Next Article in Journal
Metabolomic and Transcriptomic Analyses Provide Insights into Metabolic Networks During Kiyomi Tangors Development and Ripening
Previous Article in Journal
Multifunctional Roles of Medicinal Plants in the Meat Industry: Antioxidant, Antimicrobial, and Color Preservation Perspectives
Previous Article in Special Issue
Metabolomic Analysis Uncovers the Presence of Pimarenyl Cation-Derived Diterpenes as Insecticidal Constituents of Sphagneticola trilobata
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 14
Issue 17
10.3390/plants14172750
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Multi-Transcripts and Expressions of Trypsin Inhibitor and α-Amylase Inhibitor Genes of Sengon (Falcataria falcata) Against Xystrocera festiva Stem Borer Infestation

by
Ulfah Juniarti Siregar
1,
Hasyyati Shabrina
2,*,
Esti Nurianti
1,
Fahirah Dwiyuni
1,
Ayu Indah Lestari
1,
Januard Kristian Sihombing
1,
Buma Larosa
1,
Vilda Puji Dini Anita
3 and
Deden Derajat Matra
4
1
Department of Silviculture, Faculty of Forestry and Environment, IPB University, Bogor 16680, West Java, Indonesia
2
Forestry Program, Faculty of Agriculture University of Mataram, Jalan Pendidikan No 37, Mataram City 83125, West Nusa Tenggara, Indonesia
3
Department of Forestry Engineering, Faculty of Industrial Technology, Institut Teknologi Sumatera, Bandar Lampung 35365, Lampung, Indonesia
4
Department of Agronomy and Horticulture, Faculty of Agriculture, IPB University, Bogor 16680, West Java, Indonesia
*
Author to whom correspondence should be addressed.
Plants 2025, 14(17), 2750; https://doi.org/10.3390/plants14172750
Submission received: 30 June 2025 / Revised: 11 August 2025 / Accepted: 31 August 2025 / Published: 3 September 2025
(This article belongs to the Special Issue Sustainable Strategies for Managing Plant Diseases)
Browse Figures
Versions Notes

Abstract

The infestation of boktor (Xystrocera festiva Pascoe) stem borer in Sengon (Falcataria falcata) tree plantations in Indonesia, especially in Java, has caused severe losses by damaging the stems, decreasing wood quality, and potentially leading to mortality. To digest the woods, the X. festiva larvae’s gut has at least two digestive enzymes, which are trypsin and α-amylase. Former studies have shown that F. falcata produces inhibitors of these two enzymes as part of its defense mechanisms. This research aimed to analyze trypsin inhibitor (TI) and α-amylase inhibitor (AAI) transcripts, as well as their expression, in X. festiva-infested and resistant F. falcata trees. We found 19 contigs encoding the TI gene and 29 contigs encoding AAI. The results were able to predict the sequence of the DNA that produced the TI and AAI transcriptomes, which proved that one gene could be expressed differently due to alternative splicing. The DEG analysis and RT-PCR confirmed that mostly the TI and AAI activity was heavily induced by the X. festiva larvae attacks. The expression of the TI gene was upregulated 0.78 times, while the AAI gene expression was upregulated 2.44 times in infested samples. The findings from this study are fundamental in understanding the mechanism of F. falcata resistance against X. festiva infestation and selecting the resistant trees.

1. Introduction

Falcataria falcata, commonly known as albizia, Jeungjing (Sundanese), Batai (Malaysian), Bae (Papuan), or Sengon (Indonesian), is a tree species native to Haiti, Papua New Guinea, the Solomon Islands, and Indonesia [1]. It is valued for its fast growth characteristics and fast economic return in Indonesia [2], especially on Java Island. It is the most common crop commodity planted in community forests in Java, which produces 97.16% of total F. falcata production in Indonesia [3]. The F. falcata wood industry itself is growing rapidly and has started to enter the international market.
With the rapid growth of the industry and plantation size, especially in monoculture form, the threat to the plantation itself has also increased. There is one major pest of F. falcata, the boktor stem borer (Xystrocera festiva), which starts infestation when the plant reaches 3 years old [4]. The damage is caused mainly by the larval stage of the insect. The insect infestation begins when the eggs are laid in bark crevices or wounds on the tree. The hitched larvae then create feeding tunnels or burrowing holes that run downwards and become larger as the larvae’ size increases as well [5]. The feeding tunnels decrease the quality and quantity of timber, damaging the stems, and leading to plant mortality [6]. The infestation itself is controlled mainly by eradicating the infested tree, but the spread of X. festiva infestation still happens widely and is deadly.
X. festiva belongs to the family Cerambycidae in the Coleoptera order, in which the larvae are major wood borers in forest areas [7]. The larvae mainly feed on the starch of the wood [8], and also need protein for survival, growth, and fecundity [9]. To digest those two main nutrients, the larvae’s guts have enzymes to break down the complex molecules into smaller ones. One of the important enzymes to digest carbs in the X. festiva digestive system is α-amylase, which acts in the first step of breaking starch down in the form of maltopolysaccharides [10] into oligosaccharides [11]. Meanwhile, to digest the proteins, the larvae secrete serine protease enzymes, including the major enzyme trypsin. Trypsin is involved in the initial phase of protein digestion by cleaving the bonds of the polypeptide on the carboxyl side of basic L-amino acids, lysine, or arginine [12].
To suppress the X. festiva larvae’s feeding ability, F. falcata trees secrete inhibitors of those digestive enzymes [13], which interfere with the digestion of plant starch and proteins. Amylases play a role in softening the cellulose in the wood so it will be easier to digest [14], while trypsin breaks the protein chain on the carboxyl side of basic L-amino acids [15]. Two known inhibitors produced by the F. falcata tree were trypsin inhibitor (TI) and α-amylase inhibitor (AAI), which inhibit trypsin and α-amylase secreted by herbivores to digest proteins, starches, and glycogens in plants [9,16]. A former study stated that TI and AAI activity had negative correlations with the larvae’s weight, length, and feed consumption in an artificial diet [13]. Other studies in the standing F. falcata trees showed that TI and AAI activities were higher in resistant trees’ woods and barks [17,18]. Studies of TI and AAI in other plants have also shown that those two inhibitors play a significant role in plant protection against herbivores [19,20,21,22].
The current advancement in technologies has enabled us to analyze the expression of genes encoding those two enzymes in the transcriptomes produced from the infested and resistant trees. Large-scale genotyping, genomic sequencing, and gene analysis have enabled us to have a better and more comprehensive understanding of plant–herbivore interactions and identify the key resistance components that may be integrated in future tree improvement. Ribonuclease acid–sequencing (RNA-seq) is now recognized as the most powerful, robust, and adaptable technique for measuring gene expression and transcriptional activation at the genome-wide level. Other research has shown that various resistance genes, including AAIs, were expressed in pigeon pea against the pod-borer using RNA-Seq analysis [23]. Another study found various peptidase inhibitors in the banana transcriptome against the pseudostem weevil [24]. This research objective was to analyze the difference in the RNA-seq from X. festiva-infested and resistant F. falcata trees at the transcriptome level and identify the TI and AAI gene expression. Findings from this research will be significant in developing markers for selecting the resistant F. falcata trees.

