Genome Size Variation Is Associated with Hybrid Vigor in Near-Isogenic Backgrounds in Brassica napus
Abstract
1. Introduction
2. Results
2.1. Fertility and Restore Genetic Markers Identification of Induced Offspring
2.2. Ploidy and Chromosome Identification Number of Induced Offspring
2.3. SNP Chip Identification and Analysis
2.4. Flow Cytometry Detection and Analysis
2.5. Investigation Results of Agronomic Traits
2.6. Resequencing Analysis
2.7. Correlation Analysis of Traits
3. Discussion
4. Experimental Materials and Methods
4.1. Experimental Materials
4.2. DNA Extraction and Detection
4.3. Molecular Marker Identification Restores Genes
4.4. SNP Purity Identification
4.5. Ploidy Detection by Flow Cytometry
4.6. Fertility Identification
4.7. Cytological Observation
4.8. Investigation of Agronomic Traits
4.9. Resequencing
4.9.1. Sample Sequencing, Sequence Alignment, and Variant Detection
4.9.2. Sample Genetic Distance Cluster Analysis
4.9.3. Analysis of the Differences in SNP Sites Between High and Low Yields
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Appendix A
| Number | Materials | Restore Genetic Markers | Fertility | Number | Materials | Restore Genetic Markers | Fertility |
|---|---|---|---|---|---|---|---|
| 1 | 3689-1 | + | Fertile | 29 | 157-22 | + | Fertile |
| 2 | 3689-2 | + | Fertile | 30 | 157-23 | + | Fertile |
| 3 | 3689-4 | + | Fertile | 31 | 157-24 | + | Fertile |
| 4 | 3689-6 | + | Fertile | 32 | 157-25 | + | Fertile |
| 5 | 3689-7 | + | Fertile | 33 | 157-29 | + | Fertile |
| 6 | 3689-8 | + | Fertile | 34 | 157-31 | + | Fertile |
| 7 | 3689-9 | + | Fertile | 35 | 157-34 | + | Fertile |
| 8 | 3689-10 | + | Fertile | 36 | 157-35 | + | Fertile |
| 9 | 3689-12 | + | Fertile | 37 | 4537-3 | + | Fertile |
| 10 | 3689-14 | + | Fertile | 38 | 4538-2 | + | Fertile |
| 11 | 3689-17 | + | Fertile | 39 | 4539-3 | + | Fertile |
| 12 | 3689-18 | + | Fertile | 40 | 4540-1 | + | Fertile |
| 13 | 3689-19 | + | Fertile | 41 | 4541-1 | + | Fertile |
| 14 | 3689-20 | + | Fertile | 42 | 4542-1 | + | Fertile |
| 15 | 3689-21 | + | Fertile | 43 | 4543-1 | + | Fertile |
| 16 | 3689-23 | + | Fertile | 44 | 4545-2 | + | Fertile |
| 17 | 3689-24 | + | Fertile | 45 | 4546-3 | + | Fertile |
| 18 | 3689-25 | + | Fertile | 46 | 4547-1 | + | Fertile |
| 19 | 3689-27 | + | Fertile | 47 | 4548-3 | + | Fertile |
| 20 | 3689-28 | + | Fertile | 48 | 4549-3 | + | Fertile |
| 21 | 157-9 | + | Fertile | 49 | 4550-2 | + | Fertile |
| 22 | 157-11 | + | Fertile | 50 | 4551-1 | + | Fertile |
| 23 | 157-12 | + | Fertile | 51 | 4552-1 | + | Fertile |
| 24 | 157-13 | + | Fertile | 52 | 4553-1 | + | Fertile |
| 25 | 157-14 | + | Fertile | 53 | 4554-3 | + | Fertile |
| 26 | 157-16 | + | Fertile | 54 | 4556-1 | + | Fertile |
| 27 | 157-20 | + | Fertile | 55 | 4557-2 | + | Fertile |
| 28 | 157-21 | + | Fertile | 56 | 4558-2 | + | Fertile |
| Plot 4: C02 157-16: Gated on (P2 in (R2 in R1)) | Count | Events/μL | % of This Plot | % of All | Mean PE-A | CV PE-A |
| This Plot | 607 | 11 | 100.00% | 0.47% | 424,725.43 | 48.65% |
| G1 (267,857.0/392,856.0) | 386 | 7 | 63.59% | 0.30% | 333,633.47 | 7.90% |
| G2 (574,406.0/705,357.0) | 59 | 1 | 9.72% | 0.05% | 641,913.85 | 5.02% |
| Plot 4: A04 3689-4: Gated on (P2 in (R2 in R1)) | Count | Events/μL | % of This Plot | % of All | Mean PE-A | CV PE-A |
| This Plot | 681 | 14 | 100.00% | 8.06% | 678,566.07 | 36.00% |
| G1 (491,071.0/607,142.0) | 362 | 8 | 53.16% | 4.29% | 547,692.81 | 4.96% |
| G2 (973,214.0/1,169,643.0) | 111 | 2 | 16.30% | 1.31% | 1,070,831.09 | 4.91% |
| Plot 4: B02 3689-14: Gated on (P2 in (R2 in R1)) | Count | Events/μL | % of This Plot | % of All | Mean PE-A | CV PE-A |
| This Plot | 568 | 8 | 100.00% | 3.34% | 801,962.85 | 33.03% |
| G1 (571,428.0/741,071.0) | 344 | 5 | 60.56% | 2.02% | 651,086.08 | 5.82% |
| G2 (1,124,999.0/1,321,428.0) | 74 | 1 | 13.03% | 0.43% | 1,219,503.59 | 4.49% |
| Plot 4: C02 3689-26: Gated on (P2 in (R2 in R1)) | Count | Events/μL | % of This Plot | % of All | Mean PE-A | CV PE-A |
| This Plot | 1303 | 23 | 100.00% | 5.13% | 962,033.02 | 32.25% |
| G1 (642,857.0/750,000.0) | 399 | 7 | 30.62% | 1.57% | 692,118.19 | 3.90% |
| G2 (1,285,714.0/1,392,857.0) | 231 | 4 | 17.73% | 0.91% | 1,340,552.78 | 2.00% |
| 0068A | C2970 | RY18 | 3689-1 | 3689-2 | 3689-4 | 3689-6 | 3689-7 | 3689-8 | 3689-9 | 3689-10 | 3689-12 | 3689-14 | 3689-17 | 3689-18 | |
| 0068A | 0.000 | 0.357 | 0.346 | 0.249 | 0.274 | 0.240 | 0.278 | 0.245 | 0.245 | 0.182 | 0.298 | 0.292 | 0.299 | 0.299 | 0.285 |
