Identification and Distribution of Begomoviruses Infecting Cassava Fields in Sierra Leone
Abstract
1. Introduction
2. Results
2.1. Phenotypic Assessment of Cassava Mosaic Disease
2.2. Phenotypic and Molecular Detection and Distribution of Cassava Begomoviruses in Sierra Leone
3. Discussion
4. Materials and Methods
4.1. Surveyed Experimental Sites
4.2. Survey Design
4.3. Field Data Collection and Storage
4.4. Molecular Detection
4.5. Data Analysis
4.5.1. Phenotypic Analysis
4.5.2. Molecular Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ACMV | African cassava mosaic virus |
| CMD | Cassava mosaic disease |
| CTAB | Cetyltrimethylammonium bromide |
| DNA | Deoxyribonucleic acid |
| EACMV | East African cassava mosaic virus |
| MEGA | Molecular Evolutionary Genetics Analysis |
| PCR | Polymerase chain reaction |
References
- The WIRE. Why Cassava Has So Much Potential in Sub-Saharan Africa. 2020. Available online: https://thewire.in/agriculture/food-security-climate-change-cassava (accessed on 19 April 2022).
- The Food and Agriculture Organization Statistics FAOSTAT. 2020. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 7 March 2022).
- Tarawali, G.; Ilona, P.; Ojiako, I.A.; Iyangbe, C.; Ogundijo, D.S.; Asumugha, G.; Udensi, U.E. A Comprehensive Training Module on Competitive Cassava Production; International Institute of Tropical Agriculture (IITA): Ibadan, Nigeria, 2013; Available online: https://www.iita.org/wp-content/uploads/2016/06/A_comprehensive_training_module_on_competitive_cassava_production.pdf (accessed on 19 April 2022).
- Storey, H.H. Virus diseases of East African plants: VI-A progress report on studies of the diseases of cassava. East Afr. Agric. J. 1936, 2, 34–39. [Google Scholar]
- Winter, S.; Koerbler, M.; Stein, B.; Pietruszka, A.; Paape, M.; Butgereitt, A. Analysis of cassava brown streak viruses reveals the presence of distinct virus species causing cassava brown streak disease in East Africa. J. Gen. Virol. 2010, 91, 1365–1372. [Google Scholar]
- Owor, B.; Legg, J.P.; Okao-Okuja, G.; Obonyo, R.; Ogenga-Latigo, M.W. The effect of cassava mosaic geminiviruses on symptom severity, growth and root yield of a cassava mosaic virus disease-susceptible cultivar in Uganda. Ann. Appl. Biol. 2004, 145, 331–337. [Google Scholar]
- Legg, J.P.; Owor, B.; Sseruwagi, P.; Ndunguru, J. Cassava mosaic virus disease in east and central Africa: Epidemiology and management of a regional pandemic. Adv. Virus Res. 2006, 67, 355–418. [Google Scholar] [CrossRef]
- Fauquet, C.M.; Briddon, R.W.; Brown, J.K.; Moriones, E.; Stanley, J.; Zerbini, M.; Zhou, X. Geminivirus strain demarcation and nomenclature. Arch. Virol. 2008, 153, 783–821. [Google Scholar] [CrossRef]
- Samura, A.E.; Massaquoi, F.B.; Mansaray, A.; Kumar, P.L.; Koroma, J.P.C.; Fomba, S.N.; Dixon, A. Status and diversity of the cassava mosaic disease causal agents in Sierra Leone. Int. J. Agric. For. 2014, 4, 246–254. [Google Scholar]
- Chi, Y.; Pan, L.L.; Bouvaine, S.; Fan, Y.Y.; Liu, Y.Q.; Liu, S.S.; Seal, S.; Wang, X.W. Differential transmission of Sri Lankan cassava mosaic virus by three cryptic species of the whitefly Bemisia tabaci complex. Virology 2020, 540, 141–149. [Google Scholar]