2. Results

2.1. Contigs Exploration and Phylogenetic Analysis

The assembled sequences of the samples and the properties are available at https://doi.org/10.6084/m9.figshare.14058458 [25]. The annotated contigs were blasted with reference sequences and resulted in 19 contigs of TI and 29 contigs of AAI found in all the transcriptomes (Table 1). The AAI-containing contigs of F. falcata length were 201–728 base pairs (bp); meanwhile, the TI-containing contigs length range was 125–764 bp. The TI contigs BLAST v.2.14.1 results showed that all the contigs were homologous with Kunitz-type trypsin inhibitor from various members of the Fabaceae family. The alignment of TI- and AAI-containing contigs is shown in Figure 1. We used the TI sequence from Glycine max and the AAI sequence from Phaseolus vulgaris as a comparison, since they belonged to the same family. The aligned contigs from F. falcata had identical length and gaps with the TI sequence from G. max, and AAI from P. vulgaris. The consensus length for TI alignment was 927 bp, and for AAI was 1061 bp. A consensus is built from the most common residues at each position (alignment column) such that the total percentage of rows represented by the selected residues in that column meets at least the specified threshold. The alignment of the contigs in Figure 1 showed that there were sites that aligned with reference sequences from G. max and P. vulgaris. Similar lengths and gaps indicated that there was high similarity between all aligned contigs.
The alignment of TI- and AAI-containing contigs is shown in Figure 1. We used the TI sequence from G. max and the AAI sequence from P. vulgaris as a comparison. It can be seen that there is an identical length and gaps between aligned contigs. Deep gaps in alignment indicate change mutations in sequences, including insertion, deletion, or rearrangement of nucleotides.
The phylogenetic trees from TI and AAI showed that there were no clustered contigs. All of the contigs were clustered into one big group against the outgroup sequence. The importance of the outgroup in generating a phylogenetic tree was to create character polarization. The outgroup for TI was chosen because in a former study, there was a 24 kilodalton (kDa) protein from F. falcata’s bark and wood, which was identical to TI from G. max. Meanwhile, AAI from P. vulgaris was chosen as the outgroup because it also belonged to the lectin group of AAI. All of the TI-containing contigs from our study were from Kunitz-type TI. There were two major groups formed in the TI phylogenetic tree, which were on the same line (not branched) as the outgroup one. In Group II, there was further branching so that the members were not in the same branch as the outgroup. Group 1, which is in the same line, has a closer kinship with the outgroup (AF128268.1) and had a genetic distance of 1.329. Overall, Group II, whose members were more diverse and were not in the same branch as the outgroup sequence, had a genetic distance value of 1.322. The value of genetic distance in Group II’s F. falcata contigs did not differ much from Group I’s contigs due to the branching between the two groups, with the outgroup starting at the same beginning. The difference between the two groups was due to the location and length of the nucleotide base sequences in the different conserved domains.
Phylogenetic analysis in AAI contigs showed the presence of four groups that belonged to the lectin class. Group differences were due to differences in splicing sites for both exons and introns. Group I consisted of two contigs that were identified as AAI1 and AAI2, which inhibit lectins and alpha-amylase and act as a defense protein against insects. Group II consisted of four contigs that were identified as AAI and AAI1. Group III consisted of 11 contigs, and Group IV consisted of 12 contigs. Groups III and IV were identified as AAI, AAI1, and CLAI (a legumin-amylase inhibitor from Cicer arietinum). Phylogenetic analysis results showed that Groups III and IV evolved faster than Groups I and II because of the higher number of divergences. Phylogenetic analysis showed that Groups III and IV had a higher number of branches than Groups I and II, and a lower identical site value of 2% and 3.4%. The phylogenetic trees of TI and AAI are shown in Figure 2. Meanwhile, it was suggested that AAI2 evolved from AAI1 because of the high homology between both contigs. This hypothesis concurred with the results of phylogenetic analysis, with AAI1 and AAI2 contigs in this study belonging to the same group with 95.3% identical site values.

2.2. Comparison of Transcriptomes and Genome Draft

Genome sequencing produced 72.6 GB of raw data, which was deposited at DDBJ with accession number DRA012508 (https://ddbj.nig.ac.jp/search/entry/sra-submission/DRA012508, accessed on 31 July 2021). The assembling of the genome using Ray software v.3 produced 1,074,927 sequences, with an N50 value of 710 bp and a maximum length of 133,812 bp. The annotation process resulted in 70.09% of the sequences matching with proteins from the NR NCBI, and 11.05% matched with proteins from UniProt. We found two candidates of genome sequences that contained AAI and 18 sequences that contained TI genes. The genome sequences aligned with the transcriptomes and resulted in the predicted genome sequence that transcribes the AAI and TI genes. The spliced alignments of AAI and TI are shown in Figure 3A,B.
Based on the results from the spliced alignment of AAI and TI, we predicted that the AAI genes were produced by scaffold-229707, while for TI genes, we found two candidates, which were scaffold-152348 and scaffold-215344.

2.3. Differentially Expressed Gene Analysis and Real Time-Polymerase Chain Reaction

The assembled contigs showed that from the total of 10,566 contigs, 6859 were expressed in an upregulated way, and 3707 were expressed in a downregulated way (Figure 4).
The DEG analysis between resistant and infested samples showed that mostly TI and AAI in F. falcata were expressed in a downregulated manner in susceptible trees. The logFC of TI ranged from −11.472 to 4.027, and AAI logFC ranged from −10.752 to 2.016 (Figure 4). The DEG results showed that the genes were expressed variously, with 9.52% of the TI expressed in an upregulated way, 71.43% expressed in a downregulated way, and 19.05% expressed in an insignificant way. For AAI, the DEG showed that the isoforms of the gene were also expressed in both an upregulated (3.45%) and downregulated (31.02%) way, while 65.52% was expressed in an insignificant way (LogFC < 2). The DEG analysis results for TI and AAI genes found in the transcriptome are shown in Table 2 and Figure 5. These findings indicated that somehow the TI and AAI expression increased in the stem after the larval infestation. The results were then confirmed using RT-PCR.
From all the transcriptomes, the number of primers that were available for primer designing was seven for TI and seven for AAI. Out of 14 pairs of primers generated, only one pair from each TI and AAI produced specific results and had an appropriate melt curve with a single peak. The primers that were able to produce a specific band in this study are listed in Table 3. The desired single peak in the melting curve showed that our amplified product was specific, and the PCR process produced single-band results. The RT-PCR products were also electrophoresed in 2% agarose to ensure the size of the PCR products. The electrophoresis results are shown in Figure 6.
The RT-PCR data showed that the expression of the TI gene was already high (average 0.860) and increased after the infestation (average 1.790). On the other hand, AAI expressions were considered low (average 1.262) and highly increased after infestation (average 6.899). These findings indicate that both genes were already present as F. falcata defenses against X. festiva larvae, but the expression of both genes increased due to the induction of larval trypsin and α-amylase infestation. These results were in accord with the DEG analysis results from RNA-Seq. The results showed that in the infested samples, expression of the TI gene was upregulated 0.78 times compared to the resistant ones, while for the AAI gene, the expression was upregulated 2.44 times in infested samples. The expression difference of AAI was significant with a p-value of 0.04 but considered insignificant in the TI gene with a p-value of 0.45. The complete results of the RT-PCR are shown in Figure 7 below.