| C2970 | 0.357 | 0.000 | 0.336 | 0.219 | 0.240 | 0.286 | 0.276 | 0.250 | 0.282 | 0.291 | 0.223 | 0.356 | 0.282 | 0.241 | 0.289 |
| RY18 | 0.346 | 0.336 | 0.000 | 0.227 | 0.184 | 0.160 | 0.134 | 0.199 | 0.165 | 0.220 | 0.223 | 0.206 | 0.131 | 0.152 | 0.116 |
| Y3380 | 0.400 | 0.396 | 0.537 | 0.448 | 0.461 | 0.454 | 0.475 | 0.463 | 0.471 | 0.434 | 0.433 | 0.490 | 0.491 | 0.448 | 0.482 |
| 3689-19 | 3689-20 | 3689-21 | 3689-23 | 3689-24 | 3689-25 | 3689-27 | 3689-28 | 157-9 | 157-11 | 157-12 | 157-13 | 157-14 | 157-16 | 157-20 | |
| 0068A | 0.288 | 0.267 | 0.237 | 0.228 | 0.298 | 0.284 | 0.282 | 0.284 | 0.241 | 0.290 | 0.246 | 0.303 | 0.278 | 0.300 | 0.233 |
| C2970 | 0.215 | 0.293 | 0.294 | 0.309 | 0.255 | 0.251 | 0.190 | 0.304 | 0.267 | 0.311 | 0.315 | 0.206 | 0.304 | 0.254 | 0.245 |
| RY18 | 0.191 | 0.132 | 0.162 | 0.151 | 0.143 | 0.162 | 0.219 | 0.143 | 0.183 | 0.150 | 0.275 | 0.241 | 0.155 | 0.138 | 0.216 |
| Y3380 | 0.447 | 0.479 | 0.482 | 0.481 | 0.469 | 0.479 | 0.423 | 0.476 | 0.455 | 0.489 | 0.480 | 0.434 | 0.488 | 0.481 | 0.469 |
| 157-21 | 157-22 | 157-23 | 157-24 | 157-25 | 157-29 | 157-31 | 157-34 | 157-35 | 4537-3 | 4538-2 | 4539-3 | 4540-1 | 4541-1 | 4542-1 | |
| 0068A | 0.293 | 0.270 | 0.274 | 0.274 | 0.311 | 0.304 | 0.261 | 0.307 | 0.288 | 0.250 | 0.244 | 0.218 | 0.269 | 0.176 | 0.291 |
| C2970 | 0.225 | 0.272 | 0.245 | 0.287 | 0.230 | 0.232 | 0.250 | 0.227 | 0.300 | 0.272 | 0.175 | 0.246 | 0.218 | 0.223 | 0.210 |
| RY18 | 0.176 | 0.152 | 0.172 | 0.158 | 0.193 | 0.161 | 0.183 | 0.149 | 0.138 | 0.227 | 0.274 | 0.234 | 0.230 | 0.301 | 0.232 |
| Y330 | 0.466 | 0.474 | 0.434 | 0.462 | 0.454 | 0.476 | 0.475 | 0.460 | 0.484 | 0.452 | 0.390 | 0.444 | 0.449 | 0.412 | 0.448 |
| 4543-1 | 4545-2 | 4546-3 | 4547-1 | 4548-3 | 4549-3 | 4550-2 | 4551-1 | 4552-1 | 4553-1 | 4554-3 | 4556-1 | 4557-2 | 4558-2 | ||
| 0068A | 0.204 | 0.175 | 0.249 | 0.225 | 0.216 | 0.306 | 0.268 | 0.210 | 0.237 | 0.150 | 0.249 | 0.173 | 0.195 | 0.242 | |
| C2970 | 0.243 | 0.237 | 0.181 | 0.224 | 0.276 | 0.185 | 0.208 | 0.248 | 0.252 | 0.308 | 0.250 | 0.256 | 0.279 | 0.214 | |
| RY18 | 0.247 | 0.286 | 0.272 | 0.272 | 0.236 | 0.202 | 0.219 | 0.275 | 0.218 | 0.286 | 0.221 | 0.270 | 0.261 | 0.244 | |
| Y3380 | 0.452 | 0.433 | 0.397 | 0.442 | 0.452 | 0.428 | 0.429 | 0.433 | 0.453 | 0.435 | 0.436 | 0.435 | 0.445 | 0.444 |
| Number | Test Number of Plants | Fluorescence Intensity in Phase G1 | Relative Average Genome Size/Mb | The Increase in Genomic Size Compared with ZS 11 | |
|---|---|---|---|---|---|
| Average | Relative Standard Deviation | ||||
| ZS11 | 2 | 331,439.63 | 1.61% | 966.00 | 0.00% |
| 3689-1 | 5 | 330,048.96 | 1.78% | 961.95 | −0.42% |
| 3689-2 | 5 | 308,700.23 | 1.94% | 899.72 | −6.86% |
| 3689-4 | 5 | 283,661.14 | 2.02% | 826.75 | −14.42% |
| 3689-6 | 5 | 307,073.19 | 3.07% | 894.98 | −7.35% |
| 3689-7 | 5 | 304,885.00 | 7.52% | 888.61 | −8.01% |
| 3689-8 | 5 | 322,773.94 | 0.59% | 940.74 | −2.61% |
| 3689-9 | 5 | 338,536.26 | 1.59% | 986.68 | 2.14% |
| 3689-10 | 5 | 343,593.79 | 0.54% | 1001.42 | 3.67% |
| 3689-12 | 5 | 345,379.29 | 0.90% | 1006.63 | 4.21% |
| 3689-14 | 5 | 344,918.85 | 1.55% | 1005.29 | 4.07% |
| 3689-17 | 5 | 347,072.10 | 2.15% | 1011.56 | 4.72% |
| 3689-18 | 5 | 338,265.21 | 1.02% | 985.89 | 2.06% |
| 3689-19 | 5 | 328,884.01 | 1.49% | 958.55 | −0.77% |
| 3689-20 | 5 | 333,162.84 | 3.38% | 971.02 | 0.52% |
| 3689-21 | 5 | 329,028.76 | 3.21% | 958.97 | −0.73% |
| 3689-23 | 2 | 340,860.48 | 2.83% | 993.46 | 2.84% |
| 3689-25 | 5 | 336,232.51 | 3.29% | 979.97 | 1.45% |
| 157-9 | 5 | 323,060.78 | 1.81% | 941.58 | −2.53% |
| 157-11 | 5 | 339,522.24 | 8.06% | 989.56 | 2.44% |
| 157-13 | 5 | 342,151.37 | 2.11% | 997.22 | 3.23% |
| 157-14 | 5 | 350,118.44 | 2.43% | 1020.44 | 5.64% |
| 157-16 | 5 | 336,066.49 | 1.35% | 979.49 | 1.40% |
| 157-20 | 5 | 342,931.75 | 2.54% | 999.49 | 3.47% |
| 157-21 | 5 | 328,161.73 | 2.67% | 956.45 | −0.99% |
| 157-22 | 5 | 316,939.54 | 3.74% | 923.74 | −4.37% |
| 157-23 | 5 | 310,152.29 | 5.47% | 903.96 | −6.42% |
| 157-24 | 5 | 314,106.96 | 2.18% | 915.48 | −5.23% |
| 157-25 | 4 | 329,123.77 | 6.83% | 959.25 | −0.70% |
| 157-29 | 5 | 343,853.51 | 3.97% | 1002.18 | 3.75% |
| 157-31 | 5 | 310,989.94 | 2.90% | 906.40 | −6.17% |
| 157-35 | 5 | 339,823.63 | 3.49% | 990.44 | 2.53% |
| 4537-3 | 5 | 313,580.55 | 3.85% | 913.95 | −5.39% |
| 4538-5 | 5 | 308,924.50 | 2.60% | 900.38 | −6.79% |
