Development and Application of Pik Locus-Specific Molecular Markers for Blast Resistance Genes in Yunnan Japonica Rice Cultivars
by
, , ,
Pei Liu
1,†,
Wumin Zhou
1,2,†,‡,
Liying Dong
1,
Shufang Liu
1,
Gul Nawaz
1,
Liyu Huang
2 and
Qinzhong Yang
1,* 1
Key Laboratory of Green Prevention and Control of Agricultural Transboundary Pests of Yunnan Province, Agricultural Environment and Resources Institute, Yunnan Academy of Agricultural Sciences, Kunming 650205, China
2
School of Agriculture, Yunnan University, Kunming 650504, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
‡
Current address: Jingdong Yi Automonous Country Party Committee Publicity Department, Pu’er 676299, China.
Plants 2025, 14(4), 592; https://doi.org/10.3390/plants14040592
Submission received: 12 November 2024
/
Revised: 29 December 2024
/
Accepted: 13 January 2025
/
Published: 15 February 2025
(This article belongs to the Special Issue Plant Functional Traits or Microbiomes Associated with Diseases, Pests, Human Activities and Climate Change)
Abstract
Rice blast, caused by the fungal pathogen Magnaporthe oryzae, is one of the most devastating diseases affecting rice production worldwide, resulting in significant yield losses and threatening global food security. The severity of rice blast, particularly in susceptible regions, underscores the urgent need for available effective resistance strategies. In this study, six sets of gene-specific molecular markers for the Pik locus associated with rice blast resistance were developed based on publicly available gene sequences. Experimental validation confirmed their high accuracy. During the marker development process, a novel haplotype of the Pik locus was identified. This haplotype is characterized by 14 bp mutations and a 9 bp insertion within the coding sequence region when compared to the Pikh allele. Subsequently, a molecular marker specific to this haplotype was developed and validated. The application of these seven sets of markers to analyze 163 japonica rice cultivars bred in Yunnan Province between 1980 and 2020 revealed that 38.65% of the cultivars carry the Piks allele, indicating a low resistance frequency against the rice blast fungus under field conditions. In contrast, only a small proportion of cultivars possess other Pik locus alleles, which exhibit higher resistance frequencies. These findings highlight the limited utilization of Pik locus genes in japonica rice breeding in Yunnan. Furthermore, 21.47% of the cultivars lack any of the aforementioned Pik locus alleles, indicating the genetic diversity and complexity of the rice genetic resources of Yunnan Province.
1. Introduction
Rice (Oryza sativa L.) is a fundamental staple food for approximately half of the global population, rendering it one of the most critical food crops worldwide [1]. However, rice production faces significant challenges, particularly from rice blast disease, caused by the ascomycete fungus Magnaporthe oryzae (syn. Pyricularia oryzae) [2,3]. This disease is recognized as one of the most destructive fungal diseases in agriculture globally, posing a severe threat to rice cultivation. Statistics indicate that the global economic loss attributed to rice blast exceeds USD 7 billion annually [4]. The rice yield reduction in fields where rice blast occurs is about 10% to 30% on average [5], with severe outbreaks potentially leading to complete crop failure [6]. The most cost-effective, efficient, and environmentally sustainable strategy for mitigating rice blast is to deploy resistance genes to develop resistant rice cultivars [7,8,9].
Through long-term and extensive genetic analysis and research worldwide, nearly 118 rice blast resistance genes have been identified [10], and among them, about 38 genes have been cloned [11,12,13]. Genetic analysis has revealed that most of these resistance genes are dominant, while a few, such as pi21 and Pi55(t), are recessive [14,15]. Structural and functional analysis revealed that with the exception of Pid2, pi21, and Ptr, which encode proteins with unique structures, most resistance genes encode proteins with coiled-coil (CC), nucleotide-binding site (NBS), and leucine-rich repeat (LRR) domains [16,17]. These resistance genes are unevenly distributed across 12 chromosomes of rice, with a concentration on chromosomes 6, 11, and 12, exhibiting a clustered distribution pattern [18].
The accurate identification of resistance genes in rice germplasm is essential for their effective utilization in breeding programs. Traditionally, this has been accomplished by selecting specific pathogenic strains of M. oryzae and inoculating rice cultivars to assess resistance or susceptibility, thus inferring the presence of particular resistance genes [19]. However, this kind of work is time-consuming and inefficient, with results often being unreliable due to variability in rice growth conditions and inoculation processes [20]. Compared with inoculation experiments, the application of molecular markers is more convenient and saves time. With the identification and fine mapping of resistance genes, a number of molecular markers closely linked to target resistance genes have been developed and applied in practice, such as molecular marker-assisted selection (MAS) breeding [21]. Despite this, the accuracy of using closely linked markers for identifying target genes could be affected by linkage disequilibrium breakdown, population specificity, genetic recombination, as well as a lack of causal relationship with resistant phenotype. Additionally, closely linked markers often fail to differentiate between alleles at the same locus [8,22]. As rice blast resistance genes continue to be cloned, their complete gene sequences have become available, facilitating the development of gene-specific molecular markers. These markers enable the direct selection of target genes, overcoming the limitations associated with closely linked markers and ensuring greater selection accuracy [23].
The Pik locus, located at the terminus of the long arm of chromosome 11, comprises at least seven alleles: Pik [24], Pi1 [25], Pikm [26], Piks [27,28], Pikp [29], Pikh [30], and Pike [31]. The resistance conferred by genes at the Pik locus is governed by two adjacent CC-NBS-LRR genes (such as Pik-1 and Pik-2) with opposite transcriptional orientations [26]. Studies targeting Pikm have found that the nucleic acid polymorphism is primarily associated with Pikm-1, with variation concentrated in the CC domain, whereas Pikm-2 remains more conserved [32]. A mechanistic model of Pikh-mediated resistance proposes that Pikh-1 functions as an adaptor, facilitating the interaction between AvrPik-h and Pikh-2. Subsequently, Pikh-2 transduces the signal to trigger Pikh-specific resistance [30]. The Pik locus is critically important due to the application of its alleles in rice breeding programs aimed at achieving durable resistance against rice blast [33]. The allele Pik confers high and stable resistance to a wide range of Chinese rice blast isolates [24]. Likewise, the Pi1 allele originally derived from the West African cv. LAC23 [25] has exhibited durable and high-level resistance to rice blast [34]. Furthermore, Liu et al. [35] reviewed the broad-spectrum resistance against M. oryzae by Pikh and Pi1.
Yunnan is not only a center of diversity for Asia-cultivated rice (O. sativa) but also the origin of rice blast fungus (M. oryzae) [36,37], which presents unique opportunities for rice blast resistance breeding. To harness Yunnan’s rich genetic resources, it is imperative to accurately and swiftly identify resistance genes. At the same time, the Pik locus offers vital materials for exploitation in resistance breeding. Currently, six alleles at the Pik locus, excluding Pike, have been cloned and published sequences. However, as new allele sequences are identified, previously developed markers may lose accuracy. In this study, the sequence information of these six alleles was analyzed in order to develop more precise and effective gene-specific molecular markers. These newly developed markers were subsequently applied to assess 163 japonica rice cultivars bred in Yunnan from 1980 to 2020, with the goal of determining the distribution of these six resistance genes at the Pik locus. The aim of this research is to provide valuable insights and guidance for selecting resistance gene combinations in future rice breeding programs.