- Njoroge, M.K.; Mutisya, D.L.; Miano, D.W.; Kilalo, D.C. Whitefly species efficiency in transmitting cassava mosaic and brown streak virus diseases. Cogent Biol. 2017, 3, 1311499. [Google Scholar]
- Maruthi, M.N.; Hillocks, R.J.; Mtunda, K.; Raya, M.D.; Muhanna, M.; Kiozia, H.; Rekha, A.R.; Colvin, J.; Thresh, J.M. Transmission of cassava brown streak virus by Bemisia tabaci (Gennadius). J. Phytopathol. 2005, 153, 307–312. [Google Scholar]
- Chikoti, P.C.; Tembo, M.; Chisola, M.; Ntawuruhungu, P.; Ndunguru, J. Status of cassava mosaic disease and whitefly population in Zambia. Afr. J. Biotechnol. 2015, 14, 2539–2546. [Google Scholar]
- Thresh, J.M.; Cooter, R.J. Strategies for controlling cassava mosaic virus disease in Africa. Plant Pathol. 2005, 54, 587–614. [Google Scholar] [CrossRef]
- Sseruwagi, P.; Sserubombwe, W.S.; Legg, J.P.; Ndunguru, J.; Thresh, J.M. Methods of surveying the incidence and severity of cassava mosaic disease and whitefly vector populations on cassava in Africa: A review. Virus Res. 2004, 100, 129–142. [Google Scholar] [CrossRef]
- Crespo-Bellido, A.; Hoyer, J.S.; Dubey, D.; Jeannot, R.B.; Duffy, S. Interspecies recombination has driven the macroevolution of cassava mosaic begomoviruses. J. Virol. 2021, 95, e00541-21. [Google Scholar] [CrossRef]
- Maruthi, M.N.; Seal, S.; Colvin, J.; Briddon, R.W.; Bull, S.E. East African cassava mosaic Zanzibar virus—A recombinant begomovirus species with a mild phenotype. Arch. Virol. 2004, 149, 2365–2377. [Google Scholar]
- Monde, G.; Walangululu, J.; Winter, S.; Bragard, C. Dual infection by cassava begomoviruses in two leguminous species (Fabaceae) in Yangambi, northeastern Democratic Republic of Congo. Arch. Virol. 2010, 155, 1865–1869. [Google Scholar] [PubMed]
- Patil, B.L.; Fauquet, C.M. Cassava mosaic geminiviruses: Actual knowledge and perspectives. Mol. Plant Pathol. 2009, 10, 685–701. [Google Scholar] [PubMed]
- Ndunguru, J.; Legg, J.P.; Aveling, T.A.S.; Thompson, G.; Fauquet, C.M. Molecular biodiversity of cassava begomoviruses in Tanzania: Evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses. Virol. J. 2005, 2, 21. [Google Scholar]
- Ariyo, O.A.; Koerbler, M.; Dixon, A.G.O.; Atiri, G.I.; Winter, S. Molecular variability and distribution of cassava mosaic begomoviruses in Nigeria. J. Phytopathol. 2005, 153, 226–231. [Google Scholar] [CrossRef]
- Were, H.K.; Winter, S.; Maiss, E. Distribution of begomoviruses infecting cassava in Africa. J. Plant Pathol. 2003, 85, 145–151. [Google Scholar]
- Ogero, K.O.; Mburugu, G.N.; Mwangi, M.; Ombori, O.; Ngugi, M. In vitro micropropagation of cassava through low-cost tissue culture. Asian J. Agric. Sci. 2012, 4, 205–209. [Google Scholar]
- Nassar, N.M.A.; Ortiz, R. A review on cassava improvement: Challenges and impacts. J. Agric. Sci. 2007, 145, 163–171. [Google Scholar] [CrossRef]
- Bakelana, Z.; Boykin, L.M.; Mahungu, N.; Mavila, N.; Magole, M.; Nduandele, N.; Makuati, L.; Ndomateso, T.; Monde, G.; Pita, J.; et al. First report and preliminary evaluation of cassava root necrosis in Angola. Int. J. Agric. Environ. Biores. 2019, 4, 37–46. [Google Scholar]