3. Discussion

The results from our study showed that there were several isoforms of TI and AAI as a result of different assembly of the transcriptomes from RNA-Seq using NGS technology. Most eukaryotic genes have multiple isoforms. Isoforms of mature RNA (mRNA) derived from the same locus are molecules with different exon compositions and lengths and can encode different forms of the corresponding genes [26]. The isoforms happened because all the protein-coding genes were separated by introns that have to be removed through splicing in mRNA maturation [27]. Splicing is carried out by spliceosomes, large ribonucleoprotein (RNP) complexes found in eukaryotes that assemble around splice sites in introns of pre-mRNA molecules and catalytically remove introns through successive reactions of phosphodiester transfer [28]. There were a large number of proteins that act as splicing regulators, which recognized distinct sequences in RNA as ‘splicing code’ [29]. When the mRNA sequences were constitutively spliced, the exons were joined in an order that corresponds to the DNA following the removal of the introns. When the mRNA sequences were constitutively spliced, the exons were joined in an order that corresponds to the DNA following the removal of the introns.
Many identical copies of RNA can be made from the same DNA template, and each RNA molecule can direct the synthesis of many identical protein molecules, allowing cells to rapidly synthesize large amounts of protein on demand [30]. In this study, we used a splice alignment method, which aligned the predicted transcriptomes to the predicted genome sequences [31]. The alignment of transcriptomes and genome draft from our study showed that the AAI and TI genes most probably originated from a single copy of DNA [30]. Alternative splicing deviates from this process through mechanisms that rearrange exon patterns into different coding sequences that are translated into different proteins [32]. Alternative splicing is a post-transcriptional level of gene expression regulation that increases the diversity of transcriptome and proteome. Alternative splicing happened because of the occurrence of alternate-splice sites in the premature RN [33]. The alternative splicing-related RNA-binding proteins (RBPs), under some conditions, could lead to different splicing events [34]. The isoforms were formed by assembling the spliced reads and mapping them to the reference transcriptome, then clustered and filtered to obtain high-quality contigs [35]. De novo assembly is the sole method available to reconstruct transcriptional isoforms from short-read methods in organisms for which there was not a high-quality reference genome, yet full-length transcriptome isoform reconstruction was difficult to perform with existing de novo transcriptome assembly techniques [36]. The de novo transcriptome assembly presents considerable difficulty due to the high sequence similarity among sub-genomes, duplicated genes, and isoforms [37].
The TI contigs BLAST results showed that all the contigs were homologous with Kunitz-type trypsin inhibitor from various members of the Fabaceae family. In the Kunitz-type family, TI was effective in suppressing the digestion process in various agricultural insects [38]. TI activity in Fabaceae not only inhibits trypsin or chymotrypsin but is sometimes capable of blocking other serine proteases such as subtilisin [39]. The F. falcata tree has several insect pests, with X. festiva as its main pest. TIs were associated with plants’ resistance against insect pests by inhibiting proteases of the digestive tract, impeding the pests’ development and reproduction [40]. TIs reacted irreversibly with trypsin secreted by the insect gut to form inert-irreversible complexes that inhibit nutrient uptake by the insect and signal the insect to feed less [41]. In another study, overexpression of TI showed antifungal activity, thus not only protecting plants from herbivore insects but also against plant pathogens [42]. In the Fabaceae family, this inhibitor was effective in suppressing metabolic processes in the digestion of agricultural insect pests and was considered more environmentally friendly and more sustainable [38]. There were no Bowman–Birk inhibitor (BBI) type of TI present in the F. falcata sequence data in our study, presumably due to the absence of the BBI-type TI gene, or the non-expression of the BBI-type TI gene. The lack of expression of this gene can be caused by several things, one of which is gene silencing. Silencing at the transcriptional stage was identified by the absence of a transcript of the gene [43].
BLAST results in our study showed that there were similarities in the sequence of AAI in F. falcata with AAI chain B (AAI), AAI1, and AAI2 which belong to the lectin class, and CLAI which belongs to the legumin class plant lectin-like amylase inhibitors, AAI1 and AAI2, which mainly exert different inhibitory properties against different types of amylase, while AAI1 has been shown to inhibit mammalian and two insect amylases and AAI2 can only inhibit one insect amylases [44]. Meanwhile, legumin activity against α-amylase was first detected in chickpeas that were able to inhibit α-amylase activity from plants and mammals but were unable to inhibit α-amylase activity from fungi and bacteria [45]. AAI1’s effect on insect larvae was by causing larvae death in the first or second instar; meanwhile, AAI2 resulted in delayed maturation of the larvae [46]. The insect digests starch by secreting α-amylase, which hydrolyzes starch and other related polysaccharides by randomly cleaving internal α-1,4-glucosidic linkages [20]. The inhibitory activity of the AAI against α-amylases was created because of the structure of the inhibitor, which resembled the substrates for α-amylase and therefore binds to the catalytic site of the amylase enzyme [47].
The isoforms found in this study were differentially expressed, with the downregulated isoforms having higher abundance than the upregulated ones. Those various expressions indicated that in those genes, some isoforms acted independently during the larval wounding [48]. The expression of some genes increased due to the larvae’s wounding activity. Meanwhile, the downregulation of AAI in non-infested plants, described in another study in persimmon plants [49], probably happened due to the lower starch content. The results of our study showed that the non-infected F. falcata had a lower amount of AAI expressed. This finding is probably caused by the insect’s larval behavior that has evolved a sensory system for the detection of host cues about the nutritional content [50].
The expression produced by RT-PCR validated the DEG results from RNA-Seq analysis in our study. Both TI and AAI were mostly expressed in an upregulated way in X. festiva-infested samples. These findings indicated that the expression of TI and AAI in F. falcata was induced by the wounding process by X. festiva larvae. These findings were supported by a previous study in Poplar [51], in which the Kunitz-type TI was strongly induced by wounding and herbivore activity. Another study showed that the activity of NaKTI2 (Kunitz-type trypsin inhibitor from Nicotiana attenuata) was highly induced by oral secretions of the herbivore [52]. For AAI, it was also identified that the wounding caused by the larvae’ activities increased the level of amylase inhibitor in Cajanus cajan [53]. The induction in the host tree also reportedly had a significant impact on lowering the amount of larvae of Trichoplusia feeding on Brassica rapa [54].
The insignificant expression of TI, as confirmed by the t-test in this study, might be caused by the decreased response of the plants due to the prolonged time after initial infestation. Since the infested samples were collected by observing whether there were already burrowing holes and wood leftovers from larvae present, the initial time of the infestations was unknown. Prolonged time after initial infestation could lower the expression of TI, according to a former study in tobacco [55]. Another study [56] examined the results after induction by various herbivore attacks in black poplar, but the activity of the TI did not correlate with the severity of the damage caused by the herbivores. In another study, AAI was also increased by the induction of Lepidoptera larvae in amaranth, but was different from TI, which was also able to be induced by salt and water stress, although mechanical human-made wounding failed to induce both inhibitors [16]. The activity of isoforms of AAI was affected by pH, temperature, incubation time, and the presence of particular ions [57].

4. Materials and Methods

4.1. Trypsin Inhibitor and α-Amylase Inhibitor Sequences Alignment and Analysis

The transcriptome sequences from both susceptible and resistant samples were developed from one pair of supposedly resistant and susceptible mature trees grown in a private garden, Bogor, West Java, Indonesia. The resistant and susceptible trees were selected by observing the trees, of which the susceptible ones had one or more X. festiva burrowing holes (Figure 8), while the resistant ones had none of them. The presence of the holes indicated that the larvae had successfully overcome the tree’s defenses. The tree pairs were grown in the same plot and separated by a 5 m distance, eliminating possible different environmental factors affecting the larval infestation. The sample collection from susceptible trees considered the burrowing hole conditions, such as the presence of the larvae leftover, which indicates the hole was formed recently. The trees used as samples were planted at the same time, were of the same age, and started to become infested at 3 years old. Total RNA was extracted from the wood tissue close to the bark of the infested sample, which was collected as close as possible to the burrowing hole.
The RNA isolation was performed using Total RNA Mini Kit (Plant) (GeneAid, New Taipei City, Taiwan R.O.C.) with modification using 2 reactions for one sample extracted and adding 26% polyvinylpyrrolidone (PVP) in each tube. A total of 100 mg of wood was ground using mortar with liquid nitrogen and then incubated at 60 °C in the lysis buffer with added PVP and β-Mercaptoethanol. The samples were then centrifuged and filtered to remove the remaining cell debris. The filtered column was washed and then incubated in nuclease-free water for 2 min at room temperature for RNA elution.
The RNA was sequenced using BGI-Seq 500. The RNA-seq protocol consisted of sample preparation, sample QC, library construction, library QC, sequencing, sequencing QC, raw data production, and raw data QC. One of each type of sample was used in the Next-generation sequencing (NGS) process. The raw sequences were uploaded to the database with accession number DRA008389, and the assembled sample is available at https://doi.org/10.6084/m9.figshare.14058458.v1 [25]. The annotated sample was filtered to find the predictive TI and AAI sequences. The filtered contigs were then trimmed in accordance to their hits in Basic Local Alignment Search Tools (BLAST) results and then aligned using Geneious Prime v.2020.1.2 (https://www.geneious.com, accessed on 5 July 2021) using MUSCLE (Multiple Sequence Comparison by Log-Expectation) algorithm with 10 maximum iterations, kmer value 4_6, and clustering method Unweighted Pair Group Method using Arithmetic Mean (UPGMB). The phylogenetic tree was also generated using Geneious Prime v.2020.1.2 with the Neighbor-Joining method. In performing the alignment and tree construction, we used a sequence of TI from soybean (Glycine max) with accession number AF128268.1 and AAI from the common bean (Phaseolus vulgaris) with accession number U10348.1 from GenBank, which were also used as the outgroup for phylogenetic tree development. Those two species were selected because of their similarity with F. falcata.

4.2. Whole Genome Sequencing (WGS) Analysis

DNA for WGS analysis was extracted from the leaves of a non-infested tree. The sequencing process was conducted with Illumina NovaSeq 6000 by Novogene AIT, Helios, Singapore. The raw data was collected and then analyzed using FASTQC [58] to check the quality of the sequences and filter low-quality data. The filtered sequences were then assembled using Ray v.3 [59] software on the MASER [60] platform. The assembled genome draft was then analyzed using BUSCO v3.0.2 [61] to check the quality and completeness of the data using complete and single copy, complete and duplicated, fragmented, and missing BUSCO criteria. The assembled genome was annotated using annotation after assembling tools in MASER with databases from UniProt and NR NCBI to discover the functional genes in the genome. The sequences that contained the AAI and TI genes were extracted using Samtools v1.10 [62]. Drafts of genome sequences that contained TI and AAI aligned with the contigs of TI- and AAI-containing transcriptomes using Geneious Prime v.2020.1.2 to predict the DNA that transcribes the TI and AAI genes.

4.3. Differentially Expressed Gene (DEG) Analysis

The expression of genes was analyzed by counting the number of reads mapped into the assembled transcriptome using eXpress software v.1.5.1 [63] in counts per million (CPM) [64]. The differentially expressed genes were counted and then analyzed using the edgeR package in R statistical software v.4.2.3 [65]. The DEGs result was then merged with the results of functional annotation from the SwissProt database, with only the TI and AAI sequences. The criterion for determining DEG is a log-fold change (logFC) value of ≥2 and a p-value of <0.05. LogFC value ≥ 2 means that the logCPM expression of the gene was ≥2 times higher or lower in the resistant type.