2. Results
2.1. Development and Identification of Resistance Gene-Specific Molecular Markers
2.1.1. Pik
Comparison of the gDNA sequence of Pik with other alleles revealed a 22-nucleotide deletion located downstream of the coding region of Pik-1 (Figure 1a). An insertion/deletion (In/Del) marker (Pik-Fw/Rv, Table 1) was developed to detect this deletion and distinguish Pik from other alleles. The amplification fragment length of monogenic rice line IRBLk-Ka (Pik), using this newly developed marker, is 111 bp, shorter than counterparts of other alleles, including those from Lijiangxintuanheigu (LTH), which were 133 bp (Figure 2a).
2.1.2. Pi1
Sequence alignment of the coding sequence (CDS) of Pi1-6 with other alleles identified a specific single nucleotide polymorphism (SNP), where Pi1-6 contains an adenine (A) base, while the others have thymine (T) (Figure 1b). Based on this SNP, a dCAPS marker (Pi1-Fw/Rv, Table 1) was developed, producing an amplification fragment of 120 bp for all monogenic rice lines and LTH. The amplification product was then digested with Xba I and analyzed using 2% agarose gel electrophoresis. The amplification product specific to Pi1 could not be digested with Xba I, and its length remained 120 bp. By contrast, the amplification products of other monogenic rice lines and LTH were cleaved with Xba I, yielding fragments of 99 bp and 21 bp, which were shorter than the product for Pi1 (Figure 2b).
2.1.3. Pikm
The sequence alignment of CDS of Pikm-1-TS with other alleles identified an SNP where Pikm contains a cytosine (C) base, while the other alleles have guanine (G). This C base, along with its flanking sequences of Pikm-1-TS, creates a recognition site for the restriction enzyme BstN I (Figure 1c). A CAPS marker (Pikm-Fw/Rv, Table 1) was developed to amplify this fragment, which is 134 bp in length. Following amplification and digestion with BstN I, the amplification product of Pikm cleaved into two fragments of equal length (67 bp), while the amplification products of other monogenic rice lines and LTH remained uncut at 134 bp (Figure 2c).
2.1.4. Piks
The polymorphism in the CDS between Piks-1 and its counterparts (Pikp, Pikh, and the allele in LTH) led to the development of a forward primer by introducing 4, 4, and 6 mismatched bases compared to the target sequence of Pikp, Pikh, and LTH (Figure 1d). Additionally, an SNP site, which is C for Piks and T for Pik, Pi1, and Pikm, located in the reverse primer region, enabled the development of a dCAPS marker (Piks-Fw/Rv, Figure 1d). Due to the introduction of mismatched bases, it was not possible for the dCAPS marker for Piks to amplify products representing Pikp, Pikh, and LTH. The remaining amplification product specific to Piks is 189 bp in length. Following digestion with Nde I, only the amplification product representing Piks is cleaved, resulting in a fragment of 165 bp, which is significantly shorter than those of other alleles when analyzed by 2% agarose gel electrophoresis (Figure 2d).
2.1.5. Pikp and Pikh
Due to the minimal differences in coding sequence between Pikp and Pikh and interference from the allele present in LTH, we initially designed a co-dominant marker; this marker introduces 7 and 6 mismatched bases, compared to Pik, Pi1, Pikm, and Piks, in the forward and reverse primers (Pikp/kh-Fw/Rv, Table 1), respectively, to distinguish Pikp/Pikh from Pik, Pi1, Pikm, Piks, and LTH (Figure 3a). With this marker, a 122 bp amplification product will be obtained, which represents Pikp or Pikh. Due to the introduced mismatched bases, no amplification could be observed with other monogenic rice lines as samples. A 9 bp longer fragment was found in the amplification region, so the product representing LTH is 131 bp (Figure 4a). To prevent false-negative results, a housekeeping gene, TBC, with its specific marker (TBC-Fw/Rv, Table 1), was incorporated to confirm the PCR reaction.
An SNP site between Pikp and Pikh was used to develop a dCAPS marker (Pikp/kh-Fw1/Rv1, Table 1), which introduces restriction endonuclease Mse I site in the amplification product of Pikp (Figure 3b). Upon digestion, the Pikp product is cleaved into 51 bp and 25 bp fragments, while the Pikh product remains 79 bp (Figure 4b).
2.1.6. A Novel Haplotype of Pik Locus
Using the newly developed dCAPS marker Pikp/kh-Fw1/Rv1 to analyze the 163 japonica rice cultivars, we unexpectedly identified a novel haplotype at the Pik locus. The amplification product of this haplotype is approximately 79 bp long and cannot be digested by Mse I, displaying the same digestion pattern as Pikh. However, Sanger sequencing demonstrated that there are 14 bp mutations and a 9 bp insertion distributing in the CDS region of this haplotype compared with Pikh (Figure 3c). To further differentiate the novel haplotype from Pikh, we conducted additional amplification using the newly developed marker Piknew-Fw/Rv (Table 1), followed by 8% acrylamide gel electrophoresis analysis. The results showed a significant difference between this novel haplotype and Pikh, enabling a clear distinction (Figure 4c).
2.2. Determination of 163 Japonica Rice Cultivars with Pik Allele-Specific Molecular Markers
The newly developed molecular markers were employed to analyze 163 japonica rice cultivars bred in Yunnan from 1980 to 2020, to determine the distribution of the Pik alleles in these cultivars. The findings are summarized in Table 2.
Among six alleles at the Pik locus, Piks is the most widely distributed, with 63 cultivars containing Piks, which corresponds to a detection frequency of 38.65%. In contrast, Pikm and Pik were detected in only three and one cultivars, with corresponding detection frequencies of 1.84% and 0.61%, respectively. No cultivars were found to carry Pi1, Pikp, and Pikh. Interestingly, 61 cultivars were identified as carrying the novel Pik locus haplotype through detection with Pikp/kh-Fw1/Rv1, representing a detection frequency of 37.42%. The remaining 35 cultivars did not contain any of these 7 Pik locus alleles/haplotypes, with a detection frequency is 21.47%. This reveals an uncovered genetic diversity of these cultivars (Figure 5).
These 163 cultivars can be divided into seven major breeding series based on their origins of development: ‘Chugeng’, ‘Yungeng’, ‘Xiugeng’, ‘Ligeng’, ‘Fengdao’, ‘Jinggeng’, and ‘Hexi’. These series were developed by scientific institutions across different regions of Yunnan, reflecting the diversity of rice genetic resources in the region. The results indicated that Piks is distributed across all seven series. Pikm was detected in cultivars of the ‘Chugeng’ and ‘Xiugeng’ series, while Pik was identified in cultivars of ‘Jinggeng’. The novel Pik locus haplotype was found in all five series except for ‘Jinggeng’ and ‘Xiugeng’, with the most widespread distribution being in ‘Chugeng’, ‘Yungeng’, and ‘Hexi’. Interestingly, cultivars lacking any of these seven Pik alleles/haplotypes were found in all series, underscoring the widespread occurrence of this genetic trait (Table 2).