| 4539-5 | 5 | 321,489.20 | 3.28% | 937.00 | −3.00% |
| 4540-3 | 5 | 290,607.33 | 3.85% | 846.99 | −12.32% |
| 4541-1 | 5 | 301,427.65 | 4.93% | 878.53 | −9.06% |
| 4542-5 | 5 | 298,009.31 | 4.70% | 868.57 | −10.09% |
| 4543-4 | 5 | 280,999.34 | 5.87% | 818.99 | −15.22% |
| 4545-1 | 5 | 305,779.37 | 1.53% | 891.21 | −7.74% |
| 4546-5 | 5 | 326,360.43 | 1.35% | 951.20 | −1.53% |
| 4547-4 | 5 | 335,129.06 | 3.01% | 976.75 | 1.11% |
| 4548-1 | 5 | 351,505.20 | 2.68% | 1024.48 | 6.05% |
| 4549-4 | 5 | 303,252.18 | 5.28% | 883.85 | −8.50% |
| 4550-1 | 5 | 317,178.44 | 5.25% | 924.43 | −4.30% |
| 4551-3 | 5 | 316,947.66 | 3.61% | 923.76 | −4.37% |
| 4552-1 | 5 | 288,348.39 | 3.35% | 840.41 | −13.00% |
| 4553-1 | 5 | 349,756.81 | 1.83% | 1019.39 | 5.53% |
| 4554-5 | 5 | 338,797.82 | 5.87% | 987.45 | 2.22% |
| 4556-4 | 5 | 349,115.38 | 2.45% | 1017.52 | 5.33% |
| 4557-1 | 5 | 327,468.90 | 3.79% | 954.43 | −1.20% |
| 4558-1 | 5 | 345,539.26 | 1.54% | 1007.09 | 4.25% |
| 4546-5 | 5 | 326,360.43 | 1.35% | 951.20 | −1.53% |
| 4547-4 | 5 | 335,129.06 | 3.01% | 976.75 | 1.11% |
| 4548-1 | 5 | 351,505.20 | 2.68% | 1024.48 | 6.05% |
| 4549-4 | 5 | 303,252.18 | 5.28% | 883.85 | −8.50% |
| 4550-1 | 5 | 317,178.44 | 5.25% | 924.43 | −4.30% |
| 4551-3 | 5 | 316,947.66 | 3.61% | 923.76 | −4.37% |
| 4552-1 | 5 | 288,348.39 | 3.35% | 840.41 | −13.00% |
| 4553-1 | 5 | 349,756.81 | 1.83% | 1019.39 | 5.53% |
| 4554-5 | 5 | 338,797.82 | 5.87% | 987.45 | 2.22% |
| 4556-4 | 5 | 349,115.38 | 2.45% | 1017.52 | 5.33% |
| 4557-1 | 5 | 327,468.90 | 3.79% | 954.43 | −1.20% |
| 4558-1 | 5 | 345,539.26 | 1.54% | 1007.09 | 4.25% |
| Number | Plant Height /cm | Rootstock Diameter /cm | Branch Height /cm | Fruiting Length of Main Branch /cm | Number of Primary Effective Branch /n | Number of Effective Silique on the Main Axis/n | Number of Effective Silique on the Entire Plant/n | Number of Kernels /n | 1000- Grain Weigh /g | Theoreti-cal Yield Per Plant/g | Actual Yield of the Plot/g | Oil Content/% | Glucosi- Nolucic /% | Protein /% | Acid /% |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| RY18 | 161.00 | 0.68 | 78.00 | 48.00 | 4.2 | 61.2 | 144.0 | 19 | 2.80 | 6.51 | 902 | 44.24 | 27.37 | 18.41 | 1.20 |
| F1-1 | 147.60 | 1.05 | 59.40 | 54.20 | 4.4 | 48.6 | 157.2 | 22 | 2.65 | 7.78 | 477 | 45.93 | 26.02 | 17.05 | 1.37 |
| F1-2 | 149.80 | 0.94 | 76.20 | 49.80 | 3.8 | 54.6 | 120.6 | 23 | 2.7 | 6.39 | 555 | 47.80 | 28.07 | 15.85 | 0.94 |
| F1-3 | 146.60 | 0.99 | 67.60 | 48.80 | 4.2 | 52.6 | 146.0 | 18 | 2.88 | 6.43 | 477 | 49.03 | 26.52 | 16.82 | 1.25 |
| F1-4 | 152.20 | 1.13 | 68.60 | 58.60 | 4.4 | 61.2 | 155.8 | 19 | 2.89 | 7.28 | 647 | 43.42 | 23.65 | 18.03 | 0.96 |
| F1-5 | 160.20 | 0.99 | 72.40 | 58.84 | 4.2 | 58.2 | 132.4 | 18 | 2.71 | 5.47 | 689 | 47.76 | 25.01 | 17.00 | 1.31 |
| F1-6 | 155.40 | 1.07 | 67.00 | 55.80 | 4.6 | 62.2 | 170.4 | 21 | 2.52 | 7.65 | 527 | 46.11 | 27.58 | 17.84 | 1.22 |
| F1-7 | 160.80 | 0.84 | 72.80 | 51.60 | 5.2 | 59.8 | 150.0 | 22 | 2.62 | 7.35 | 759 | 46.14 | 25.21 | 18.36 | 1.26 |
| F1-8 | 164.20 | 1.27 | 71.20 | 56.60 | 4.8 | 63.2 | 231.8 | 20 | 2.7 | 10.60 | 596 | 44.49 | 25.64 | 18.31 | 0.80 |
| F1-9 | 158.20 | 0.90 | 76.00 | 57.00 | 3.8 | 56.0 | 125.0 | 19 | 2.61 | 5.27 | 828 | 44.60 | 26.24 | 18.30 | 0.71 |
| F1-10 | 173.20 | 1.19 | 75.40 | 67.20 | 3.8 | 62.8 | 181.8 | 22 | 2.58 | 8.73 | 670 | 48.25 | 26.86 | 17.30 | 1.36 |
| F1-11 | 170.20 | 0.86 | 70.20 | 60.00 | 5.2 | 70.0 | 218.8 | 20 | 2.63 | 9.75 | 622 | 47.50 | 26.40 | 17.48 | 1.15 |
| F1-12 | 180.40 | 1.29 | 73.20 | 67.40 | 6.0 | 67.2 | 236.2 | 18 | 2.64 | 9.53 | 559 | 44.34 | 26.43 | 17.99 | 1.04 |
| F1-13 | 170.20 | 1.42 | 68.60 | 66.20 | 5.0 | 68.0 | 194.8 | 21 | 2.77 | 9.64 | 439 | 43.16 | 26.82 | 17.97 | 0.90 |
| F1-14 | 174.00 | 1.26 | 69.20 | 62.80 | 5.4 | 70.4 | 222.0 | 23 | 3.01 | 13.06 | 406 | 43.76 | 25.29 | 19.11 | 1.41 |
| F1-15 | 168.00 | 1.24 | 72.60 | 65.20 | 4.4 | 70.6 | 174.2 | 19 | 2.63 | 7.39 | 548 | 45.58 | 26.43 | 17.16 | 1.32 |
| F1-16 | 165.40 | 1.29 | 78.00 | 67.20 | 4.4 | 66.8 | 155.0 | 21 | 2.83 | 7.83 | 612 | 44.96 | 25.25 | 19.09 | 1.29 |
| F1-17 | 166.20 | 1.11 | 58.80 | 62.60 | 6.0 | 75.4 | 270.6 | 20 | 2.71 | 12.44 | 543 | 44.97 | 25.87 | 18.18 | 1.03 |
| F1-18 | 164.20 | 1.15 | 77.20 | 60.80 | 4.6 | 57.4 | 153.6 | 19 | 2.69 | 6.69 | 661 | 46.41 | 29.50 | 18.52 | 1.64 |
| F1-19 | 150.00 | 1.02 | 68.20 | 52.20 | 3.8 | 50.8 | 121.4 | 22 | 2.73 | 6.18 | 458 | 45.38 | 25.56 | 17.32 | 0.82 |