4.4. Primer Design for Gene Expression Analysis Using Real Time-Polymerase Chain Reaction (RT-PCR)

The candidate sequences of TI and AAI were then used to generate primers for RT-PCR. Primer design was conducted using Primer3 software [66] with product size ranging between 80 and 150 base pairs (bp), Guanine and Cytosine (GC) content range 45–55%, primer length 17–25 base pairs, and melting temperature (Tm°) range 60–65 °C. We also generated an Actin encoding primer as the housekeeping gene in this study. The data produced more than one sequence for AAI and TI. Therefore, we developed several primers to test. The designed primers for TI and AAI are presented in Supplementary Table S1.
The samples used in the RT-PCR process were collected from the same community forest in Bogor, West Java, as the sampling for RNA-seq (−6.55007143, 106.5741218). The wood tissues were collected from 3 resistant and 3 infested F. falcata trees. The time after initial infestation in the infested trees was unknown. The paired trees (resistant and infested) were very closely planted at a distance of 3 m from each other. The wood tissue from the infested tree was collected from part of the stem around the larvae’s burrowing hole, while that from the resistant tree was from the healthy stem. The wood was then submerged in Invitrogen RNA-later Stabilization Solution (ThermoFisher, Waltham, MA, USA) until extracted. RNA extraction was performed using Total RNA Mini Kit (Plant) (GeneAid, New Taipei City, Taiwan R.O.C.) with modification using 2 reactions for one sample extracted and adding 26% polyvinylpyrrolidone in each tube. The quality and quantity of extracted RNA were checked with electrophoresis and Nanophotometer (Implen, Munich, Germany). The DNA was then converted to cDNA with ReverTra Ace™ qPCR RT Kit (Toyobo, Osaka, Japan) and stored until RT-PCR analysis.
The RT-PCR process was performed using Applied Biosystem StepOne™Plus System (Termofisher, Waltham, MA, USA). The RT-PCR reaction contained ~10 ng cDNA as template, 400 nM of each forward and reverse primer, and 5 µL SensiFAST™ SYBR® Hi-ROX One-Step mix (2×) (Bioline, London, UK). The RT-PCR process was started with activation of Ampli-Taq at 95 °C for 3 min, followed by 40 cycles of denaturation at 95 °C, annealing, and extension at 72 °C. The RT-PCR results were also electrophoresed in 2% agarose gel. RT-PCR was conducted with 3 biological replicates for each sample.
The relative expression of targeted genes was then analyzed using the quantification method relative to the comparison of Cycle threshold (Ct) values (2−ΔΔCT) [67]:
∆CtP = CtGT − CtHG;
∆CtK = CtGT − CtHG;
∆∆Ct = ∆CtP − ∆CtK
Expression = 2−∆∆Ct
Notes: CtGT: Ct value of targeted gene; CtHG: Ct value of Housekeeping gene; ∆CtP: Ct value of treated sample; ∆CtK: Ct value of control sample; ∆∆Ct: difference of Ct value between treated and control sample.
Statistical analysis was performed on the expression value of resistant and infested samples on both TI and AAI genes using paired T-test.

5. Conclusions

Isoforms of TI and AAI encoding genes found in this research indicated that there was various alternative splicing in those genes and indicated that the expression of the same gene at the same time could differ due to the different functions of each isoform. The isoforms of the TI and AAI genes are possibly formed by a single copy of DNA for each gene. RT-PCR results confirmed the majority of DEG analysis, which indicates that both inhibitors’ activity was heavily induced by the X. festiva wounding and gut enzyme. The expression in infested samples of AAI was significantly upregulated 2.44 times on average, while the TI gene insignificantly increased 0.78 times on average. Findings from this research could be the foundation for future studies on how to induce TI and AAI activity to strengthen F. falcata resistance against X. festiva infestation or other insect pests. The findings from this research are also important in developing markers for selecting X. festiva-resistant trees. Further study into the interaction between both inhibitor activity and other signaling-related genes also needs to be pursued.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants14172750/s1. Table S1. list of primers for TI and AAI genes of F. falcata.

Author Contributions

Conceptualization, U.J.S. and D.D.M.; methodology, D.D.M., E.N., F.D., B.L., J.K.S., A.I.L., V.P.D.A. and H.S.; software, B.L., J.K.S., A.I.L. and V.P.D.A.; validation, H.S. and V.P.D.A.; formal analysis, D.D.M., E.N., F.D., B.L., J.K.S., A.I.L., V.P.D.A. and H.S.; investigation, E.N., F.D., B.L., J.K.S., A.I.L. and V.P.D.A.; resources, U.J.S. and D.D.M.; data curation, H.S., U.J.S. and D.D.M.; writing—original draft preparation, E.N., F.D., B.L., J.K.S., A.I.L., V.P.D.A. and H.S.; writing—review and editing, H.S., D.D.M. and U.J.S.; visualization, H.S., B.L., A.I.L. and J.K.S.; supervision, U.J.S. and D.D.M.; project administration, U.J.S., H.S. and V.P.D.A.; funding acquisition, U.J.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by DIPA SEAMEO BIOTROP (Grant number 051.11/PSRP/SC/SPK-PNLT/III/2021). The publication was funded by the Post-Doctoral Research Program IPB University (Grant Number 19/IT3/SP/WCU/2023) and Research Collaboration Center for Sengon Improvement National Research and Innovation Agency (Grant number 05/PPK.KP/PKR.GEL.VII/II/2025 and 7959/IT3/PT.01.03/P/B/2025).

Data Availability Statement

The transcriptome data used in this research are available for access at https://doi.org/10.6084/m9.figshare.14058458.v1. Raw data of the Genome sequence available at DDBJ with accession number DRA012508 (https://ddbj.nig.ac.jp/search/entry/sra-submission/DRA012508, accessed on 31 July 2021).

