao, Y.; Chang, H.L.; Sun, S.R.; Wang, J.Q.; Liang, Q.G.; Wu, Q.D.; Wu, J.T.; Qin, Y.X.; Chen, J.L.; et al. The Regulatory Network of Sweet Corn (Zea mays L.) Seedlings under Heat Stress Revealed by Transcriptome and Metabolome Analysis. Int. J. Mol. Sci. 2023, 24, 845. [Google Scholar] [CrossRef]
- Tao, R.; Liu, Y.Q.; Jing, W.P. Response and Regulatory Network Analysis of Roots and Stems to Abiotic Stress in Populus trichocarpa. Forests 2022, 13, 1300. [Google Scholar] [CrossRef]
- Chen, S.; Li, H. Heat Stress Regulates the Expression of Genes at Transcriptional and Post-Transcriptional Levels, Revealed by RNA-seq in Brachypodium distachyon. Front. Plant Sci. 2016, 7, 2067. [Google Scholar] [CrossRef]
- Wu, L.S.; Liu, Y.; Liu, X.Y.; Li, Q.Y.; Yi, X.Y.; Chen, C.; Wang, L.; Liao, J.Y. Transcriptome Analysis Reveals Key Genes in Response to High-Temperature Stress in Rhododendron molle. Bioresources 2024, 19, 8238–8256. [Google Scholar] [CrossRef]
- Rossi, C.A.M.; Patel, D.N.; Castroverde, C.D.M. Distinct profiles of plant immune resilience revealed by natural variation in warm temperature-modulated disease resistance among Arabidopsis accessions. Plant Cell Environ. 2024, 47, 5115–5125. [Google Scholar] [CrossRef] [PubMed]
- Jin, J.; Yang, L.; Fan, D.Y.; Li, L.L.; Hao, Q. Integration analysis of miRNA-mRNA pairs between two contrasting genotypes reveals the molecular mechanism of jujube (Ziziphus jujuba Mill.) response to high-temperature stress. BMC Plant Biol. 2024, 24, 612. [Google Scholar] [CrossRef]
- Nozková, V.; Mieslerová, B.; Luhová, L.; Piterková, J.; Novák, O.; Spundová, M.; Lebeda, A. Effect of heat-shock pre-treatment on tomato plants infected by powdery mildew fungus. Plant Prot. Sci. 2019, 55, 31–42. [Google Scholar] [CrossRef]
- Lin, L.; Wu, J.; Jiang, M.; Wang, Y. Plant Mitogen-Activated Protein Kinase Cascades in Environmental Stresses. Int. J. Mol. Sci. 2021, 22, 1543. [Google Scholar] [CrossRef] [PubMed]
- Sewelam, N.; El-Shetehy, M.; Mauch, F.; Maurino, V.G. Combined Abiotic Stresses Repress Defense and Cell Wall Metabolic Genes and Render Plants More Susceptible to Pathogen Infection. Plants 2021, 10, 1946. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Li, J.; Zhang, R.; Lin, Y.; Xiong, A.; Tan, G.; Luo, Y.; Zhang, Y.; Chen, Q.; Wang, Y.; et al. Combined Analysis of the Metabolome and Transcriptome to Explore Heat Stress Responses and Adaptation Mechanisms in Celery (Apium graveolens L.). Int. J. Mol. Sci. 2022, 23, 3367. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Nahar, K.; Hossain, M.S.; Al Mahmud, J.; Rahman, A.; Inafuku, M.; Oku, H.; Fujita, M. Coordinated Actions of Glyoxalase and Antioxidant Defense Systems in Conferring Abiotic Stress Tolerance in Plants. Int. J. Mol. Sci. 2017, 18, 200. [Google Scholar] [CrossRef] [PubMed]