3. Discussion
In this study, we successfully developed gene-specific molecular markers for six alleles at the Pik locus using publicly accessible gene sequences. These markers have been proven effective in accurately identifying target genes within rice genetic resources. Furthermore, a novel haplotype of Pik locus was found during the process of marker development. This new haplotype contains nucleotide mutations in its CDS region compared to known functional alleles, resulting in changes to the corresponding amino acid sequence, including a 9 bp insertion that encodes three additional amino acids. Based on these unique characteristics, we have developed haplotype-specific molecular markers to analyze the distribution of this new haplotype among improved rice cultivars of Yunnan.
The application of seven sets of specific markers developed by this study to detect 163 developed japonica rice cultivars from the 1980s to 2020s in Yunnan revealed a limited utilization of Pik locus resistance genes. Specifically, 38.65% of the cultivars, spanning all seven breeding series, carry the Piks allele, which confers a low resistance frequency against M. oryzae in the field. In contrast, the remaining five alleles of the Pik locus are rarely utilized, with detection frequencies of 1.84% for Pikm, 0.61% for Pik, and 0% for Pi1, Pikp, and Pikh, respectively. This underutilization of Pik locus resistance genes restricts their potential application in rice breeding programs. Moreover, the long-term reliance on a single resistance gene can significantly increase selection pressure and accelerate the breakdown of resistance [38]. Interestingly, 21.47% of the cultivars, distributed across all seven breeding series, do not carry any of the known Pik locus alleles. This observation highlights the genetic diversity of Yunnan’s rice genetic resources and suggests the presence of unknown genes/alleles that may harbor new resistance functions. Despite the high sequence similarity among the coding sequences of Pik locus alleles, their resistance functions differ significantly. Chen et al. [31] tested the resistance spectra of these six alleles of Pik locus with 215 M. oryzae isolates collected from different regions of China. The results showed a low resistance spectrum of Piks (with a resistance frequency of 13.0%), medium resistance spectrum of Pikp (31.6%), Pik (39.1%), Pi1 (48.4%), Pikm (50.2%), and Pikh (51.6%). However, 38.65% of the 163 japonica rice cultivars bred in Yunnan carry Piks, while the other alleles were rarely utilized. This imbalance further underscores the limitations of current Pik locus allele usage in rice breeding. The development of these sets of gene-specific markers will facilitate the rapid identification of Pik locus alleles carried by rice genetic resources, expand the utilization of Pik locus alleles, and facilitate the pyramiding of Pik genes with other resistance genes to enhance both the resistance spectrum and the longevity of resistance in subsequent rice breeding efforts.
By integrating the latest sequence information, we have developed six sets of accurate and practical gene-specific markers for detecting alleles at the Pik locus in Yunnan rice cultivars. Our findings revealed that alleles at the Pik locus are limited in improved cultivars. This indicates that alleles such as Pi1, Pikm, and Pikh, which exhibit good resistance against M. oryzae [39], could be strategically utilized in disease-resistant rice breeding in Yunnan to broaden the resistant spectrum. Notably, we identified a novel haplotype at the Pik locus, with 37.42% of the improved Yunnan cultivars carrying this new haplotype. Further investigations into whether this haplotype represents a functional resistance allele are currently ongoing.
4. Materials and Methods
4.1. Rice Cultivars
A total of 163 japonica rice cultivars bred in Yunnan from 1980 to 2020 (Table 2), monogenic rice lines IRBLk-Ka (Pik), IRBL1-CL (Pi1), IRBLkm-Ts (Pikm), IRBLks-F5 (Piks), IRBLks-S (Piks), IRBLkp-K60 (Pikp), IRBLkh-K3 (Pikh), and LTH, were collected and preserved by the laboratory.
4.2. Development of Gene-Specific Molecular Markers
The sequences of cloned resistance genes Pik (NCBI accession number AB616659), Pi1 (HQ606329), Pikm (AB462256), Piks (HQ662329), Pikp (HM035360), and Pikh (HQ662330), as well as housekeeping gene TBC (LOC_Os09g34040, [40]) were utilized for the development of relevant molecular markers. Primers and CAPS markers were designed by using SnapGene V4.1.8. dCAPS markers were generated through dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/ (accessed on 12 January 2025), [41]). The primers and markers used are listed in Table 1.
4.3. Genomic DNA Extraction
Genomic DNA (gDNA) was extracted from seedling leaves using the CTAB method described by Warude et al. [42]. The integrity of the extracted gDNA was assessed via 1% agarose gel electrophoresis. The gDNA concentration of each sample was measured by NanodropTM 1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA) and then adjusted to a working concentration of 20 ng/μL with 0.1× TE buffer. The samples were then stored at −20 °C.
4.4. PCR Amplification and Electrophoresis
Each 20.0 μL PCR reaction mixture was prepared with the following components: 10.0 μL 2× Es Taq MasterMix (Dye) (CWBIO, Taizhou, China), 1.0 μL gDNA (20 ng/μL), 1.0 μL each of forward and reserve primers, and 7.0 μL of ddH2O. The PCR protocol consisted of an initial denaturation at 95 °C for 3 min, followed by 34 cycles of denaturation at 95 °C for 30 s, annealing at temperatures specified in Table 1 for 30 s, and extension at 72 °C for 30 s. The PCR products targeting the Pik gene were analyzed using 2% agarose gel electrophoresis; PCR products amplified for Pi1, Pikm, and Piks were subsequently digested with relevant restriction enzymes and analyzed with 2% agarose gel electrophoresis. PCR products generated using Pikp/kh-Fw and Pikp/kh-Rv, targeting Pikp/Pikh, were analyzed by 8% acrylamide gel electrophoresis to distinguish Pikp and Pikh with Pik, Pi1, Pikm, and Piks, with TBC used as an internal control to confirm successful amplifications. To further distinguish Pikp from Pikh, PCR products amplified with Pikp/kh-Fw1 and Pikp/kh-Rv1 were digested with Mse I and analyzed with 2% agarose gel electrophoresis. Additionally, PCR products amplified using Piknew-Fw and Piknew-Rv primers were analyzed by 8% acrylamide gel electrophoresis to identify a novel Pik locus haplotype distinct from Pikh.