Acknowledgments

We would like to thank Dewi Rahmawati, Aditya Nugroho, and Fitri Indriani for their assistance during sampling collection and laboratory work. This paper is dedicated to the late Deden D. Matra, who contributed greatly to the research and his input for this manuscript, who sadly passed away in October 2024.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Orwa, C.; Mutua, A.; Kindt, R.; Jamnadass, R.; Anthony, S. Albizia Cinensis. Agroforestree Database: A Tree Reference and Selection Guide, version 4.0. 2009. Available online: https://apps.worldagroforestry.org/treedb2/speciesprofile.php/Spid=618?Spid=1787 (accessed on 7 November 2020).
  2. Siregar, U.J.; Rachmi, A.; Massijaya, M.Y.; Ishibashi, N.; Ando, K. Economic analysis of sengon (Paraserianthes falcataria) community forest plantation, a fast growing species in East Java, Indonesia. For. Policy Econ. 2007, 9, 822–829. [Google Scholar] [CrossRef]
  3. Statistics Indonesia. Statistics of Forestry Production 2018; Statistics Indonesia: Jakarta, Indonesia, 2019. [Google Scholar]
  4. Husaeni, E.A. Xystrocera festiva thoms, (cerambycidae, coleoptera): Biology and Control in Sengon Plantation; IPB Press: Bogor, Indonesia, 2019. [Google Scholar]
  5. Husaeni, E.A.; Haneda, N.F. Infestation of Xystrocera festiva in Paraserianthes falcataria plantation in East Java, Indonesia. J. Trop. For. Sci. 2010, 22, 397–402. [Google Scholar]
  6. Supriatna, A.H.; Haneda, N.F.; Wahyudi, I. Population distribution, damage percentage, and damage level due to Boktor in Sengon: Effect of age, diameter, and tree height. J. Silvikultur Trop. 2017, 8, 79–87. [Google Scholar] [CrossRef]
  7. Karan, M.; Evans, D.S.; Reilly, D.; Schulte, K.; Wright, C.; Innes, D.; Holton, T.A.; Nikles, D.G.; Dickinson, G.R. Rapid microsatellite marker development for African mahogany (Khaya senegalensis, Meliaceae) using next-generation sequencing and assessment of its intra-specific genetic diversity. Mol. Ecol. Resour. 2012, 12, 344–353. [Google Scholar] [CrossRef]
  8. Haneda, N.F.; Ichtisinii, A.; Siregar, U.; Istikorini, Y.; Lestari, A. Chemical Component of Sengon Tree Digested Xystrocera festiva (Coleoptera: Cerambycidae) Larvae. In Proceedings of the 3rd KOBI Congress, International and National Conferences (KOBICINC 2020), Online, 24–25 November 2021; Volume 14, pp. 292–295. [Google Scholar] [CrossRef]
  9. Lazarević, J.; Janković-Tomanić, M. Dietary and phylogenetic correlates of digestive trypsin activity in insect pests. Entomol. Exp. Appl. 2015, 157, 123–151. [Google Scholar] [CrossRef]
  10. Da Lage, J.-L. The Amylases of Insects. Int. J. Insect Sci. 2018, 10, 117954331880478. [Google Scholar] [CrossRef]
  11. Zverlov, V.V.; Höll, W.; Schwarz, W.H. Enzymes for digestion of cellulose and other polysaccharides in the gut of longhorn beetle larvae, Rhagium inquisitor L. (Col., Cerambycidae). Int. Biodeterior. Biodegrad. 2003, 51, 175–179. [Google Scholar] [CrossRef]
  12. Lončar, N.; Vujčić, Z.; Božić, N.; Ivanović, J.; Nenadović, V. Purification and properties of trypsin-like enzyme from the midgut of Morimus funereus (coleoptera, cerambycidae) larvae. Arch. Insect Biochem. Physiol. 2010, 74, 232–246. [Google Scholar] [CrossRef]
  13. Siregar, U.J.; Haneda, N.F.; Flowrensia, L. Correlation of Enzyme Inhibitor Activity in Sengon with Boktor Larval Growth on Artificial Diet. J. Silvikultur Trop. 2011, 3, 101–109. [Google Scholar]
  14. Sakaguchi, H.; Suzuki, M.G. Drosophila melanogaster larvae control amylase secretion according to the hardness of food. Front. Physiol. 2013, 4, 200. [Google Scholar] [CrossRef]
  15. Azad, R.K.; Thakur, D.R. Trypsin and chymotrypsin activity in developmental stages of Acanthoscelides obtectus (SAY) and screening Phaseolus vulgaris cultivars for inhibitory effect on bovine pancreatic proteases. Indian J. Entomol. 2024. [Google Scholar] [CrossRef]
  16. Sánchez-Hernández, C.; Martínez-Gallardo, N.; Guerrero-Rangel, A.; Valdés-Rodríguez, S.; Délano-Frier, J. Trypsin and α-amylase inhibitors are differentially induced in leaves of amaranth (Amaranthus hypochondriacus) in response to biotic and abiotic stress. Physiol. Plant. 2004, 122, 254–264. [Google Scholar] [CrossRef]
  17. Siregar, U.J.; Situmorang, I.M.; Pasaribu, F.A.; Lestari, A.; Istikorini, Y.; Haneda, N.F. Trypsin inhibitor activities as defense mechanism of sengon (Falcataria moluccana) against pest attacks. IOP Conf. Ser. Mater. Sci. Eng. 2020, 935, 012034. [Google Scholar] [CrossRef]
  18. Haneda, N.F.; Nuban, S.R. Development of Boktor (Xystrocera festiva pascoe) Larvae in Artificial Diet by Using Sengon (Paraserianthes falcataria) Powder. J. Silvikultur Trop. 2011, 2, 19–25. [Google Scholar]
  19. Gatehouse, J.A. Prospects for Using Proteinase Inhibitors to Protect Transgenic Plants Against Attack by Herbivorous Insects. Curr. Protein Pept. Sci. 2011, 12, 409–416. [Google Scholar] [CrossRef] [PubMed]
  20. Bandani, A. Effect of plant a-amylase inhibitors on sunn pest, Eurygaster integriceps Puton (Hemiptera: Scutelleridae), alpha-amylase activity. Commun. Agric. Appl. Biol. Sci. 2005, 70, 869–873. [Google Scholar]
  21. Garcia, V.A.; Freire, M.D.G.M.; Novello, J.C.; Marangoni, S.; Macedo, M.L.R. Trypsin inhibitor from Poecilanthe parviflora seeds: Purification, characterization, and activity against pest proteases. Protein J. 2004, 23, 343–350. [Google Scholar] [CrossRef]
  22. Odhav, B.; Kandasamy, T.; Khumalo, N.; Baijnath, H. Screening of African traditional vegetables for their alpha-amylase inhibitory effect. J. Med. Plants Res. 2010, 4, 1502–1507. [Google Scholar]
  23. Rathinam, M.; Mishra, P.; Mahato, A.K.; Singh, N.K.; Rao, U.; Sreevathsa, R. Comparative transcriptome analyses provide novel insights into the differential response of Pigeonpea (Cajanus cajan L.) and its wild relative (Cajanus platycarpus (Benth.) Maesen) to herbivory by Helicoverpa armigera (Hübner). Plant Mol. Biol. 2019, 101, 163–182. [Google Scholar] [CrossRef]
  24. Borah, S.; Singh, S.K.; Bhorali, P.; Bora, D. Seasonal incidence pattern and host preference of Odoiporus longicollis Olivier (Coleoptera: Curculionidae) in certain banana cultivars of Assam. J. Entomol. Res. 2020, 44, 59–66. [Google Scholar] [CrossRef]
  25. Siregar, U.J.; Nugroho, A.; Shabrina, H.; Indriani, F.; Damayanti, A.; Matra, D.D. De novo transcriptome assembly data for sengon (Falcataria moluccana) trees displaying resistance and susceptibility to boktor stem borers (Xystrocera festiva Pascoe). BMC Res. Notes 2021, 14, 261. [Google Scholar] [CrossRef] [PubMed]
  26. Planells, B.; Gómez-Redondo, I.; Pericuesta, E.; Lonergan, P.; Gutiérrez-Adán, A. Differential isoform expression and alternative splicing in sex determination in mice. BMC Genom. 2019, 20, 202. [Google Scholar] [CrossRef]
  27. Sharp, P.A. The discovery of split genes and RNA splicing. Trends Biochem. Sci. 2005, 30, 279–281. [Google Scholar] [CrossRef]
  28. Fu, X.D.; Ares, M. Context-dependent control of alternative splicing by RNA-binding proteins. Nat. Rev. Genet. 2014, 15, 689–701. [Google Scholar] [CrossRef]
  29. Fu, X.D. Towards a splicing code. Cell 2004, 119, 736–738. [Google Scholar] [CrossRef]
  30. Alberts, B.; Johnson, A.; Lewis, J. Molecular Biology of the Cell, 4th ed.; Garland Science: New York, NY, USA, 2002; Volume 347. [Google Scholar]
  31. Yi, L.; Liu, L.; Melsted, P.; Pachter, L. A direct comparison of genome alignment and transcriptome pseudoalignment. bioRxiv 2018, 444620. Available online: https://www.biorxiv.org/content/10.1101/444620v1.full.pdf (accessed on 6 November 2024). [CrossRef]
  32. Dornell, J. Alternative Splicing: Importance and Definition. Technology Networks. August 2021. Available online: https://www.technologynetworks.com/genomics/articles/alternative-splicing-importance-and-definition-351813 (accessed on 21 April 2023).
  33. Mandadi, K.K.; Scholthof, K.B.G. Genome-wide analysis of alternative splicing landscapes modulated during plant-virus interactions in Brachypodium distachyon. Plant Cell 2015, 27, 71–85. [Google Scholar] [CrossRef]
  34. Tao, Y.; Zhang, Q.; Wang, H.; Yang, X.; Mu, H. Alternative splicing and related RNA binding proteins in human health and disease. Signal Transduct. Target. Ther. 2024, 9, 26. [Google Scholar] [CrossRef] [PubMed]
  35. Shabrina, H.; Siregar, U.J.; Matra, D.D.; Siregar, I.Z. The dataset of de novo transcriptome assembly of Falcataria moluccana cambium from gall-rust (Uromycladium falcatarium) infected and non- infected tree. Data Br. 2019, 26, 4–7. [Google Scholar] [CrossRef]
  36. Akhter, S.; Kretzschmar, W.W.; Nordal, V.; Delhomme, N.; Street, N.R.; Nilsson, O.; Emanuelsson, O.; Sundström, J.F. Integrative analysis of three RNA sequencing methods identifies mutually exclusive exons of MADS-box isoforms during early bud development in picea abies. Front. Plant Sci. 2018, 871, 1625. [Google Scholar] [CrossRef]
  37. Voshall, A.; Moriyama, E.N. Next-generation transcriptome assembly and analysis: Impact of ploidy. Methods 2020, 176, 14–24. [Google Scholar] [CrossRef] [PubMed]
  38. Jamal, F.; Pandey, P.K.; Singh, D.; Khan, M.Y. Serine protease inhibitors in plants: Nature’s arsenal crafted for insect predators. Phytochem. Rev. 2013, 12, 1–34. [Google Scholar] [CrossRef]