| F1-20 | 167.20 | 1.18 | 81.00 | 57.60 | 4.2 | 63.2 | 136.8 | 23 | 2.63 | 7.04 | 501 | 44.64 | 28.14 | 17.80 | 0.91 |
| F1-21 | 170.60 | 1.09 | 74.60 | 59.20 | 5.4 | 68.6 | 196.8 | 20 | 2.52 | 8.44 | 388 | 47.66 | 25.42 | 17.22 | 1.30 |
| F1-22 | 172.00 | 1.35 | 65.20 | 54.40 | 5.8 | 67.6 | 276.8 | 23 | 2.46 | 13.32 | 438 | 46.38 | 24.88 | 17.21 | 0.69 |
| F1-23 | 184.80 | 1.18 | 74.40 | 77.40 | 5.0 | 81.6 | 333.2 | 21 | 2.93 | 17.42 | 507 | 45.55 | 24.75 | 18.05 | 0.82 |
| F1-24 | 173.60 | 1.29 | 63.20 | 65.00 | 6.0 | 70.4 | 241.4 | 20 | 2.53 | 10.37 | 405 | 45.27 | 26.29 | 17.69 | 1.03 |
| F1-25 | 172.60 | 1.20 | 79.80 | 51.80 | 6.0 | 59.0 | 199.8 | 19 | 2.71 | 8.75 | 625 | 41.47 | 29.35 | 19.22 | 1.20 |
| F1-26 | 190.20 | 1.42 | 80.20 | 64.20 | 5.8 | 72.0 | 273.6 | 24 | 2.63 | 14.70 | 798 | 42.45 | 23.82 | 19.74 | 1.14 |
| F1-27 | 195.75 | 2.09 | 71.50 | 58.60 | 6.3 | 89.3 | 319.6 | 25 | 2.72 | 18.50 | 834 | 46.23 | 27.08 | 18.70 | 1.07 |
| F1-28 | 182.40 | 1.49 | 68.60 | 69.90 | 6.0 | 77.2 | 316.8 | 25 | 2.67 | 17.99 | 904 | 43.28 | 28.80 | 19.64 | 1.68 |
| F1-29 | 189.20 | 1.62 | 66.80 | 77.20 | 5.8 | 75.4 | 320.0 | 22 | 2.9 | 17.35 | 589 | 45.23 | 27.53 | 18.13 | 1.34 |
| F1-30 | 187.00 | 1.44 | 67.20 | 75.40 | 5.4 | 82.0 | 340.0 | 19 | 2.85 | 15.65 | 699 | 46.49 | 25.86 | 17.55 | 1.15 |
| F1-31 | 194.00 | 1.31 | 84.00 | 66.20 | 5.4 | 76.2 | 231.8 | 21 | 2.7 | 11.18 | 849 | 43.17 | 25.98 | 18.12 | 0.91 |
| F1-32 | 173.00 | 1.55 | 65.60 | 72.00 | 5.6 | 71.8 | 277.6 | 20 | 2.74 | 12.95 | 684 | 43.85 | 26.15 | 19.29 | 0.98 |
| F1-33 | 200.40 | 1.46 | 82.00 | 67.60 | 6.4 | 75.6 | 453.6 | 21 | 3.2 | 25.93 | 695 | 40.98 | 26.66 | 19.45 | 0.68 |
| F1-34 | 193.40 | 1.86 | 60.80 | 74.80 | 6.8 | 91.6 | 465.4 | 23 | 2.97 | 27.00 | 852 | 43.13 | 27.07 | 20.23 | 0.93 |
| F1-35 | 174.75 | 1.63 | 82.50 | 71.75 | 6.0 | 74.5 | 364.6 | 22 | 2.78 | 18.97 | 831 | 43.76 | 26.64 | 19.34 | 0.92 |
| F1-36 | 188.80 | 1.11 | 73.80 | 74.60 | 6.2 | 91.0 | 393.8 | 22 | 2.98 | 21.96 | 861 | 45.15 | 25.49 | 19.05 | 0.81 |
| F1-37 | 175.20 | 1.49 | 76.00 | 65.60 | 6.6 | 78.4 | 280.6 | 21 | 2.66 | 13.34 | 655 | 44.87 | 26.52 | 17.21 | 1.57 |
| F1-38 | 169.00 | 0.96 | 72.60 | 59.80 | 5.8 | 64.0 | 205.4 | 24 | 3.05 | 12.76 | 900 | 43.31 | 33.46 | 19.89 | 2.01 |
| F1-39 | 191.40 | 1.41 | 80.00 | 75.00 | 5.0 | 78.0 | 271.6 | 21 | 2.95 | 14.32 | 722 | 44.47 | 31.12 | 18.61 | 1.33 |
| F1-40 | 179.40 | 1.40 | 69.60 | 67.40 | 6.0 | 70.6 | 215.0 | 23 | 2.71 | 13.25 | 894 | 43.77 | 24.96 | 18.56 | 1.00 |
| F1-41 | 161.50 | 0.70 | 68.50 | 64.50 | 4.3 | 62.8 | 134.2 | 22 | 2.84 | 7.12 | 920 | 44.66 | 24.47 | 18.05 | 0.84 |
| F1-42 | 172.00 | 0.76 | 66.80 | 64.80 | 5.4 | 67.8 | 239.2 | 24 | 3.16 | 15.41 | 762 | 45.04 | 25.62 | 17.73 | 0.64 |
| F1-43 | 175.00 | 0.93 | 59.80 | 67.60 | 6.4 | 79.0 | 420.8 | 23 | 2.91 | 23.89 | 760 | 42.90 | 25.71 | 20.03 | 0.92 |
| F1-44 | 164.60 | 1.08 | 56.00 | 64.20 | 6.0 | 78.2 | 355.4 | 25 | 2.67 | 20.14 | 580 | 45.08 | 23.48 | 18.41 | 1.41 |
| F1-45 | 163.00 | 0.60 | 62.60 | 61.80 | 5.2 | 61.8 | 198.0 | 21 | 2.89 | 10.21 | 698 | 42.67 | 27.50 | 21.54 | 0.74 |
| F1-46 | 175.20 | 1.56 | 61.40 | 69.00 | 6.2 | 77.2 | 349.2 | 22 | 3.05 | 19.91 | 721 | 45.78 | 25.60 | 18.86 | 0.87 |
| F1-47 | 183.20 | 1.34 | 72.00 | 65.60 | 5.2 | 67.4 | 233.6 | 22 | 3.01 | 13.17 | 891 | 45.13 | 25.23 | 18.76 | 1.02 |
| F1-48 | 189.20 | 1.11 | 76.60 | 67.60 | 5.8 | 64.2 | 265.2 | 23 | 2.76 | 14.30 | 749 | 48.49 | 27.02 | 17.95 | 1.36 |
| F1-49 | 163.40 | 0.90 | 63.00 | 58.50 | 5.0 | 71.0 | 299.0 | 19 | 2.78 | 13.42 | 316 | 45.26 | 29.30 | 18.51 | 1.10 |
| F1-50 | 182.50 | 1.05 | 56.25 | 67.00 | 6.3 | 65.0 | 231.0 | 21 | 2.99 | 12.33 | 895 | 46.96 | 27.43 | 18.15 | 1.63 |
| F1-51 | 167.40 | 0.81 | 70.40 | 67.20 | 4.6 | 68.8 | 178.0 | 20 | 2.77 | 8.38 | 711 | 40.41 | 27.75 | 19.79 | 0.96 |
| F1-52 | 173.40 | 1.48 | 61.80 | 69.20 | 4.8 | 73.6 | 265.4 | 23 | 2.93 | 15.18 | 689 | 44.84 | 29.29 | 18.65 | 1.12 |
| F1-53 | 155.80 | 0.94 | 61.40 | 48.80 | 5.8 | 56.6 | 203.0 | 22 | 2.79 | 10.59 | 651 | 45.90 | 33.49 | 17.72 | 1.99 |
| F1-54 | 167.40 | 1.26 | 52.60 | 62.40 | 5.4 | 65.4 | 222.2 | 21 | 2.76 | 10.94 | 614 | 46.64 | 25.90 | 16.96 | 0.87 |
| F1 average | 172.13 | 1.20 | 69.84 | 63.55 | 5.3 | 68.8 | 241.2 | 21 | 2.78 | 12.44 | 660 | 45.01 | 26.71 | 18.32 | 1.12 |
| F1 Average | RY18 | Variation Range | Average | Positive Proportion | |
|---|---|---|---|---|---|
| Plant height/cm | 172.13 | 161.00 | −8.94~24.47% | 6.91% | 81.48% |