Author Contributions
Conceptualization, P.L. and Q.Y.; methodology, P.L. and Q.Y.; software, S.L.; validation, P.L. and W.Z.; formal analysis, L.D. and S.L.; investigation, P.L. and W.Z.; resources, L.D. and Q.Y.; data curation, S.L.; writing—original draft preparation, P.L.; writing—review and editing, P.L., G.N. and Q.Y.; visualization, S.L.; supervision, L.H. and Q.Y.; project administration, L.H. and Q.Y.; funding acquisition, P.L., Q.Y. and L.D. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Basic Research Special Project of Yunnan (202301AT070099), the Yunnan Seed Laboratory (202205AR070001-4), and the National Natural Science Foundation of China (32260646).
Data Availability Statement
The data that support the findings of this study are accessible from the corresponding author upon reasonable request.
Acknowledgments
We are grateful to S-J Zheng from Biodiversity International for proofreading and reviewing the manuscript.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Khush, G.S. What it will take to Feed 5.0 Billion Rice consumers in 2030. Plant Mol. Biol. 2005, 59, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Couch, B.C.; Kohn, L.M. A multilocus gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae, from M. grisea. Mycologia 2002, 94, 683–693. [Google Scholar] [CrossRef] [PubMed]
- Zhang, N.; Luo, J.; Rossman, A.Y.; Aoki, T.; Chuma, I.; Crous, P.W.; Dean, R.; de Vries, R.P.; Donofrio, N.; Hyde, K.D.; et al. Generic names in Magnaporthales. IMA Fungus 2016, 7, 155–159. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wang, X.; Mitchell, T.; Hu, Y.; Liu, X.; Dai, L.; Wang, G.-L. Recent progress and understanding of the molecular mechanisms of the rice-Magnaporthe oryzae interaction. Mol. Plant Pathol. 2010, 11, 419–427. [Google Scholar] [CrossRef]
- Nalley, L.; Tsiboe, F.; Durand-Morat, A.; Shew, A.; Thoma, G. Economic and environmental impact of rice blast pathogen (Magnaporthe oryzae) alleviation in the United States. PLoS ONE 2016, 11, e0167295. [Google Scholar] [CrossRef]
- Dean, R.; Van Kan, J.A.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef]
- Sharma, T.R.; Rai, A.K.; Gupta, S.K.; Vijayan, J.; Devanna, B.N.; Ray, S. Rice blast management through host-plant resistance: Retrospect and prospects. Agric. Res. 2012, 1, 37–52. [Google Scholar] [CrossRef]
- Savary, S.; Willocquet, L.; Pethybridge, S.J.; Esker, P.; McRoberts, N.; Nelson, A. The global burden of pathogens and pests on major food crops. Nat. Ecol. Evol. 2019, 3, 430–439. [Google Scholar] [CrossRef]
- Ashkani, S.; Rafii, M.Y.; Shabanimofrad, M.; Miah, G.; Sahebi, M.; Azizi, P.; Tanweer, F.A.; Akhtar, M.S.; Nasehi, A. Molecular breeding strategy and challenges towards improvement of blast disease resistance in rice crop. Front. Plant Sci. 2015, 6, 886. [Google Scholar] [CrossRef]
- Kalia, S.; Rathour, R. Current status on mapping of genes for resistance to leaf- and neck-blast disease in rice. 3 Biotech 2019, 9, 209. [Google Scholar] [CrossRef]
- Yang, T.; Song, L.; Hu, J.; Qiao, L.; Yu, Q.; Wang, Z.; Chen, X.; Lu, G.D. Magnaporthe oryzae effector AvrPik-D targets a transcription factor WG7 to suppress rice immunity. Rice 2024, 17, 14. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Qiu, J.; Shen, Z.; Wang, C.; Jiang, N.; Shi, H.; Kou, Y. The E3 ubiquitin ligase OsRGLG5 targeted by the Magnaporthe oryzae effector AvrPi9 confers basal resistance against rice blast. Plant Commun. 2023, 4, 100626. [Google Scholar] [CrossRef] [PubMed]
- Devanna, B.N.; Jain, P.; Solanke, A.U.; Das, A.; Thakur, S.; Singh, P.K.; Kumari, M.; Dubey, H.; Jaswal, R.; Pawar, D.; et al. Understanding the dynamics of blast resistance in rice-Magnaporthe oryzae interactions. J. Fungi 2022, 8, 584. [Google Scholar] [CrossRef] [PubMed]
- Fukuoka, S.; Saka, N.; Koga, H.; Ono, K.; Shimizu, T.; Ebana, K.; Hayashi, N.; Takahashi, A.; Hirochika, H.; Okuno, K.; et al. Loss of function of a proline-containing protein confers durable disease resistance in rice. Science 2009, 325, 998–1001. [Google Scholar] [CrossRef]
- He, X.; Liu, X.; Wang, L.; Wang, L.; Lin, F.; Cheng, Y.; Chen, Z.; Liao, Y.; Pan, Q. Identification of the novel recessive gene pi55(t) conferring resistance to Magnaporthe oryzae. Sci. China Life Sci. 2012, 55, 141–149. [Google Scholar] [CrossRef][Green Version]
- Zhao, H.; Wang, X.; Jia, Y.; Minkenberg, B.; Wheatley, M.; Fan, J.; Jia, M.H.; Famoso, A.; Edwards, J.D.; Wamishe, Y.; et al. The rice blast resistance gene Ptr encodes an atypical protein required for broad-spectrum disease resistance. Nat. Commun. 2018, 9, 2039. [Google Scholar] [CrossRef]
- Chen, X.; Shang, J.; Chen, D.; Lei, C.; Zou, Y.; Zhai, W.; Liu, G.; Xu, J.; Ling, Z.; Cao, G.; et al. A B-lectin receptor kinase gene conferring rice blast resistance. Plant J. 2006, 46, 794–804. [Google Scholar] [CrossRef]
- Zhang, M.; Wang, S.; Yuan, M. An update on molecular mechanism of disease resistance genes and their application for genetic improvement of rice. Mol. Breed. 2019, 39, 154. [Google Scholar] [CrossRef]
- Tsunematsu, H.; Yanoria, M.J.T.; Ebron, L.A.; Hayashi, N.; Ando, I.; Kato, H.; Imbe, T.; Khush, G.S. Development of monogenic lines of rice for blast resistance. Breed. Sci. 2000, 50, 229–234. [Google Scholar] [CrossRef]
- Fang, W.W.; Liu, C.C.; Zhang, H.W.; Xu, H.; Zhou, S.; Fang, K.X.; Peng, Y.L.; Zhao, W.S. Selection of differential isolates of Magnaporthe oryzae for postulation of blast resistance genes. Phytopathology 2018, 108, 878–884. [Google Scholar] [CrossRef]
- Michelmore, R.W.; Paran, I.; Kesseli, R.V. Identification of markers linked to disease-resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. USA 1991, 88, 9828–9832. [Google Scholar] [CrossRef]
- Jena, K.K.; Mackill, D.J. Molecular markers and their use in marker-assisted selection in rice. Crop Sci. 2008, 48, 1266–1276. [Google Scholar] [CrossRef]