  39. Terada, S.; Fujimura, S.; Kino, S.; Kimoto, E. Purification and Characterization of Three Proteinase Inhibitors from Canavalia lineata Seeds. Biosci. Biotechnol. Biochem. 1994, 58, 371–375. [Google Scholar] [CrossRef] [PubMed]
  40. Amaral, M.D.; Freitas, A.C.O.; Santos, A.S.; dos Santos, E.C.; Ferreira, M.M.; Gesteira, A.d.S.; Gramacho, K.P.; Marinho-Prado, J.S.; Pirovani, C.P. TcTI, a Kunitz-type trypsin inhibitor from cocoa associated with defense against pathogens. Sci. Rep. 2022, 12, 1–16. [Google Scholar] [CrossRef]
  41. Schneider, F.; Houseman, J.G.; Morrison, P. Activity cycles and the regulation of digestive proteases in the posterior midgut of Stomoxys calcitrans (L.) (Diptera: Muscidae). Insect Biochem. 1987, 17, 859–862. [Google Scholar] [CrossRef]
  42. Huang, H.; Qi, S.D.; Qi, F.; Wu, C.A.; Yang, G.D.; Zheng, C.C. NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response. FEBS J. 2010, 277, 4076–4088. [Google Scholar] [CrossRef]
  43. Lucy, A.P.; Guo, H.S.; Li, W.X.; Ding, S.W. Suppression of post-transcriptional gene silencing by a plant viral protein localized in the nucleus. EMBO J. 2000, 19, 1672–1680. [Google Scholar] [CrossRef]
  44. Li, H.; Zhou, H.; Zhang, J.; Fu, X.; Ying, Z.; Liu, X. Proteinaceous α-amylase inhibitors: Purification, detection methods, types and mechanisms. Int. J. Food Prop. 2021, 24, 277–290. [Google Scholar] [CrossRef]
  45. Hao, X.; Li, J.; Shi, Q.; Zhang, J.; He, X.; Ma, H. Characterization of a novel legumin α-amylase inhibitor from chickpea (Cicer arietinum L.) seeds. Biosci. Biotechnol. Biochem. 2009, 73, 1200–1202. [Google Scholar] [CrossRef]
  46. Morton, R.L.; Schroeder, H.E.; Bateman, K.S.; Chrispeels, M.J.; Armstrong, E.; Higgins, T.J.V. Bean α-amylase inhibitor 1 in transgenic peas (Pisum sativum) provides complete protection from pea weevil (Bruchus pisorum) under field conditions. Proc. Natl. Acad. Sci. USA 2000, 97, 3820–3825. [Google Scholar] [CrossRef]
  47. Franco, O.L.; Rigden, D.J.; Melo, F.R.; Grossi-de-Sá, M.F. Plant α-amylase inhibitors and their interaction with insect α-amylases. Eur. J. Biochem. 2002, 269, 397–412. [Google Scholar] [CrossRef] [PubMed]
  48. Wu, J.; Liu, X.; Zhang, S.; Zhu, Y.C.; Whitworth, R.J.; Chen, M.S. Differential responses of wheat inhibitor-like genes to Hessian fly, Mayetiola destructor, attacks during compatible and incompatible interactions. J. Chem. Ecol. 2008, 34, 1005–1012. [Google Scholar] [CrossRef] [PubMed]
  49. Li, K.; Yao, F.; Du, J.; Deng, X.; Li, C. Persimmon Tannin Decreased the Glycemic Response through Decreasing the Digestibility of Starch and Inhibiting α-Amylase, α-Glucosidase, and Intestinal Glucose Uptake. J. Agric. Food Chem. 2018, 66, 1629–1637. [Google Scholar] [CrossRef] [PubMed]
  50. Bruce, T.J.A. Interplay between insects and plants: Dynamic and complex interactions that have coevolved over millions of years but act in milliseconds. J. Exp. Bot. 2015, 66, 455–465. [Google Scholar] [CrossRef]
  51. Major, I.T.; Constabel, C.P. Functional analysis of the kunitz trypsin inhibitor family in poplar reveals biochemical diversity and multiplicity in defense against herbivores. Plant Physiol. 2008, 146, 888–903. [Google Scholar] [CrossRef]
  52. Yin, M.; Song, N.; Chen, S.; Wu, J. NaKTI2, a Kunitz trypsin inhibitor transcriptionally regulated by NaWRKY3 and NaWRKY6, is required for herbivore resistance in Nicotiana attenuata. Plant Cell Rep. 2021, 40, 97–109. [Google Scholar] [CrossRef]
  53. Tekale, S.S.; Padul, M.V. Effect of Mechanical Wounding on Level of Secondary Metabolites in Cajanus cajan and Defense Against Helicoverpa armigera. Trends Biotechnol. Res. 2017, 6, 4–8. [Google Scholar]
  54. Cipollini, D.F.; Busch, J.W.; Stowe, K.A.; Simms, E.L.; Bergelson, J. Genetic variation and relationships of constitutive and herbivore-induced glucosinolates, trypsin inhibitors, and herbivore resistance in Brassica rapa. J. Chem. Ecol. 2003, 29, 285–302. [Google Scholar] [CrossRef]
  55. Jongsma, M.A. The Resistance of Insects to Plant Proteinase Inhibitors Centrale; Wageningen University Research: Wageningen, The Netherlands, 1995; Available online: https://edepot.wur.nl/200061 (accessed on 25 April 2023).
  56. Eberl, F.; Fabisch, T.; Luck, K.; Köllner, T.G.; Vogel, H.; Gershenzon, J.; Unsicker, S.B. Poplar protease inhibitor expression differs in an herbivore specific manner. BMC Plant Biol. 2021, 21, 170. [Google Scholar] [CrossRef]
  57. Barrett, M.L.; Udani, J.K. A proprietary alpha-amylase inhibitor from white bean (Phaseolus vulgaris): A review of clinical studies on weight loss and glycemic control. Nutr. J. 2011, 10, 24. [Google Scholar] [CrossRef]
  58. Andrews, S. FASTQC: A Quality Control Tool for High Throughput Sequence Data. 2010. Google Scholar. 2019. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 16 December 2021).
  59. Boisvert, S.; Laviolette, F.; Corbeil, J. Ray: Simultaneous assembly of reads from a mix of high-throughput sequencing technologies. J. Comput. Biol. 2010, 17, 1401–1415. [Google Scholar] [CrossRef]
  60. Kinjo, S.; Monma, N.; Misu, S.; Kitamura, N.; Imoto, J.; Yoshitake, K.; Gojobori, T.; Ikeo, K. Maser: One-stop platform for NGS big data from analysis to visualization. Database 2018, 2018, bay027. [Google Scholar] [CrossRef]
  61. Seppey, M.; Manni, M.; Zdobnov, E.M. BUSCO: Assessing genome assembly and annotation completeness. Methods Mol. Biol. 2019, 1962, 227–245. [Google Scholar] [CrossRef] [PubMed]
  62. Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.; et al. Twelve years of SAMtools and BCFtools. Gigascience 2021, 10, giab008. [Google Scholar] [CrossRef] [PubMed]
  63. Geisslitz, S.; Weegels, P.; Shewry, P.; Zevallos, V.; Masci, S.; Sorrells, M.; Gregorini, A.; Colomba, M.; Jonkers, D.; Huang, X.; et al. Wheat amylase/trypsin inhibitors (ATIs): Occurrence, function and health aspects. Eur. J. Nutr. 2022, 61, 2873–2880. [Google Scholar] [CrossRef] [PubMed]
  64. Roberts, A.; Pachter, L. Streaming fragment assignment for real-time analysis of sequencing experiments. Nat. Methods 2013, 10, 71–73. [Google Scholar] [CrossRef]
  65. Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2009, 26, 139–140. [Google Scholar] [CrossRef]
  66. Kõressaar, T.; Lepamets, M.; Kaplinski, L.; Raime, K.; Andreson, R.; Remm, M. Primer3-masker: Integrating masking of template sequence with primer design software. Bioinformatics 2018, 34, 1937–1938. [Google Scholar] [CrossRef]
  67. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
Plants 14 02750 g001
Figure 1. The alignment of TI-containing contigs from Falcataria falcata transcripts. With Glycine max TI (accession number AF128268.1) (A) and AAI-containing contigs with Phaseolus vulgaris AAI (accession number U10348.1) (B).
Figure 1. The alignment of TI-containing contigs from Falcataria falcata transcripts. With Glycine max TI (accession number AF128268.1) (A) and AAI-containing contigs with Phaseolus vulgaris AAI (accession number U10348.1) (B).
Plants 14 02750 g001
Plants 14 02750 g002
Figure 2. Phylogenetic tree of TI-containing contigs from F. falcata transcripts with G. max TI (accession number AF128268.1) (A) and AAI-containing contigs with P. vulgaris AAI (accession number U10348.1) (B).
Figure 2. Phylogenetic tree of TI-containing contigs from F. falcata transcripts with G. max TI (accession number AF128268.1) (A) and AAI-containing contigs with P. vulgaris AAI (accession number U10348.1) (B).
Plants 14 02750 g002
Plants 14 02750 g003
Figure 3. The spliced alignment of AAI (A) and TI (B). Contigs: transcriptome sequence; scaffolds: genome draft sequence.
Figure 3. The spliced alignment of AAI (A) and TI (B). Contigs: transcriptome sequence; scaffolds: genome draft sequence.
Plants 14 02750 g003
Plants 14 02750 g004
Figure 4. DEG results of the resistant and infested F. falcata trees.
Figure 4. DEG results of the resistant and infested F. falcata trees.
Plants 14 02750 g004
Plants 14 02750 g005
Figure 5. The logFC value of TI (A) and AAI (B) contigs in DEG analysis from RNA-Seq of F. falcata.
Figure 5. The logFC value of TI (A) and AAI (B) contigs in DEG analysis from RNA-Seq of F. falcata.
Plants 14 02750 g005
Plants 14 02750 g006
Figure 6. The amplicons amplified by TI (A) and AAI (B) primers with 50 bp ladder (L). S1–S3: samples from resistant trees 1–3; B1–B3: samples from X. festiva-infested trees 1–3.
Figure 6. The amplicons amplified by TI (A) and AAI (B) primers with 50 bp ladder (L). S1–S3: samples from resistant trees 1–3; B1–B3: samples from X. festiva-infested trees 1–3.
Plants 14 02750 g006
Plants 14 02750 g007
Figure 7. Relative expression of AAI (A) and TI (B) genes in F. falcata against X. festiva.
Figure 7. Relative expression of AAI (A) and TI (B) genes in F. falcata against X. festiva.
Plants 14 02750 g007
Plants 14 02750 g008
Figure 8. F. falcata tree with X. festiva burrowing hole (red circle).
Figure 8. F. falcata tree with X. festiva burrowing hole (red circle).
Plants 14 02750 g008
Table 1. Contigs of TI and AAI found in Falcataria falcata wood transcriptomes.
Table 1. Contigs of TI and AAI found in Falcataria falcata wood transcriptomes.
No.Contig NameHitsAccession Number
Trypsin Inhibitor
1Cluster-42052.303167_TRINITY_DN172546_c1_g2_i21023–778P32733.1
2Cluster-42052.306924_TRINITY_DN178415_c6_g1_i1569–634J2Y_A
3Cluster-42052.247290_TRINITY_DN178415_c6_g6_i12–454P24924.2