| Rootstock diameter/cm | 1.20 | 0.68 | −11.54~209.17% | 78.21% | 98.15% |
| Branch height/cm | 69.84 | 78.00 | −32.56~7.69% | −10.47% | 12.96% |
| Fruiting length of main branch/cm | 63.55 | 48.00 | 1.67~61.25% | 32.39% | 100% |
| Number of primary effective branch/n | 5.3 | 4.2 | −9.52~61.90% | 25.99% | 87.04% |
| Number of effective silique on the main axis/n | 68.8 | 61.2 | −20.59~49.67% | 12.34% | 79.63% |
| number of effective silique on the entire plant/n | 241.2 | 144.0 | −16.25~223.19% | 67.52% | 88.89% |
| Number of kernels/n | 21 | 19 | −5.26~31.58% | 12.48% | 81.48% |
| 1000-grain weigh/g | 2.78 | 2.80 | −12.14~14.29% | −0.73% | 37.04% |
| Theoretical yield of singe plant/g | 12.44 | 6.51 | −19.08~314.63% | 91.01% | 90.74% |
| Actual yield of singe plant/g | 660 | 902 | −64.95~2.03% | −26.76% | 3.70% |
| Oil content/% | 45.01 | 44.24 | −8.65~10.83% | 1.74% | 70.37% |
| Glucosinolucic/% | 26.71 | 27.37 | −14.21~22.35% | −2.43% | 27.78% |
| Protein/% | 18.32 | 18.14 | −13.91~16.97% | −0.47% | 42.59% |
| Acid/% | 1.12 | 1.20 | −46.56~67.12% | −6.51% | 37.04% |
| Female Parent | Male Parent | Hybrid F1 | Female Parent | Male Parent | Hybrid F1 | Female Parent | Male Parent | Hybrid F1 |
|---|---|---|---|---|---|---|---|---|
| 0068A | 3689-1 | F1-1 | 0068A | 157-9 | F1-19 | 0068A | 4539 | F1-37 |
| 3689-2 | F1-2 | 157-11 | F1-20 | 4540 | F1-38 | |||
| 3689-4 | F1-3 | 157-12 | F1-21 | 4541 | F1-39 | |||
| 3689-6 | F1-4 | 157-13 | F1-22 | 4542 | F1-40 | |||
| 3689-7 | F1-5 | 157-14 | F1-23 | 4543 | F1-41 | |||
| 3689-8 | F1-6 | 157-16 | F1-24 | 4545 | F1-42 | |||
| 3689-9 | F1-7 | 157-20 | F1-25 | 4546 | F1-43 | |||
| 3689-10 | F1-8 | 157-21 | F1-26 | 4547 | F1-44 | |||
| 3689-12 | F1-9 | 157-22 | F1-27 | 4548 | F1-45 | |||
| 3689-14 | F1-10 | 157-23 | F1-28 | 4549 | F1-46 | |||
| 3689-17 | F1-11 | 157-24 | F1-29 | 4550 | F1-47 | |||
| 3689-18 | F1-12 | 157-25 | F1-30 | 4551 | F1-48 | |||
| 3689-19 | F1-13 | 157-29 | F1-31 | 4552 | F1-49 | |||
| 3689-20 | F1-14 | 157-31 | F1-32 | 4553 | F1-50 | |||
| 3689-21 | F1-15 | 157-34 | F1-33 | 4554 | F1-51 | |||
| 3689-23 | F1-16 | 157-35 | F1-34 | 4556 | F1-52 | |||
| 3689-24 | F1-17 | 4537 | F1-35 | 4557 | F1-53 | |||
| 3689-25 | F1-18 | 4538 | F1-36 | 4558 | F1-54 |
| C2970 | 0068A | RY18 | F1-2 | F1-3 | F1-9 | F1-13 | F1-34 | F1-36 | F1-41 | 3689-2 | 3689-4 | 3689-12 | 3689-19 | 157-35 | 4538-5 | 4543-4 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C2970 | 0 | ||||||||||||||||
| 0068A | 0.4875 | 0 | |||||||||||||||
| RY18 | 0.2812 | 0.2663 | 0 | ||||||||||||||
| F1-2 | 0.3624 | 0.1665 | 0.1368 | 0 | |||||||||||||
| F1-3 | 0.378 | 0.1664 | 0.136 | 0.1499 | 0 | ||||||||||||
| F1-9 | 0.4144 | 0.1364 | 0.2073 | 0.1577 | 0.1849 | 0 | |||||||||||
| F1-13 | 0.4303 | 0.1041 | 0.1903 | 0.1548 | 0.1678 | 0.1791 | 0 | ||||||||||
| F1-34 | 0.3795 | 0.2305 | 0.2144 | 0.2305 | 0.2349 | 0.2636 | 0.2248 | 0 | |||||||||
| F1-36 | 0.3788 | 0.1714 | 0.1404 | 0.1448 | 0.134 | 0.1753 | 0.1556 | 0.2282 | 0 | ||||||||
| F1-41 | 0.3716 | 0.1451 | 0.154 | 0.1603 | 0.1417 | 0.1611 | 0.1584 | 0.2114 | 0.164 | 0 | |||||||
| 3689-2 | 0.254 | 0.2955 | 0.2366 | 0.1938 | 0.2764 | 0.2745 | 0.2727 | 0.3029 | 0.2463 | 0.2643 | 0 | ||||||
| 3689-4 | 0.2581 | 0.2754 | 0.1977 | 0.2294 | 0.1683 | 0.2538 | 0.2758 | 0.3018 | 0.2166 | 0.2201 | 0.2756 | 0 | |||||
| 3689-12 | 0.2488 | 0.3101 | 0.2256 | 0.2494 | 0.2499 | 0.3215 | 0.2865 | 0.2676 | 0.2507 | 0.2768 | 0.2382 | 0.2612 | 0 | ||||
| 3689-19 | 0.3487 | 0.2601 | 0.2627 | 0.2542 | 0.2848 | 0.1906 | 0.2687 | 0.3137 | 0.2719 | 0.2788 | 0.3381 | 0.2839 | 0.3704 | 0 | |||
| 157-35 | 0.3261 | 0.2128 | 0.2119 | 0.2268 | 0.2302 | 0.2395 | 0.2282 | 0.1917 | 0.238 | 0.1983 | 0.2809 | 0.2673 | 0.2854 | 0.2604 | 0 | ||
| 4538-5 | 0.2614 | 0.2986 | 0.2472 | 0.2529 | 0.2642 | 0.2819 | 0.291 | 0.3245 | 0.1928 | 0.2807 | 0.2179 | 0.2368 | 0.2112 | 0.3312 | 0.2817 | 0 | |
| 4543-4 | 0.2902 | 0.2478 | 0.2313 | 0.2512 | 0.2311 | 0.2614 | 0.2482 | 0.2742 | 0.2536 | 0.1464 | 0.2632 | 0.2252 | 0.2976 | 0.3312 | 0.2397 | 0.3111 | 0 |
| High-Yield Site | Low Yield Site | Common Sites for High and Low Yields | Remove the High-Yield Sites of the Common Sites | Remove the Low-Yield Sites of the Common Sites | |
|---|---|---|---|---|---|
| A01 | 13 | 216 | 10 | 3 | 206 |
| A02 | 8 | 34 | 5 | 3 | 29 |
| A03 | 15 | 200 | 8 | 7 | 192 |
| A04 | 3 | 7 | 0 | 3 | 7 |
| A05 | 21 | 43 | 8 | 13 | 35 |
| A06 | 88 | 99 | 7 | 81 | 92 |