- Yeap, W.C.; Namasivayam, P.; Ooi, T.E.K.; Appleton, D.R.; Kulaveerasingam, H.; Ho, C.L. EgRBP42 from oil palm enhances adaptation to stress in Arabidopsis through regulation of nucleocytoplasmic transport of stress-responsive mRNAs. Plant Cell Environ. 2019, 42, 1657–1673. [Google Scholar] [CrossRef]
- Song, Y.; Zhu, Z.; Liu, K.; Zhao, Y.; Nie, Z.; Zhang, L.; Fahim, A.M.; Yang, X. Comparative Transcriptome Analysis Reveals Differential Gene Expression Pattern Associated with Heat Tolerance in Pepper Capsicum annuum L.). Horticulturae 2023, 9, 801. [Google Scholar] [CrossRef]
- He, X.W.; Wang, C.Z.; Wang, H.B.; Li, L.G.; Wang, C. The Function of MAPK Cascades in Response to Various Stresses in Horticultural Plants. Front. Plant Sci. 2020, 11, 952. [Google Scholar] [CrossRef] [PubMed]
- Alimohammadi, M.; de Silva, K.; Ballu, C.; Ali, N.; Khodakovskaya, M.V. Reduction of inositol (1,4,5)-trisphosphate affects the overall phosphoinositol pathway and leads to modifications in light signalling and secondary metabolism in tomato plants. J. Exp. Bot. 2012, 63, 825–835. [Google Scholar] [CrossRef]
Gene ID | Forward Primer | Reverse Primer |
---|---|---|
TRINITY_DN20076_c0_g1 | GCCGTCTCCGATGATGATGT | CAGGTCCTCAACGACAGCTT |
TRINITY_DN2594_c0_g1 | TTTTTGTTGCAGCGACCGAG | TTCGGGGAACTCGTTTCAGG |
TRINITY_DN2442_c0_g2 | GCCTTGCCAAAGTCTGTGTG | GTCATCGGCTGTGGGAGAAA |
TRINITY_DN4761_c3_g4 | CCGCTCCGGCACCTATTAAT | TGGCTCAGACCTTGATGCAG |
TRINITY_DN5736_c0_g3 | ATGGGCCATCTTCAAAGGGG | TTCCGGCAAAGAGACAGGAC |
TRINITY_DN7895_c0_g1 | TAACAATGCCAGGACGCACT | AGGCACGTTTCCTTTGTGGA |
TRINITY_DN10709_c0_g2 | TGGTAGCCTTCCCTCTCCTC | CATTTCACCTCCCCCTCCAC |
TRINITY_DN14615_c0_g1 | ATTGTTCGCACGTGATCCCT | AGACGACGGAACTTGTGCAT |
TRINITY_DN4552_c0_g1 | AACGTCGTCCTCCATGCATT | ACCACGACGAATTTGACCGA |
TRINITY_DN7055_c0_g3 | ACGGTCTTGGTCGCTCATTT | CGTGTTGCCATTGTTGGTGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chu, B.; Liu, W.; Li, J.; Zhang, X.; Li, P. Molecular Mechanisms of Gene Expression Regulation in Response to Heat Stress in Hemerocallis fulva. Plants 2025, 14, 690. https://doi.org/10.3390/plants14050690
Chu B, Liu W, Li J, Zhang X, Li P. Molecular Mechanisms of Gene Expression Regulation in Response to Heat Stress in Hemerocallis fulva. Plants. 2025; 14(5):690. https://doi.org/10.3390/plants14050690
Chicago/Turabian StyleChu, Boyan, Weixue Liu, Jinxia Li, Xiaofei Zhang, and Ping Li. 2025. "Molecular Mechanisms of Gene Expression Regulation in Response to Heat Stress in Hemerocallis fulva" Plants 14, no. 5: 690. https://doi.org/10.3390/plants14050690
APA StyleChu, B., Liu, W., Li, J., Zhang, X., & Li, P. (2025). Molecular Mechanisms of Gene Expression Regulation in Response to Heat Stress in Hemerocallis fulva. Plants, 14(5), 690. https://doi.org/10.3390/plants14050690