- Legg, J.P.; Jeremiah, S.C.; Obiero, H.M.; Maruthi, M.N.; Ndyetabula, I.; OkaoOkuja, G.; Bouwmeester, H.; Bigirimana, S.; Tata-Hangy, W.; Gashaka, G.; et al. Comparing the regional epidemiology of the cassava mosaic and cassava brown streak virus pandemics in Africa. Virus Res. 2011, 159, 161–170. [Google Scholar] [CrossRef]
- Samura, A.E.; Kanteh, S.M.; Norman, J.E.; Fomba, S.N. Integrated pest management options for the cassava mosaic disease in Sierra Leone. Int. J. Agric. Innov. Res. 2016, 5, 432–440. [Google Scholar]
- Sesay, J.V.; Ayeh, K.O.; Norman, P.E.; Acheampong, E. Shoot nodal culture and virus indexing of selected local and improved genotypes of cassava (Manihot esculenta) from Sierra Leone. Int. J. Biotechnol. Mol. Biol. Res. 2016, 7, 20–28. [Google Scholar]
- Sesay, J.V.; Lebbie, A.; Wadsworth, R.; Nuwamanya, E.; Bado, S.; Norman, P.E. Genetic structure and diversity study of cassava (Mannihot esculenta) germplasm for African cassava mosaic disease and fresh storage root yield. Open J. Genet. 2023, 13, 23–47. [Google Scholar] [CrossRef]
- Mivedor, A.S.; Dansou-Kodjo, K.A.; Adjata, D.K.; Pita, J.S. Identification and incidence of cassava mosaic begomoviruses in Togo. Asian J. Plant Pathol. 2020, 14, 11–20. [Google Scholar]
- Chikoti, P.C.; Peter, S.; Mulenga, R.M.; Tembo, M. Cassava mosaic disease: A review of a threat to cassava production in Zambia. J. Plant Pathol. 2019, 101, 467–477. [Google Scholar] [CrossRef]
- Fondong, V.N.; Pita, J.S.; Rey, M.E.C.; de Kochko, A.; Beachy, R.N.; Fauquet, C.M. Evidence of synergism between African cassava mosaic virus and a new double-recombinant geminivirus infecting cassava in Cameroon. J. Gen. Virol. 2000, 81, 287–297. [Google Scholar] [CrossRef]
- Ogbe, F.O.; Thottappilly, G.; Dixon, A.G.; Atiri, G.I.; Mignouna, H.D. Variants of East African cassava mosaic virus and its distribution in double infections with African cassava mosaic virus in Nigeria. Plant Dis. 2003, 87, 229–232. [Google Scholar] [CrossRef]
- Alicai, T.; Omongo, C.A.; Maruthi, M.N.; Hillocks, R.J.; Baguma, Y.; Kawuki, R.; Bua, A.; Otim-Nape, G.W.; Colvin, J. Re-emergence of cassava brown streak disease in Uganda. Plant Dis. 2007, 91, 24–29. [Google Scholar] [CrossRef]
- Njoroge, M.K.; Kilalo, D.C.; Miano, D.W.; Mutisya, D.L. Whiteflies species distribution and abundance on cassava crop in different agro-ecological zones of Kenya. J. Entomol. Zool. Stud. 2016, 4, 258–262. [Google Scholar]
- Combala, M.; Pita, J.S.; Gbonamou, M.; Samura, A.E.; Amoakon, W.J.-L.; Kouakou, B.S.M.; Onile-ere, O.; Sawadogo, S.; Eboulem, G.R.; Otron, D.H.; et al. An alarming eastward front of cassava mosaic disease in development in West Africa. Viruses 2024, 16, 1691. [Google Scholar] [CrossRef]
- Pita, J.S.; Fondong, V.N.; Sangare, A.; Otim-Nape, G.W.; Ogwal, S.; Fauquet, C.M. Recombination, pseudorecombination and synergism of geminiviruses are determinant keys to the epidemic of severe cassava mosaic disease in Uganda. J. Gen. Virol. 2001, 82, 655–665. [Google Scholar] [CrossRef]
- Valam-zango, A.; Zinga, I.; Hoareau, M.; Mvila, A.C.; Semballa, S.; Lett, J.M. First report of cassava mosaic geminiviruses and the Uganda strain of East African cassava mosaic virus (EACMV-UG) associated with cassava mosaic disease in Equatorial Guinea. New Dis. Rep. 2015, 32, 29. [Google Scholar]
- Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
- Kumar, P.L.; Cuervo, M.; Kreuze, J.F.; Muller, G.; Kulkarni, G.; Kumari, S.G.; Massart, S.; Mezzalama, M.; Alakonya, A.; Muchugi, A.; et al. Phytosanitary interventions for safe global germplasm exchange and the prevention of transboundary pest spread: The role of CGIAR germplasm health units. Plants 2021, 10, 328. [Google Scholar] [CrossRef]
- Harimalala, M.; Chiroleu, F.; Giraud-Carrier, C.; Hoareau, M.; Zinga, I.; Randriamampianina, J.A.; Velombola, S.; Ranomenja-nahary, S.; Andrianjaka, A.; Reynaud, B.; et al. Molecular epidemiology of cassava mosaic disease in Madagascar. Plant Pathol. 2014, 64, 501–507. [Google Scholar]
- Eni, A.O.; Efekemo, O.P.; Onile-ere, O.A.; Pita, J.S. South west and north central Nigeria: Assessment of cassava mosaic disease and field status of African cassava mosaic virus and East African cassava mosaic virus. Ann. Appl. Biol. 2021, 178, 466–479. [Google Scholar]
- Busogoro, J.P.; Masquellier, L.; Kummert, J.; Dutrecq, O.; Lepoivre, P.; Jijakli, M.H. Application of a simplified Molecular protocol to reveal mixed infections with begomoviruses in cassava. J. Phytopathol. 2008, 457, 452–457. [Google Scholar] [CrossRef]
- Zhou, X.; Robinson, D.J.; Harrison, B.D. Types of variation in DNA—A among isolates of East African cassava mosaic virus from Kenya, Malawi and Tanzania. J. Gen. Virol. 1998, 79, 2835–2840. [Google Scholar] [CrossRef]
- Fargene, D.; Colon, L.T.; Bouveau, R.; Fauquet, C. Components of resistance of cassava to African cassava mosaic virus. Eur. J. Plant Pathol. 1996, 102, 645–654. [Google Scholar] [CrossRef]
- IITA (International Institute of Tropical Agriculture). Cassava in Tropical Africa, A Reference Manual; IITA: Ibadan, Nigeria, 1990; 176p. [Google Scholar]
- Permingeat, H.R.; Romagnoli, M.V.; Sesma, J.I.; Vallejos, R.H. A simple method for isolating DNA of high yield and quality from cotton (shape Gossypium hirsutum L.) leaves. Plant Mol. Biol. Rep. 1998, 16, 89. [Google Scholar] [CrossRef]
- Matic, S.; da Cunha, A.T.P.; Thompson, J.R.; Tepfer, M. An analysis of viruses associated with cassava mosaic disease in three Angolan provinces. J. Plant Pathol. 2012, 94, 443–450. [Google Scholar]
- Alabi, O.J.; Kumar, P.L.; Naidu, R.A. Multiplex PCR method for the detection of African cassava mosaic virus and East African cassava mosaic Cameroon virus in cassava. J. Virol. Methods 2008, 154, 111–120. [Google Scholar] [CrossRef]
- Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. Proc. Nat. Acad. Sci. USA 1977, 74, 5463–5467. [Google Scholar] [CrossRef]
- Bao, Y.; Chetvernin, V.; Tatusova, T. Improvements to pairwise sequence comparison (PASC): A genome-based web tool for virus classification. Arch. Virol. 2014, 159, 3293–3304. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]







| Number of Samples | Status of Samples | Positive Samples | Negative Samples | |||
|---|---|---|---|---|---|---|
| Detection of ACMV | Detection of EACMV | Detection of ACMV/EACMV | Detection of EACMVCM Virus | |||
| 320 CMD | 230 | 4 | 58 | 43 | 28 | |
| 426 | 106 Symptomless | 13 | 0 | 6 | 5 | 87 |