| A07 | 1 | 0 | 0 | 1 | 0 |
| A08 | 13 | 10 | 0 | 13 | 10 |
| A09 | 22 | 329 | 11 | 11 | 318 |
| A10 | 3 | 3 | 0 | 3 | 3 |
| C01 | 17 | 27 | 11 | 6 | 16 |
| C02 | 8 | 9 | 5 | 3 | 4 |
| C03 | 23 | 36 | 8 | 15 | 28 |
| C04 | 44 | 43 | 16 | 28 | 27 |
| C05 | 7 | 6 | 3 | 4 | 3 |
| C06 | 11 | 30 | 6 | 5 | 24 |
| C07 | 9 | 11 | 6 | 3 | 5 |
| C08 | 8 | 53 | 1 | 7 | 52 |
| C09 | 18 | 14 | 10 | 8 | 4 |
| A genome | 187 | 941 | 49 | 138 | 892 |
| C genome | 145 | 229 | 66 | 79 | 163 |
References
- Fu, C.; Zhang, K.; Li, P.; Zhang, W.; Xia, H.; Li, C.; Qiu, J.; Wang, X.; Zhao, C.; Li, A. Analysis of Genome Size and Genetic Diversity of Wild Resources of the Peanut Genus. Shandong Agric. Sci. 2022, 54, 7–13. [Google Scholar] [CrossRef]
- Pellicer, J.; Hidalgo, O.; Dodsworth, S.; Leitch, I.J. Genome size diversity and its impact on the evolution of land plants. Genes 2018, 9, 88. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Zheng, Z.; Li, Y.; Hu, H.; Wang, Z.; Du, X.; Zhang, S.; Zhu, M.; Dong, L.; Ren, G.; et al. Which factors contribute most to genome size variation within angiosperms. Ecol. Evol. 2021, 11, 2660–2668. [Google Scholar] [CrossRef] [Scilit]
- Li, X.Y.; Wang, X.Y. The Influence of Repetitive Sequences on the Evolution of Plant Genome Size. J. North China Univ. Sci. Technol. (Nat. Sci. Ed.) 2021, 43, 98–107. [Google Scholar] [CrossRef]
- Soltis, P.S.; Soltis, D.E. Ancient WGD events as drivers of key innovations in angiosperms. Curr. Opin. Plant Biol. 2016, 30, 159–165. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Wu, S.; Chang, X.; Wang, X.; Zhao, Y.; Xia, Y.; Trigiano, R.N.; Jiao, Y.; Chen, F. The ancient wave of polyploidization events in flowering plants and their facilitated adaptation to environmental stress. Plant Cell Environ. 2020, 43, 2847–2856. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van, D.P.Y.; Eshchar, M.; Kathleen, M. The evolutionary significance of polyploidy. Nat. Rev. Genet. 2017, 18, 411–424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliver, K.R.; McComb, J.A.; Greene, W.K. Transposable elements: Powerful contributors to angiosperm evolution and diversity. Genome Biol. Evol. 2013, 5, 1886–1901. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Z.D. A Preliminary Study on the Effects of Different Genome Sizes on Heterosis in Brassica napus. Master’s Thesis, Sichuan Agricultural University, Yaan, China, 2019. [Google Scholar] [CrossRef]
- Shull, G.H. The composition of a field of maize. J. Hered. 1908, os-4, 296–301. [Google Scholar] [CrossRef] [Scilit]
- Hashimoto, S.; Wake, T.; Nakamura, H.; Minamiyama, M.; Araki-Nakamura, S.; Ohmae-Shinohara, K.; Koketsu, E.; Okamura, S.; Miura, K.; Kawaguchi, H.; et al. The dominance model for heterosis explains culm length genetics in a hybrid sorghum variety. Sci. Rep. 2021, 11, 4532. [Google Scholar] [CrossRef] [Scilit]
- Knoch, D.; Werner, C.R.; Meyer, R.C.; Riewe, D.; Abbadi, A.; Lücke, S.; Snowdon, R.J.; Altmann, T. Multi-omics-based prediction of hybrid performance in canola. Theor. Appl. Genet. 2021, 134, 1147–1165. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Zhu, A.; Song, Q.; Chen, H.Y.; Harmon, F.G.; Chen, Z.J. Temporal regulation of the metabolome and proteome in photosynthetic and photorespiratory pathways contributes to maize heterosis. Plant Cell 2020, 32, 3706–3722. [Google Scholar] [CrossRef] [Scilit]
- Shao, L.; Xing, F.; Xu, C.; Zhang, Q.; Che, J.; Wang, X.; Song, J.; Li, X.; Xiao, J.; Chen, L.L.; et al. Patterns of genome-wide allele-specific expression in hybrid rice and the implications on the genetic basis of heterosis. Proc. Natl. Acad. Sci. USA 2019, 116, 5653–5658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, T.D.; Yang, G.S.; Ma, C.Z.; Tu, J.X. The History, Current Situation and Prospect of Research on the Utilization of Heterosis in Rapeseed. In Proceedings of the Academic Annual Conference of “Science and Technology Facing the New Century”; 1998; pp. 756–762. Available online: https://kns.cnki.net/kcms2/article/abstract?v=ZH6vWTMDPUKMSwWUk-E1XVzErXiw9Wm6mR3c28mAxKW_18iVN3Bdd47ZVDNGqVuvxXzCYQ4CqGWs_aCUi-RqUPFyVYjy0C5aTSQnp_kuN9LNB8QMdU-h33eeUswSTic0_4ahjyFQ6Pkc-uVii2paevvfyFSa7H8_Uynab43hgZ4=&uniplatform=NZKPT (accessed on 25 September 2025).
- Fu, D.; Xiao, M.; Hayward, A.; Jiang, G.; Zhu, L.; Zhou, Q.; Li, J.; Zhang, M. What is crop heterosis: New insights into an old topic. J. Appl. Genet. 2015, 56, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, S.Q.; Han, X.S.; Hu, K.N. Research Progress on the Genetic Basis of Heterosis in plants. Mol. Plant Breed. 2017, 15, 4734–4740. [Google Scholar] [CrossRef]