- Li, J.; Zhang, H.; Yang, R.; Zeng, Q.; Han, G.; Du, Y.; Yang, J.; Yang, G.; Luo, Q. Identification of miRNAs contributing to the broad-spectrum and durable blast resistance in the Yunnan local rice germplasm. Front. Plant Sci. 2021, 12, 749919. [Google Scholar] [CrossRef] [PubMed]
- Zhai, C.; Lin, F.; Dong, Z.; He, X.; Yuan, B.; Zeng, X.; Wang, L.; Pan, Q. The isolation and characterization of Pik, a rice blast resistance gene which emerged after rice domestication. N. Phytol. 2011, 189, 321–334. [Google Scholar] [CrossRef]
- Hua, L.; Wu, J.; Chen, C.; Wu, W.; He, X.; Lin, F.; Wang, L.; Ashikawa, I.; Matsumoto, T.; Wang, L.; et al. The isolation of Pi1, an allele at the Pik locus which confers broad spectrum resistance to rice blast. Theor. Appl. Genet. 2012, 125, 1047–1055. [Google Scholar] [CrossRef]
- Ashikawa, I.; Hayashi, N.; Yamane, H.; Kanamori, H.; Wu, J.; Matsumoto, T.; Ono, K.; Yano, M. Two adjacent nucleotide-binding site-leucine-rich repeat class genes are required to confer Pikm-specific rice blast resistance. Genetics 2008, 180, 2267–2276. [Google Scholar] [CrossRef]
- Kiyosawa, S. Inheritance of blast resistance of a U.S. rice variety, Dawn. Jpn. J. Breed. 1974, 24, 117–124. [Google Scholar] [CrossRef]
- Fjellstrom, R.; Conaway-Bormans, C.A.; McClung, A.M.; Marchetti, M.A.; Shank, A.R.; Park, W.D. Development of DNA markers suitable for marker assisted selection of three Pi genes conferring resistance to multiple Pyricularia grisea pathotypes. Crop Sci. 2004, 44, 1790–1798. [Google Scholar] [CrossRef]
- Yuan, B.; Zhai, C.; Wang, W.; Zeng, X.; Xu, X.; Hu, H.; Lin, F.; Wang, L.; Pan, Q. The Pik-p resistance to Magnaporthe oryzae in rice is mediated by a pair of closely linked CC-NBS-LRR genes. Theor. Appl. Genetic. 2011, 122, 1017–1028. [Google Scholar] [CrossRef]
- Zhai, C.; Zhang, Y.; Yao, N.; Lin, F.; Liu, Z.; Dong, Z.; Wang, L.; Pan, Q. Function and interaction of the coupled genes responsible for Pik-h encoded rice blast resistance. PLoS ONE 2014, 9, e98067. [Google Scholar] [CrossRef]
- Chen, J.; Peng, P.; Tian, J.; He, Y.; Zhang, L.; Liu, Z.; Yin, D.; Zhang, Z. Pike, a rice blast resistance allele consisting of two adjacent NBS–LRR genes, was identified as a novel allele at the Pik locus. Mol. Biol. 2015, 35, 117. [Google Scholar] [CrossRef]
- Costanzo, S.; Jia, Y. Sequence variation at the rice blast resistance gene Pi-km locus: Implications for the development of allele specific markers. Plant Sci. 2010, 178, 523–530. [Google Scholar] [CrossRef]
- Sahu, P.K.; Sao, R.; Choudhary, D.K.; Thada, A.; Kumar, V.; Mondal, S.; Das, B.K.; Jankuloski, L.; Sharma, D. Advancement in the breeding, biotechnological and genomic tools towards development of durable genetic resistance against the rice blast disease. Plants 2022, 11, 2386. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.P.; Li, X.; Wang, C.Y.; Li, X.H.; He, Y.Q. Improvement of resistance to rice blast in Zhenshan 97 by molecular marker-aided selection. Acta Agron. Sin. 2003, 45, 1346–1350. [Google Scholar]
- Liu, W.; Liu, J.; Triplett, L.; Leach, J.E.; Wang, G.L. Novel insights into rice innate immunity against bacterial and fungal pathogens. Annu. Rev. Phytopathol. 2014, 52, 213–241. [Google Scholar] [CrossRef]
- Saleh, D.; Milazzo, J.; Adreit, H.; Fournier, E.; Tharreau, D. South-East Asia is the center of origin, diversity and dispersion of the rice blast fungus, Magnaporthe oryzae. N. Phytol. 2014, 201, 1440–1456. [Google Scholar] [CrossRef]
- Saleh, D.; Xu, P.; Shen, Y.; Li, C.Y.; Adreit, H.; Milazzo, J.; Ravigné, V.; Bazin, E.; Nottéghem, J.L.; Fournier, E.; et al. Sex at the origin: An Asian population of the rice blast fungus Magnaporthe oryzae reproduces sexually. Mol. Ecol. 2012, 21, 1330–1344. [Google Scholar] [CrossRef]
- Pink, D.A.C. Strategies using genes for non-durable disease resistance. Euphytica 2002, 124, 227–236. [Google Scholar] [CrossRef]
- Dong, L.; Liu, S.; Tian, W.; Zhou, W.; Zhang, X.; Li, X.; Yang, Q. Pathogenicity and mapping type of rice blast fungus Magnaporthe oryzae isolates in Yunnan Province. J. Plant Prot. 2023, 50, 316–324, (In Chinese with English Summary). [Google Scholar]
- Maksup, S.; Supaibulwatana, K.; Selvaraj, G. High-quality reference genes for quantifying the transcriptional responses of Oryza sativa L. (ssp. indica and japonica) to abiotic stress conditions. Chin. Sci. Bull. 2013, 58, 1919–1930. [Google Scholar]
- Neff, M.M.; Turk, E.; Kalishman, M. Web-based primer design for single nucleotide polymophism analysis. TRENDS Genet. 2002, 18, 613–615. [Google Scholar] [CrossRef] [PubMed]
- Warude, D.; Chavan, P.; Joshi, K.; Patwardhan, B. DNA isolation from fresh, dry plant samples with highly acidic tissue extracts. Plant Mol. Biol. Rep. 2003, 21, 467. [Google Scholar] [CrossRef]
Figure 1.
Schematic drawing of primers design for Pik locus resistance genes Pik (a), Pi1 (b), Pikm (c), and Piks (d). The solid arrows indicate the location of forward and reverse primers. The uppercase letters represent complementary bases, and the lowercase letters represent introduced mismatched bases in reverse primers.
Figure 1.
Schematic drawing of primers design for Pik locus resistance genes Pik (a), Pi1 (b), Pikm (c), and Piks (d). The solid arrows indicate the location of forward and reverse primers. The uppercase letters represent complementary bases, and the lowercase letters represent introduced mismatched bases in reverse primers.
Figure 2.
Electrophoresis of amplification product using gene-specific primers of Pik (a), Pi1 (b), Pikm (c), and Piks (d). M, DNA standard molecular weight DL 2000 (Takara). 1–8, monogenic rice lines IRBLks-F5 (Piks), IRBLks-S (Piks), IRBLk-Ka (Pik), IRBLkp-K60 (Pikp), IRBLkh-K3 (Pikh), IRBL1-CL (Pi1), IRBLkm-TS (Pikm), and LTH.