4Cluster-42052.206862_TRINITY_DN181734_c1_g2_i31006–575P83036.2
5Cluster-42052.195413_TRINITY_DN177358_c0_g2_i21218–697AFG28551.1
6Cluster-42052.169979_Contig183492423–1929AFG28551.1
7Cluster-42052.253142_TRINITY_DN169753_c0_g1_i1690–346P83036.2
8Cluster-42052.207278_TRINITY_DN191341_c4_g2_i4722–186AFG28551.1
9Cluster-42052.155280_TRINITY_DN182112_c0_g2_i2704–312AFG28551.1
10Cluster-42052.175330_Contig183481857–1363AFG28551.1
11Cluster-42052.266424_TRINITY_DN160773_c0_g1_i1443–994P24924.2
12Cluster-42052.180501_TRINITY_DN171608_c0_g1_i1703–197P83036.2
13Cluster-42052.15862_TRINITY_DN183193_c0_g1_i6585–869P09941.1
14Cluster-42052.179981_TRINITY_DN168277_c1_g1_i2507–683AAB26177.1
15Cluster-42052.61489_Contig29962430–978P83036.2
16Cluster-42052.228242_TRINITY_DN169156_c0_g1_i1426–884P24924.2
17Cluster-42052.208643_TRINITY_DN175236_c0_g1_i2238–101P32733.1
18Cluster-42052.77508_TRINITY_DN181117_c0_g1_i2380–93AFG28551.1
19Cluster-42052.264216_TRINITY_DN129174_c0_g1_i1768–643AFG28551.1
α-amylase Inhibitor
1Cluster-42052.208011_TRINITY_DN177772_c6_g3_i6869–15581VIW_B
2Cluster-42052.237331_TRINITY_DN186379_c1_g2_i1615–11541VIW_B
3Cluster-42052.144807_TRINITY_DN174608_c1_g1_i1345–10191VIW_B
4Cluster-42052.138754_TRINITY_DN181383_c6_g1_i1551–1126P02873
5Cluster-42052.162634_TRINITY_DN181383_c6_g1_i2551–1126P02873
6Cluster-42052.188408_TRINITY_DN182603_c3_g1_i1436–10531VIW_B
7Cluster-42052.155248_Contig109391–2101VIW_B
8Cluster-42052.100030_TRINITY_DN177479_c0_g1_i11899–1267P02873
9Cluster-42052.216188_TRINITY_DN186223_c4_g4_i53177–33771VIW_B
10Cluster-42052.319012_TRINITY_DN172082_c0_g1_i3738–14421VIW_B
11Cluster-42052.201855_Contig18100104–808P02873
12Cluster-42052.195476_TRINITY_DN164741_c0_g2_i1498–10671VIW_B
13Cluster-42052.177708_TRINITY_DN172458_c0_g1_i1543–55Q9SMJ4
14Cluster-42052.235439_TRINITY_DN180890_c2_g1_i2320–655Q9SMJ4
15Cluster-42052.341257_TRINITY_DN180890_c2_g1_i1492–869Q9SMJ4
16Cluster-42052.245145_TRINITY_DN180307_c1_g4_i3478–11641VIW_B
17Cluster-42052.216103_TRINITY_DN186574_c0_g1_i2638–13121VIW_B
18Cluster-42052.420818_TRINITY_DN182603_c3_g1_i4490–11071VIW_B
19Cluster-42052.179748_TRINITY_DN185634_c1_g3_i3571–1143P02873
20Cluster-42052.245310_TRINITY_DN185634_c1_g3_i4511–1086Q41114
21Cluster-42052.169697_Contig9179754–53P02873
22Cluster-42052.182397_TRINITY_DN175336_c0_g1_i2677–1312P02873
23Cluster-42052.207959_TRINITY_DN183003_c2_g5_i3293–541P02873
24Cluster-42052.189890_TRINITY_DN184034_c1_g5_i1167–562P02873
25Cluster-42052.218695_Contig388671279–551Q9SMJ4
26Cluster-42052.207925_TRINITY_DN173791_c0_g1_i31–402P02873
27Cluster-42052.24436_Contig7754570–7701VIW_B
28Cluster-42052.123152_TRINITY_DN184034_c1_g3_i1245–361VIW_B
29Cluster-42052.292956_TRINITY_DN176191_c0_g1_i1457–110P02873
Table 2. DEG results for TI and AAI in F. falcata.
Table 2. DEG results for TI and AAI in F. falcata.
TISequencelogFCp-ValueName
Cluster-42052.169979_Contig18349−11.4721.15 × 10−25AFG28551.1 Kunitz trypsin inhibitor
Cluster-42052.15862_TRINITY_DN183193_c0_g1_i6−10.11028.55 × 10−17sp|P09941.1| trypsin inhibitor DE5 alpha chain
Cluster-42052.179981_TRINITY_DN168277_c1_g1_i2−9.645784.26 × 10−14AAB26177.1 Kunitz-type trypsin inhibitor A chain,
Cluster-42052.146119_TRINITY_DN173153_c0_g3_i1−9.583579.45 × 10−14AFG28551.1 Kunitz trypsin inhibitor, partial
Cluster-42052.231745_TRINITY_DN191341_c4_g2_i3−9.277913.82 × 10−12sp|C0HKQ3.1| Kunitz-type trypsin inhibitor IVTI
Cluster-42052.155280_TRINITY_DN182112_c0_g2_i2−8.106133.57 × 10−22AFG28551.1 Kunitz trypsin inhibitor,
Cluster-42052.175330_Contig18348−7.142879.21 × 10−22AFG28551.1 Kunitz trypsin inhibitor,
Cluster-42052.208643_TRINITY_DN175236_c0_g1_i2−5.774131.75 × 10−13sp|P32733.1|Kunitz-type trypsin inhibitor alpha chain
Cluster-42052.61489_Contig29962−5.412352.84 × 10−13sp|P83036.2| trypsin inhibitor
Cluster-42052.206862_TRINITY_DN181734_c1_g2_i3−5.180199.31 × 10−22sp|P83036.2| Full = trypsin inhibitor;
Cluster-42052.195413_TRINITY_DN177358_c0_g2_i2−4.902336.39 × 10−20AFG28551.1 Kunitz trypsin inhibitor, partial
Cluster-42052.228242_TRINITY_DN169156_c0_g1_i1−4.818483.13 × 10−10sp|P24924.2| trypsin inhibitor
Cluster-42052.180501_TRINITY_DN171608_c0_g1_i1−4.175328.19 × 10−12sp|P83036.2|trypsin inhibitor
Cluster-42052.207278_TRINITY_DN191341_c4_g2_i4−3.685643.05 × 10−12AFG28551.1 Kunitz trypsin inhibitor
Cluster-42052.77508_TRINITY_DN181117_c0_g1_i2−3.327576.14 × 10−7AFG28551.1 Kunitz trypsin inhibitor
Cluster-42052.264216_TRINITY_DN129174_c0_g1_i1−1.208590.033664AFG28551.1 Kunitz trypsin inhibitor
Cluster-42052.266424_TRINITY_DN160773_c0_g1_i1−0.543280.279542sp|P24924.2| trypsin inhibitor
Cluster-42052.253142_TRINITY_DN169753_c0_g1_i1−0.143290.76744sp|P83036.2| trypsin inhibitor
Cluster-42052.247290_TRINITY_DN178415_c6_g6_i11.7647280.00016sp|P24924.2|trypsin inhibitor
Cluster-42052.306924_TRINITY_DN178415_c6_g1_i13.4788161.12 × 10−13pdb|4J2Y|A Chain A, trypsin inhibitor
Cluster-42052.303167_TRINITY_DN172546_c1_g2_i24.0273329.26 × 10−18sp|P32733.1| Kunitz-type trypsin inhibitor alpha chain
AAISequencelogFCp-ValueName
Cluster-42052.100030_TRINITY_DN177479_c0_g1_i12.015853.416676sp|P02873.1| Alpha-amylase inhibitor 1
Cluster-42052.235439_TRINITY_DN180890_c2_g1_i21.476641.707336sp|Q9SMJ4.1| Alpha-amylase inhibitor
Cluster-42052.341257_TRINITY_DN180890_c2_g1_i11.049421.408281sp|Q9SMJ4.1| Alpha-amylase inhibitor
Cluster-42052.216188_TRINITY_DN186223_c4_g4_i51.026263.460806pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.155248_Contig109390.977743.686339pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.144807_TRINITY_DN174608_c1_g1_i10.765384.318647pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.208011_TRINITY_DN177772_c6_g3_i60.504144.926196pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.162634_TRINITY_DN181383_c6_g1_i20.373544.001451sp|P02873.1| Alpha-amylase inhibitor 1; Short = Alpha-AI-1;
Cluster-42052.420818_TRINITY_DN182603_c3_g1_i40.315281.416495pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.138754_TRINITY_DN181383_c6_g1_i10.228614.274507sp|P02873.1| Alpha-amylase inhibitor 1
Cluster-42052.237331_TRINITY_DN186379_c1_g2_i10.095064.693314pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.177708_TRINITY_DN172458_c0_g1_i1−0.176962.1322sp|Q9SMJ4.1| Alpha-amylase inhibitor
Cluster-42052.319012_TRINITY_DN172082_c0_g1_i3−0.210073.530725pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.147883_Contig6928−0.250734.212243sp|P02873.1| Alpha-amylase inhibitor 1
Cluster-42052.189890_TRINITY_DN184034_c1_g5_i1−0.382220.493207sp|P02873.1| Alpha-amylase inhibitor 1
Cluster-42052.188408_TRINITY_DN182603_c3_g1_i1−0.600563.938534pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.209935_TRINITY_DN185927_c2_g3_i1−0.604863.325443sp|P84708.1| Chitinolytic alpha-amylase inhibitor
Cluster-42052.24436_Contig7754−0.79325−0.016pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.123152_TRINITY_DN184034_c1_g3_i1−0.85830.428841pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.169697_Contig9179−1.384861.437683sp|P02873.1| Alpha-amylase inhibitor 1
Cluster-42052.216103_TRINITY_DN186574_c0_g1_i2−1.640422.126177pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.195476_TRINITY_DN164741_c0_g2_i1−1.729112.658958pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.201855_Contig18100−2.011502.602573sp|P02873.1| Alpha-amylase inhibitor 1
Cluster-42052.182397_TRINITY_DN175336_c0_g1_i2−2.111161.290499sp|P02873.1| Alpha-amylase inhibitor 1
Cluster-42052.359247_TRINITY_DN178532_c0_g1_i2−2.116821.589345sp|P84708.1| Chitinolytic alpha-amylase inhibitor
Cluster-42052.206287_TRINITY_DN186880_c2_g2_i2−3.268117.775568sp|P84708.1| Chitinolytic alpha-amylase inhibitor PvCAI
Cluster-42052.218695_Contig38867−3.795740.394497sp|Q9SMJ4.1| Alpha-amylase inhibitor
Cluster-42052.207925_TRINITY_DN173791_c0_g1_i3−3.855750.450129sp|P02873.1| Alpha-amylase inhibitor 1
Cluster-42052.238154_Contig19707−5.905053.19328pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Cluster-42052.292956_TRINITY_DN176191_c0_g1_i1−9.354410.579165sp|P02873.1| Alpha-amylase inhibitor 1
Cluster-42052.207959_TRINITY_DN183003_c2_g5_i3−9.540550.769758sp|P02873.1| Alpha-amylase inhibitor 1
Cluster-42052.245310_TRINITY_DN185634_c1_g3_i4−10.27671.526612sp|Q41114.1| Alpha-amylase inhibitor 2
Cluster-42052.179748_TRINITY_DN185634_c1_g3_i3−10.43771.69216sp|P02873.1| Alpha-amylase inhibitor 1
Cluster-42052.245145_TRINITY_DN180307_c1_g4_i3−10.75242.015186pdb|1VIW|B Chain B, ALPHA-AMYLASE-INHIBITOR
Table 3. Primer sequences that successfully produce a specific band.
Table 3. Primer sequences that successfully produce a specific band.
PrimerSequenceTm (°C)Tm (°C)
TI
ForwardGACAGGAAACGAAACTTGCCCGACAGGAAACGAAACTTGCCC61.3
ReverseACGAAATTTTCCATGGCAAGCCACGAAATTTTCCATGGCAAGCC60.3
AAI
ForwardAGGAAACGAAGGAAAG CGCGGAGGAAACGAAGGAAAG CGCGG61.3
ReverseTTGCCGTTTCCTCCGAT TCCTTGCCGTTTCCTCCGAT TCC60.5
Actin
ForwardTTGACTGCGCTTCATCACCCTTGACTGCGCTTCATCACCC60.5
ReverseGGCTGGTTTTGCTGGTGATGGGCTGGTTTTGCTGGTGATG60.5
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Siregar, U.J.; Shabrina, H.; Nurianti, E.; Dwiyuni, F.; Lestari, A.I.; Sihombing, J.K.; Larosa, B.; Anita, V.P.D.; Matra, D.D. Multi-Transcripts and Expressions of Trypsin Inhibitor and α-Amylase Inhibitor Genes of Sengon (Falcataria falcata) Against Xystrocera festiva Stem Borer Infestation. Plants 2025, 14, 2750. https://doi.org/10.3390/plants14172750