- Rayburn, A.L.; Biradar, D.P.; Bullock, D.G.; McMurphy, L.M. Nuclear DNA content in F1 hybrids of maize. Heredity 1993, 70, 294–300. [Google Scholar] [CrossRef] [Scilit]
- Pellicer, J.; Leitch, I.J. The Plant DNA C-values database (release 7.1): An updated online repository of plant genome size data for comparative studies. New Phytol. 2020, 226, 301–305. [Google Scholar] [CrossRef] [Scilit]
- Fu, S.; Yin, L.; Xu, M.; Li, Y.; Wang, M.; Yang, J.; Fu, T.; Wang, J.; Shen, J.; Ali, A.; et al. Maternal doubled haploid production in interploidy hybridization between Brassica napus and Brassica allooctaploids. Planta 2018, 247, 113–125. [Google Scholar] [CrossRef] [Scilit]
- Zhao, S.; Huang, L.; Zhang, Q.; Zhou, Y.; Yang, M.; Shi, H.; Li, Y.; Yang, J.; Li, C.; Ge, X.; et al. Paternal chromosome elimination of inducer triggers induction of double haploids in Brassica napus. Front. Plant Sci. 2023, 14, 1256338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, W.; Shi, H.; Zhou, Y.; Liang, X.; Luo, X.; Xiao, C.; Li, Y.; Xu, P.; Wang, J.; Gong, W.; et al. Rapid and synchronous breeding of cytoplasmic male sterile and maintainer line through mitochondrial DNA rearrangement using doubled haploid inducer in Brassica napus. Front. Plant Sci. 2022, 13, 871006. [Google Scholar] [CrossRef] [Scilit]
- Coe, E.H. A Line of Maize with High Haploid Frequency. Am. Nat. 1959, 93, 381–382. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.; Zhong, Y.; Qi, X.; Chen, M.; Liu, Z.; Chen, C.; Tian, X.; Li, J.; Jiao, Y.; Wang, D.; et al. Extension of the in vivo haploid induction system from diploid maize to hexaploid wheat. Plant Biotechnol. J. 2020, 18, 316–318. [Google Scholar] [CrossRef] [Scilit]
- Zhong, Y.; Chen, B.; Li, M.; Wang, D.; Jiao, Y.; Qi, X.; Wang, M.; Liu, Z.; Chen, C.; Wang, Y.; et al. A DMP-triggered in vivo maternal haploid induction system in the dicotyledonous Arabidopsis. Nat. Plants 2020, 6, 466–472. [Google Scholar] [CrossRef] [Scilit]
- Zhong, Y.; Chen, B.; Wang, D.; Zhu, X.; Li, M.; Zhang, J.; Chen, M.; Wang, M.; Riksen, T.; Liu, J.; et al. In vivo maternal haploid induction in tomato. Plant Biotechnol. J. 2021, 20, 250–252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Zhang, L.; Zhang, J.; Jia, M.; Cao, L.; Yu, J.; Zhao, D. Haploid induction in allotetraploid tobacco using DMPs mutation. Planta 2022, 255, 98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, S.; Zhang, J.; Zhao, H.; Zong, M.; Li, M.; Gong, G.; Wang, J.; Zhang, J.; Ren, Y.; Zhang, H.; et al. Production of double haploid watermelon via maternal haploid induction. Plant Biotechnol. J. 2023, 21, 1308–1310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomas, C.A. The Genetic Organization of Chromosomes. Annu. Rev. Genet. 1971, 5, 237–256. [Google Scholar] [CrossRef] [Scilit]
- Guo, S.L.; Zhou, P.; Yin, L.P.; Lou, Y.X. Variations of plant DNA C-value between species and within species and their biological significance. J. Shanghai Norm. Univ. 2011, 40, 102–110. [Google Scholar] [CrossRef]
- Walker, D.J.; Monino, I.; Correal, E. Genome size in Bituminaria bituminosa (L.) C.H. Stirton (Fabaceae) populations: Separation of “true” differences from environmental effects on DNA determination. Environ. Exp. Bot. 2006, 55, 258–265. [Google Scholar] [CrossRef] [Scilit]
- Smarda, P.; Bures, P.; Horová, L. Random distribution pattern and non-adaptivity of genome size in a highly variable population of Festuca pallens. Ann. Bot. 2007, 100, 141–150. [Google Scholar] [CrossRef] [Scilit]
- Xu, S.; Chen, R.; Zhang, X.; Wu, Y.; Yang, L.; Sun, Z.; Zhu, Z.; Song, A.; Wu, Z.; Li, T.; et al. The evolutionary tale of lilies: Giant genomes derived from transposon insertions and polyploidization. Innovation 2024, 5, 100726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mascagni, F.; Vangelisti, A.; Usai, G.; Giordani, T.; Cavallini, A.; Natali, L. A computational genome-wide analysis of long terminal repeats retrotransposon expression in sunflower roots (Helianthus annuus L.). Genetica 2020, 148, 3–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sang, S.F.; Wang, H.; Mei, D.S.; Liu, J.; Fu, L.; Wang, J.; Wang, W.X.; Hu, Q. Correlation Analysis Between Heterosis and Genetic Distance Evaluated by Genome-Wide SNP Chip in Brassica napus. Sci. Agric. Sin. 2015, 48, 2469–2478. [Google Scholar] [CrossRef]