Figure 2.
Electrophoresis of amplification product using gene-specific primers of Pik (a), Pi1 (b), Pikm (c), and Piks (d). M, DNA standard molecular weight DL 2000 (Takara). 1–8, monogenic rice lines IRBLks-F5 (Piks), IRBLks-S (Piks), IRBLk-Ka (Pik), IRBLkp-K60 (Pikp), IRBLkh-K3 (Pikh), IRBL1-CL (Pi1), IRBLkm-TS (Pikm), and LTH.
Figure 3.
Schematic drawing of primers design for Pik locus resistance genes Pikp and Pikh. The sequence differences are shown in (a). The lowercase letter represents the mismatched base (A to T) in the forward primer (b). The 9 bp insertion located in the CDS of the novel Pik locus haplotype, compared with Pikh, is illustrated in (c).
Figure 3.
Schematic drawing of primers design for Pik locus resistance genes Pikp and Pikh. The sequence differences are shown in (a). The lowercase letter represents the mismatched base (A to T) in the forward primer (b). The 9 bp insertion located in the CDS of the novel Pik locus haplotype, compared with Pikh, is illustrated in (c).
Figure 4.
The electrophoresis of amplification product using primers Pikp/kh-Fw/Rv and TBC-Fw/RV; (a), amplification product using Pikp/kh-Fw1/Rv1 after Mse I digestion (b), and amplification product using Piknew-Fw/Rv (c). M, DNA standard molecular weight DL 2000 (Takara). 1–8, monogenic rice lines IRBLks-F5 (Piks), IRBLks-S (Piks), IRBLk-Ka (Pik), IRBLkp-K60 (Pikp), IRBLkh-K3 (Pikh), IRBL1-CL (Pi1), IRBLkm-TS (Pikm), and LTH in panel a. 1–2, monogenic rice lines IRBLkp-K60 (Pikp) and IRBLkh-K3 (Pikh) in panel b. 1–6, monogenic rice line IRBLkh-K3 (Pikh), Chugeng 5, Yungeng 37, Hexi 3, Ligeng 15, and LTH.
Figure 4.
The electrophoresis of amplification product using primers Pikp/kh-Fw/Rv and TBC-Fw/RV; (a), amplification product using Pikp/kh-Fw1/Rv1 after Mse I digestion (b), and amplification product using Piknew-Fw/Rv (c). M, DNA standard molecular weight DL 2000 (Takara). 1–8, monogenic rice lines IRBLks-F5 (Piks), IRBLks-S (Piks), IRBLk-Ka (Pik), IRBLkp-K60 (Pikp), IRBLkh-K3 (Pikh), IRBL1-CL (Pi1), IRBLkm-TS (Pikm), and LTH in panel a. 1–2, monogenic rice lines IRBLkp-K60 (Pikp) and IRBLkh-K3 (Pikh) in panel b. 1–6, monogenic rice line IRBLkh-K3 (Pikh), Chugeng 5, Yungeng 37, Hexi 3, Ligeng 15, and LTH.
Figure 5.
The detection frequency of Pik locus genes in 163 japonica rice cultivars.
Table 1.
List of primers used in this study.
| Target Gene | Marker Name | Sequence (5′-3′) | Fragment Length/bp | Enzyme Site | Annealing Temperature/°C | Marker Type |
|---|---|---|---|---|---|---|
| Pik | Pik-Fw | TCAGTACTCAGTAGTAGTGC | 111 a/133 b | - | 55 | InDel |
| Pik-Rv | TGAGAGAAAATAACCCGCTC | |||||
| Pi1 | Pi1-Fw | CTGTCAACTGATGAAGGC | 120/99 + 21 | Xba I | 55 | dCAPS |
| Pi1-Rv | AGAAAGGATTCTTATCtCtAG | |||||
| Pikm | Pikm-Fw | GCAATGTCATTGGTTGCAAG | 67 + 67/134 | BstN I | 58 | CAPS |
| Pikm-Rv | CCCACCTTCTTCCGGAG | |||||
| Piks | Piks-Fw | GCAATGTCATTGGTTGCAAG | 167 + 22/189 | Nde I | 53 | dCAPS |
| Piks-Rv | CGTTATCTCCTTCACATCTTCaTaT | |||||
| Pikp/Pikh | Pikp/kh-Fw | GTTGCCATGGAGGGCAATAATT | 122/- | - | 60 | dominant |
| Pikp/kh-Rv | CCATAACCGACCACCTCTATCTT | |||||
| TBC-Fw | TGGTCATGTTCCTTCAGCAC | 111 c | - | 60 | internal control | |
| TBC-Rv | GACTTGGCGAGCTTTTGAAC | |||||
| Pikp/kh-Fw1 | AGTTGCTGCAGGTCAGCCAAGCAAt | 51 + 25/76 | Mse I | 60 | dCAPS | |
| Pikp/kh-Rv1 | CATATGGATTTCACCGGCGCAA | |||||
| Piknew-Fw | GGGAGCAGTGAAAACATTGC | 89/80 | - | 55 | InDel | |
| Piknew-Rv | ACAGCAGGGAGATTATCATGC |
a: the fragment length of the target resistance gene after amplification and/or digestion. b: the fragment length of the allele gene after amplification and/or digestion. c: the fragment length of internal control gene TBC after amplification for all resistance genes. Lowercase letters indicate introduced mismatch nucleotide bases.
Table 2.
163 japonica rice cultivars bred in Yunnan Province from 1980 to 2020 containing Pik locus resistance genes.
Table 2.
163 japonica rice cultivars bred in Yunnan Province from 1980 to 2020 containing Pik locus resistance genes.