| Total | 243 | 4 | 64 | 48 | 115 | |
| Region | Tested Samples | Positive Samples | ACMV-Single Infection | EACMV-Single Infection | Mixed Infection (ACMV/EACMV) | EACMVCM Virus | ||||
|---|---|---|---|---|---|---|---|---|---|---|
| n | % | n | % | n | % | n | % | |||
| South | 112 | 73 | 47 | 64.4 | 0 | 0.0 | 26 | 35.6 | 26 | 100.0 |
| East | 81 | 68 | 53 | 77.9 | 1 | 1.5 | 14 | 20.6 | 8 | 53.3 |
| North | 110 | 81 | 71 | 87.7 | 0 | 0.0 | 10 | 12.3 | 6 | 60.0 |
| Northwest | 79 | 60 | 45 | 75.0 | 3 | 5.0 | 12 | 20.0 | 8 | 53.3 |
| West | 44 | 29 | 27 | 93.1 | 0 | 0.0 | 2 | 6.9 | 0 | 0.0 |
| Total | 426 | 311 | 243 | 78.1 | 4 | 1.3 | 64 | 20.6 | 48 | 70.6 |
| Primer | Sequence (5′-3′) | Target Region | Expected Size (bp) | Virus Species | Reference |
|---|---|---|---|---|---|
| JSP001 | ATGTCGAAGCGACCAGGAGAT | DNA-A (CP) | 783 | ACMV | Pita et al. [37] |
| JSP002 | TGTTTATTAATTGCCAATACT | ||||
| ACMBVF | TCGGGAGTGATACATGCGAAGGC | DNA-B (BV1/BC1) | 628 | ACMV | Matic et al. [48] |
| ACMBVR | GGCTACACCAGCTACCTGAAGCT | ||||
| WAVE-508F | AAGGCCCATGTAAGGTCCAG | AV1/AC3 | 800 | ACMV | WAVE |
| WAVE-1307R | GAAGGAGCTGGGGATTCACA | ||||
| WAVE-177F | GATCTGCGGGCCTATCGAAT | BV1 | 800 | ACMV | WAVE |
| WAVE-197R | TTCACGCTGTGCAATACCCT | ||||
| WAVE-370F | ACAGCCCATACAGGAACCGT | AV1/AC3 | 1000 | ACMV | WAVE |
| WAVE-1369R | CGACCATTCCTGCTGAACCA | ||||
| WAVE-982F | TTCGTGTCATCTGCAGGAGA | BV1/BC1 | 800 | ACMV | WAVE |
| WAVE-1781R | GTACCATGGCAGCTGCTGTA | ||||
| JSP001 | ATGTCGAAGCGACCAGGAGAT | DNA-A (CP) | 780 | EACMV | Pita et al. [37] |
| JSP003 | CCTTTATTAATTTGTCACTGC | ||||
| CMBRepF | CRTCAATGACGTTGTACCA | DNA-A (AC1) | 650 | EACMV | Alabi et al. [49] |
| EACMVRepR | GGTTTGCAGAGAACTACATC | ||||
| WAVE-EA1875F | TGTACCAGGCGTCGTTTGAA | AC1 | 800 | EACMVCM | WAVE |
| WAVE-E2674R | TGTCCCCCGATCCAAAACG | ||||
| WAVE-EB1869F | TTCCAAGGGGAGGGTTCTGA | BC1 | 800 | EACMV | WAVE |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saffa, M.D.; Samura, A.E.; Bah, M.A.; Eni, A.O.; Tibiri, E.B.; Zongo, S.; Amoakon, W.J.-L.; Tiendrébéogo, F.; Pita, J.S.; Norman, P.E. Identification and Distribution of Begomoviruses Infecting Cassava Fields in Sierra Leone. Plants 2025, 14, 2142. https://doi.org/10.3390/plants14142142
Saffa MD, Samura AE, Bah MA, Eni AO, Tibiri EB, Zongo S, Amoakon WJ-L, Tiendrébéogo F, Pita JS, Norman PE. Identification and Distribution of Begomoviruses Infecting Cassava Fields in Sierra Leone. Plants. 2025; 14(14):2142. https://doi.org/10.3390/plants14142142
Chicago/Turabian StyleSaffa, Musa Decius, Alusaine Edward Samura, Mohamed Alieu Bah, Angela Obiageli Eni, Ezechiel B. Tibiri, Saïdou Zongo, William J.-L. Amoakon, Fidèle Tiendrébéogo, Justin Simon Pita, and Prince Emmanuel Norman. 2025. "Identification and Distribution of Begomoviruses Infecting Cassava Fields in Sierra Leone" Plants 14, no. 14: 2142. https://doi.org/10.3390/plants14142142
APA StyleSaffa, M. D., Samura, A. E., Bah, M. A., Eni, A. O., Tibiri, E. B., Zongo, S., Amoakon, W. J.-L., Tiendrébéogo, F., Pita, J. S., & Norman, P. E. (2025). Identification and Distribution of Begomoviruses Infecting Cassava Fields in Sierra Leone. Plants, 14(14), 2142. https://doi.org/10.3390/plants14142142