- Sun, C.M.; Chen, F.; Chen, S.; Peng, Q.; Zhang, W.; Yi, B.; Zhang, J.F.; Fu, T.D. Genome-wide association study of seed number per silique in rapeseed (Brassica napus L.). Acta Agron. Sin. 2020, 46, 147–153. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Wu, Y.; Cui, X.; Zhang, X.; Xie, M.; Liu, L.; Liu, Y.; Huang, J.; Cheng, X.; Liu, S. Genome-wide characterization of ovate family protein gene family associated with number of seeds per silique in Brassica napus. Front. Plant Sci. 2022, 13, 962592. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.B.; Huang, Y.M.; Liang, C.Y.; Wang, J.; Zhao, Q.Y. Construction of fingerprint Atlas of Brassica napus based on genome-wide SNP. Chin. J. Oil Crops 2022, 44, 966–972. [Google Scholar] [CrossRef]






| RY18 | Induce Offspring (Mean) | YF1 (Mean) | YF2 (Mean) | |
|---|---|---|---|---|
| 0068A | 0.346 | 0.257 | 0.264 | 0.235 |
| C2970 | 0.336 | 0.254 | 0.273 | 0.227 |
| Y3380 | 0.537 | 0.455 | 0.466 | 0.435 |
| RY18 | 0.000 | 0.201 | 0.174 | 0.250 |
| Sample Size | Average | Standard Deviation | p | |
|---|---|---|---|---|
| Induce offspring | 51 | 947.53 | 54.89 | 0.092 |
| RY18-F2 | 96 | 1000.20 | 81.57 | 0.200 |
| RY18-F3 | 67 | 998.14 | 59.14 | 0.200 |
| RY18 | Hybrid F1 | F1 Male Parent | |
|---|---|---|---|
| RY18 | 0 | 0.1685 | 0.2304 |
| 0068A (common female parent) | 0.2663 | 0.1601 | 0.2715 |
| C2970 (RY18 male parent) | 0.2812 | 0.3879 | 0.2839 |
| F1 male parent | 0.2304 | 0.2119 | 0 |
| The Genetic Distance Between Parents | Genetic Distance Between Offspring and the Female Parent | Genetic Distance Between Offspring and the Male Parent | |
|---|---|---|---|
| The size of the offspring genome | −0.461 | 0.588 | 0.074 |
| The size of the male parent | −0.014 | 0.076 | 0.790 * |
| An increase in the size of the genome compared to the male parent’s | −0.475 | 0.517 | −0.621 |
| The Size of the Offspring Genome | The Size of the Male Parent | An Increase in the Size of the Genome Compared to the Male Parent’s | Genetic Distance Between Parents | |
|---|---|---|---|---|
| Plant height/cm | 0.041 | 0.105 | −0.033 | 0.148 |
| Rootstock diameter/cm | 0.063 | 0.025 | 0.019 | 0.346 * |
| Branch height/cm | −0.033 | −0.042 | −0.001 | 0.210 |
| Fruiting length of main branch/cm | 0.152 | 0.031 | 0.106 | 0.092 |
| Number of primary effective branch/n | 0.05 | 0.012 | 0.033 | −0.021 |
| Number of effective siliques on the entire plant/n | 0.175 | −0.014 | 0.147 | 0.108 |
| Number of effective siliques on the main axis/n | 0.195 | 0.002 | 0.159 | 0.149 |
| Number of kernels/g | 0.062 | −0.077 | 0.094 | −0.097 |
| Thousand-seed weight/g | 0.108 | −0.310 * | 0.300 * | −0.325 * |
| Theoretical yield per plant/g | 0.198 | −0.074 | 0.207 | 0.033 |
| Actual yield of the plant/g | 0.247 | −0.166 | 0.326 * | −0.147 |
| Oil content/% | 0.049 | −0.099 | 0.106 | −0.087 |
| Glucosinolate/% | 0.021 | −0.108 | 0.091 | −0.239 |
| Acid/% | 0.193 | 0.072 | 0.118 | −0.260 |
| Protein/% | −0.099 | −0.098 | −0.013 | −0.034 |
| Primer Name | Primer Sequence (5’-3’) | Notes |
|---|---|---|
| OPSNP7-F | TATATGGGCTGTGCAACGACAAG | Pol restoring gene Rf primer |
| OPSNP7-R | GAGAGAGAGGCTACAGAACAAACT | |
| Actin-F | TGCTCTTCCTCACGCTATCCTC | actin |
| Actin-R | GCTCGTAGTTCTTCTCCACCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, R.; Yang, M.; Shi, H.; Li, Y.; Yang, J.; Gong, W.; Zou, Q.; Tao, L.; Wu, Q.; Yu, Q.; et al. Genome Size Variation Is Associated with Hybrid Vigor in Near-Isogenic Backgrounds in Brassica napus. Plants 2025, 14, 3013. https://doi.org/10.3390/plants14193013
Wang R, Yang M, Shi H, Li Y, Yang J, Gong W, Zou Q, Tao L, Wu Q, Yu Q, et al. Genome Size Variation Is Associated with Hybrid Vigor in Near-Isogenic Backgrounds in Brassica napus. Plants. 2025; 14(19):3013. https://doi.org/10.3390/plants14193013
Chicago/Turabian StyleWang, Rui, Meicui Yang, Haoran Shi, Yun Li, Jin Yang, Wanzhuo Gong, Qiong Zou, Lanrong Tao, Qiaobo Wu, Qin Yu, and et al. 2025. "Genome Size Variation Is Associated with Hybrid Vigor in Near-Isogenic Backgrounds in Brassica napus" Plants 14, no. 19: 3013. https://doi.org/10.3390/plants14193013
APA StyleWang, R., Yang, M., Shi, H., Li, Y., Yang, J., Gong, W., Zou, Q., Tao, L., Wu, Q., Yu, Q., Liu, H., & Fu, S. (2025). Genome Size Variation Is Associated with Hybrid Vigor in Near-Isogenic Backgrounds in Brassica napus. Plants, 14(19), 3013. https://doi.org/10.3390/plants14193013