| No. | Name | Year of Registration | Pik | Pi1 | Pikm | Piks | Pikp | Pikh | Novel Haplotype |
|---|---|---|---|---|---|---|---|---|---|
| 1 | Chugeng 3 | 1983 | - | - | - | + | - | - | - |
| 2 | Chugeng 4 | 1985 | - | - | + | - | - | - | - |
| 3 | Chugeng 5 | 1986 | - | - | - | - | - | - | + |
| 4 | Chugeng 6 | 1990 | - | - | - | - | - | - | + |
| 5 | Chugeng 7 | 1991 | - | - | - | - | - | - | + |
| 6 | Chugeng 8 | 1990 | - | - | - | - | - | - | + |
| 7 | Chugeng 9 | - | - | - | - | - | - | - | + |
| 8 | Chugeng 13 | - | - | - | - | - | - | - | + |
| 9 | Chugeng 14 | 1995 | - | - | - | - | - | - | + |
| 10 | Chugeng 15 | - | - | - | - | - | - | - | + |
| 11 | Chugeng 17 | 1997 | - | - | - | + | - | - | - |
| 12 | Chugeng 18 | - | - | - | + | - | - | - | - |
| 13 | Chugeng 19 | - | - | - | - | + | - | - | - |
| 14 | Chugeng 21 | - | - | - | - | - | - | - | + |
| 15 | Chugeng 22 | 1999 | - | - | - | - | - | - | + |
| 16 | Chugeng 23 | 1999 | - | - | - | + | - | - | - |
| 17 | Chugeng 25 | 2002 | - | - | - | - | - | - | + |
| 18 | Chugeng 26 | 2005 | - | - | - | - | - | - | + |
| 19 | Chugeng 27 | 2005 | - | - | - | - | - | - | + |
| 20 | Chugeng 28 | 2007 | - | - | - | + | - | - | - |
| 21 | Chugeng 29 | 2007 | - | - | - | + | - | - | - |
| 22 | Chugeng 30 | 2007 | - | - | - | + | - | - | - |
| 23 | Chugeng 31 | 2010 | - | - | - | + | - | - | - |
| 24 | Chugeng 32 | 2011 | - | - | - | + | - | - | - |
| 25 | Chugeng 34 | - | - | - | - | + | - | - | - |
| 26 | Chugeng 35 | - | - | - | - | - | - | - | + |
| 27 | Chugeng 36 | - | - | - | - | + | - | - | - |
| 28 | Chugeng 37 | 2014 | - | - | - | - | - | - | + |
| 29 | Chugeng 38 | 2014 | - | - | - | - | - | - | + |
| 30 | Chugeng 40 | 2015 | - | - | - | - | - | - | + |
| 31 | Chugeng 41 | 2016 | - | - | - | - | - | - | + |
| 32 | Chugeng 42 | 2016 | - | - | - | + | - | - | - |
| 33 | Chugeng 45 | 2017 | - | - | - | - | - | - | + |
| 34 | Chugeng 48 | 2019 | - | - | - | - | - | - | - |
| 35 | Chugeng 53 | - | - | - | - | - | - | - | + |
| 36 | Chugeng 54 | - | - | - | - | + | - | - | - |
| 37 | Hongza 135 | 1989 | - | - | - | - | - | - | - |
| 38 | Yundao 1 | 2005 | - | - | - | + | - | - | - |
| 39 | DJY 5 | 2005 | - | - | - | - | - | - | - |
| 40 | Dian 4 | 2001 | - | - | - | - | - | - | + |
| 41 | Yinguang | 2001 | - | - | - | + | - | - | - |
| 42 | Yunzigeng 41 | 2012 | - | - | - | + | - | - | - |
| 43 | Yungeng 2 | - | - | - | - | + | - | - | - |
| 44 | Yungeng 3 | - | - | - | - | + | - | - | - |
| 45 | Yungeng 4 | 2001 | - | - | - | - | - | - | + |
| 46 | Yungeng 5 | - | - | - | - | + | - | - | - |
| 47 | Yungeng 6 | - | - | - | - | + | - | - | - |
| 48 | Yungeng 7 | - | - | - | - | + | - | - | - |
| 49 | Yungeng 10 | - | - | - | - | + | - | - | - |
| 50 | Yungeng 12 | 2005 | - | - | - | - | - | - | + |
| 51 | Yungeng 14 | - | - | - | - | - | - | - | + |
| 52 | Yungeng 16 | - | - | - | - | - | - | - | - |
| 53 | Yungeng 17 | - | - | - | - | - | - | - | + |
| 54 | Yungeng 18 | - | - | - | - | - | - | - | + |
| 55 | Yungeng 19 | 2010 | - | - | - | - | - | - | + |
| 56 | Yungeng 20 | 2011 | - | - | - | - | - | - | + |
| 57 | Yungeng 21 | - | - | - | - | - | - | - | + |
| 58 | Yungeng 24 | 2007 | - | - | - | + | - | - | - |
| 59 | Yungeng 25 | 2007 | - | - | - | - | - | - | + |
| 60 | Yungeng 26 | 2010 | - | - | - | - | - | - | + |
| 61 | Yungeng 29 | 2011 | - | - | - | - | - | - | + |
| 62 | Yungeng 30 | 2011 | - | - | - | - | - | - | + |
| 63 | Yungeng 31 | 2011 | - | - | - | - | - | - | + |
| 64 | Yungeng 32 | 2011 | - | - | - | - | - | - | + |
| 65 | Yungeng 35 | 2014 | - | - | - | + | - | - | - |
| 66 | Yungeng 37 | - | - | - | - | - | - | - | + |
| 67 | Yungeng 38 | 2014 | - | - | - | - | - | - | + |
| 68 | Yungeng 39 | 2014 | - | - | - | + | - | - | - |
| 69 | Yungeng 42 | 2016 | - | - | - | - | - | - | + |
| 70 | Yungeng 43 | 2016 | - | - | - | - | - | - | + |
| 71 | Yungeng 46 | 2018 | - | - | - | - | - | - | + |
| 72 | Yungeng 48 | - | - | - | - | - | - | - | + |
| 73 | Yungeng 135 | - | - | - | - | + | - | - | - |
| 74 | Yungeng 136 | 1983 | - | - | - | - | - | - | - |
| 75 | Yungengyou 1 | 2004 | - | - | - | + | - | - | - |
| 76 | Yungengyou 5 | 2005 | - | - | - | + | - | - | - |
| 77 | Hexi 1 | - | - | - | - | + | - | - | - |
| 78 | Hexi 2 | 1991 | - | - | - | + | - | - | - |
| 79 | Hexi 3 | - | - | - | - | - | - | - | + |
| 80 | Hexi 4 | 1990 | - | - | - | - | - | - | + |
| 81 | Hexi 5 | 1990 | - | - | - | + | - | - | - |
| 82 | Hexi 6 | - | - | - | - | + | - | - | - |
| 83 | Hexi 8 | - | - | - | - | - | - | - | + |
| 84 | Hexi 9 | - | - | - | - | + | - | - | - |
| 85 | Hexi 10 | 1990 | - | - | - | - | - | - | + |
| 86 | Hexi 12 | - | - | - | - | - | - | - | + |
| 87 | Hexi 13 | - | - | - | - | + | - | - | - |
| 88 | Hexi 14 | - | - | - | - | + | - | - | - |
| 89 | Hexi 15 | 1993 | - | - | - | - | - | - | - |
| 90 | Hexi 16 | - | - | - | - | + | - | - | - |
| 91 | Hexi 17 | - | - | - | - | - | - | - | + |
| 92 | Hexi 20 | - | - | - | - | - | - | - | + |
| 93 | Hexi 22 | 1991 | - | - | - | - | - | - | + |
| 94 | Hexi 23 | - | - | - | - | + | - | - | - |
| 95 | Hexi 24 | 1993 | - | - | - | - | - | - | + |
| 96 | Hexi 25 | 1993 | - | - | - | - | - | - | - |
| 97 | Hexi 28 | - | - | - | - | - | - | - | - |
| 98 | Hexi 30 | 1993 | - | - | - | - | - | - | + |
| 99 | Hexi 32 | - | - | - | - | - | - | - | + |
| 100 | Hexi 34 | 1997 | - | - | - | + | - | - | - |
| 101 | Hexi 35 | 1997 | - | - | - | - | - | - | - |
| 102 | Hexi 38 | - | - | - | - | + | - | - | - |
| 103 | Hexi 40 | 1999 | - | - | - | + | - | - | - |
| 104 | Hexi 41 | 1999 | - | - | - | - | - | - | + |
| 105 | Hexi 42 | 1999 | - | - | - | - | - | - | + |
| 106 | Fengdao 9 | 1997 | - | - | - | - | - | - | - |
| 107 | Fengdao 11 | 1999 | - | - | - | + | - | - | - |
| 108 | Fengdao 12 | - | - | - | - | + | - | - | - |
| 109 | Fengdao 14 | 2001 | - | - | - | - | - | - | - |
| 110 | Fengdao 15 | 2002 | - | - | - | - | - | - | - |
| 111 | Fengdao 16 | 2004 | - | - | - | - | - | - | - |
| 112 | Fengdao 17 | 2003 | - | - | - | + | - | - | - |
| 113 | Fengdao 18 | 2005 | - | - | - | - | - | - | - |
| 114 | Fengdao 19 | 2006 | - | - | - | - | - | - | - |
| 115 | Fengdao 20 | 2006 | - | - | - | - | - | - | - |
| 116 | Fengdao 21 | 2007 | - | - | - | + | - | - | - |
| 117 | Fengdao 23 | 2010 | - | - | - | - | - | - | + |
| 118 | Fengdao 29 | 2014 | - | - | - | - | - | - | - |
| 119 | Fengdao 30 | 2017 | - | - | - | + | - | - | - |
| 120 | Jinggeng 3 | 2005 | - | - | - | - | - | - | - |
| 121 | Jinggeng 6 | 2009 | - | - | - | - | - | - | - |
| 122 | Dianyuyi | 1983 | - | - | - | + | - | - | - |
| 123 | Jinggeng 8 | 2001 | - | - | - | + | - | - | - |
| 124 | Jinggeng 11 | 2007 | - | - | - | + | - | - | - |
| 125 | Jinggeng 12 | 2007 | - | - | - | + | - | - | - |
| 126 | Jinggeng 13 | 2007 | - | - | - | + | - | - | - |
| 127 | Jinggeng 14 | 2007 | - | - | - | + | - | - | - |
| 128 | Jinggeng 16 | 2010 | - | - | - | + | - | - | - |
| 129 | Jinggeng 17 | 2010 | - | - | - | + | - | - | - |
| 130 | Jinggeng 18 | 2010 | - | - | - | + | - | - | - |
| 131 | Jinggeng 26 | 2014 | + | - | - | - | - | - | - |
| 132 | Jingdao 1 | 2018 | - | - | - | - | - | - | - |
| 133 | Jingdao 5 | 2018 | - | - | - | - | - | - | + |
| 134 | Jinggengyou 1 | 2003 | - | - | - | - | - | - | - |
| 135 | Jinggengyou 2 | 2005 | - | - | - | - | - | - | - |
| 136 | Jinggengyou 3 | 2005 | - | - | - | - | - | - | + |
| 137 | Ligeng 4 | - | - | - | - | - | - | - | - |
| 138 | Ligeng 6 | 2004 | - | - | - | - | - | - | - |
| 139 | Ligeng 9 | 2012 | - | - | - | - | - | - | - |
| 140 | Ligeng 10 | 2009 | - | - | - | - | - | - | - |
| 141 | Ligeng 11 | 2010 | - | - | - | - | - | - | - |
| 142 | Ligeng 15 | 2014 | - | - | - | - | - | - | + |
| 143 | Ligeng 18 | 2018 | - | - | - | + | - | - | - |
| 144 | Ligeng 22 | 2019 | - | - | - | + | - | - | - |
| 145 | Ligeng 23 | 2019 | - | - | - | - | - | - | - |
| 146 | Ligeng 314 | 2007 | - | - | - | - | - | - | - |
| 147 | Xiugeng 12 | 2011 | - | - | - | - | - | - | - |
| 148 | Xiugeng 18 | 2015 | - | - | + | - | - | - | - |
| 149 | Xiugeng 22 | 2013 | - | - | - | - | - | - | - |
| 150 | Xiugeng 26 | 2018 | - | - | - | - | - | - | - |
| 151 | Xiugeng 28 | 2018 | - | - | - | + | - | - | - |
| 152 | Xiugeng 29 | 2020 | - | - | - | + | - | - | - |
| 153 | Xiu 87-15 | 2003 | - | - | - | + | - | - | - |
| 154 | Xiu 191-7 | 2011 | - | - | - | - | - | - | - |
| 155 | Changgeng 8 | 2004 | - | - | - | + | - | - | - |
| 156 | Changgeng 9 | 2007 | - | - | - | - | - | - | - |
| 157 | Longke 16 | 2015 | - | - | - | - | - | - | + |
| 158 | Yugeng 24 | 2018 | - | - | - | + | - | - | - |
| 159 | Yugeng 25 | 2019 | - | - | - | - | - | - | + |
| 160 | Tageng 3 | 2014 | - | - | - | + | - | - | - |
| 161 | Niangeng 7 | 1993 | - | - | - | + | - | - | - |
| 162 | Jinrui 4 | 2019 | - | - | - | - | - | - | + |
| 163 | Jinning 78-102 | - | - | - | - | - | - | - | - |
“-“: refers to cultivars that lack the resistance gene; “+”: refers to cultivars that contain the resistance gene.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Liu, P.; Zhou, W.; Dong, L.; Liu, S.; Nawaz, G.; Huang, L.; Yang, Q. Development and Application of Pik Locus-Specific Molecular Markers for Blast Resistance Genes in Yunnan Japonica Rice Cultivars. Plants 2025, 14, 592. https://doi.org/10.3390/plants14040592
AMA Style
Liu P, Zhou W, Dong L, Liu S, Nawaz G, Huang L, Yang Q. Development and Application of Pik Locus-Specific Molecular Markers for Blast Resistance Genes in Yunnan Japonica Rice Cultivars. Plants. 2025; 14(4):592. https://doi.org/10.3390/plants14040592
Chicago/Turabian StyleLiu, Pei, Wumin Zhou, Liying Dong, Shufang Liu, Gul Nawaz, Liyu Huang, and Qinzhong Yang. 2025. "Development and Application of Pik Locus-Specific Molecular Markers for Blast Resistance Genes in Yunnan Japonica Rice Cultivars" Plants 14, no. 4: 592. https://doi.org/10.3390/plants14040592
APA StyleLiu, P., Zhou, W., Dong, L., Liu, S., Nawaz, G., Huang, L., & Yang, Q. (2025). Development and Application of Pik Locus-Specific Molecular Markers for Blast Resistance Genes in Yunnan Japonica Rice Cultivars. Plants, 14(4), 592. https://doi.org/10.3390/plants14040592
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