AMA Style

Siregar UJ, Shabrina H, Nurianti E, Dwiyuni F, Lestari AI, Sihombing JK, Larosa B, Anita VPD, Matra DD. Multi-Transcripts and Expressions of Trypsin Inhibitor and α-Amylase Inhibitor Genes of Sengon (Falcataria falcata) Against Xystrocera festiva Stem Borer Infestation. Plants. 2025; 14(17):2750. https://doi.org/10.3390/plants14172750

Chicago/Turabian Style

Siregar, Ulfah Juniarti, Hasyyati Shabrina, Esti Nurianti, Fahirah Dwiyuni, Ayu Indah Lestari, Januard Kristian Sihombing, Buma Larosa, Vilda Puji Dini Anita, and Deden Derajat Matra. 2025. "Multi-Transcripts and Expressions of Trypsin Inhibitor and α-Amylase Inhibitor Genes of Sengon (Falcataria falcata) Against Xystrocera festiva Stem Borer Infestation" Plants 14, no. 17: 2750. https://doi.org/10.3390/plants14172750

APA Style

Siregar, U. J., Shabrina, H., Nurianti, E., Dwiyuni, F., Lestari, A. I., Sihombing, J. K., Larosa, B., Anita, V. P. D., & Matra, D. D. (2025). Multi-Transcripts and Expressions of Trypsin Inhibitor and α-Amylase Inhibitor Genes of Sengon (Falcataria falcata) Against Xystrocera festiva Stem Borer Infestation. Plants, 14(17), 2750. https://doi.org/10.3390/plants14172750

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop