Next Article in Journal
Decreased Photosynthetic Efficiency in Nicotiana tabacum L. under Transient Heat Stress
Next Article in Special Issue
Unveiling Molecular Signatures in Light-Induced Seed Germination: Insights from PIN3, PIN7, and AUX1 in Arabidopsis thaliana
Previous Article in Journal
Network of Soil Fungi and the Microfauna Community under Diverse Anthropic Disturbances under Chrysopogon zizanioides Planting in the Reservoir
Previous Article in Special Issue
The Postharvest Application of Carvone, Abscisic Acid, Gibberellin, and Variable Temperature for Regulating the Dormancy Release and Sprouting Commencement of Mini-Tuber Potato Seeds Produced under Aeroponics
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Effects of Exogenous 2,4-Epibrassinolide on the Germination of Cucumber Seeds under NaHCO3 Stress

1
Yantai Engineering Research Center for Plant Stem Cell Targeted Breeding, Shandong Institute of Sericulture, Yantai 264001, China
2
Stage Key Laboratory of Crop Biology, College of Horticulture Science and Engineering, Shandong Agricultural University, Tai’an 271018, China
*
Authors to whom correspondence should be addressed.
Plants 2024, 13(3), 394; https://doi.org/10.3390/plants13030394
Submission received: 27 December 2023 / Revised: 20 January 2024 / Accepted: 26 January 2024 / Published: 29 January 2024
(This article belongs to the Special Issue Mechanisms of Seed Dormancy and Germination)

Abstract

This investigation focused on the suppressive impact of varying NaHCO3 concentrations on cucumber seed germination and the ameliorative effects of 2,4-Epibrassinolide (EBR). The findings revealed a negative correlation between NaHCO3 concentration and cucumber seed germination, with increased NaHCO3 concentrations leading to a notable decline in germination. Crucially, the application of exogenous EBR significantly counteracted this inhibition, effectively enhancing germination rates and seed vigor. Exogenous EBR was observed to substantially elevate the activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD), thereby mitigating oxidative damage triggered under NaHCO3 stress conditions. Additionally, EBR improved enzyme activity under alkaline stress conditions and reduced starch content in the seeds. Pertinently, EBR upregulated genes that were associated with gibberellin (GA) synthesis (GA20ox and GA3ox), and downregulated genes that were linked to abscisic acid (ABA) synthesis (NCED1 and NCED2). This led to an elevation in GA3 concentration and a reduction in ABA concentration within the cucumber seeds. Therefore, this study elucidates that alleviating oxidative stress, promoting starch catabolism, and regulating the GA and ABA balance are key mechanisms through which exogenous EBR mitigates the suppression of cucumber seed germination resulting from alkaline stress.

1. Introduction

Saline-alkali stress profoundly affects essential plant processes, including germination, growth, and photosynthesis, thereby posing challenges to sustainable horticultural practices [1,2]. This stress can be classified into two distinct classifications: salt stress, attributable to neutral salts, and alkali stress, caused by alkaline salts [3]. Both types instigate ionic toxicity and osmotic imbalances, culminating in oxidative stress. Of particular note, the heightened pH associated with alkali stress renders it more injurious to plants than salt stress [1,4,5]. Such stress promotes reactive oxygen species (ROS) accumulation, engendering oxidative harm. This not only disrupts the internal hormonal balance but also diminishes enzymatic activity, further suppressing plant growth [1,6,7]. While extensive research has elucidated mechanisms underpinning plant salt tolerance, our understanding of plant adaptations to alkali stress remains comparatively nascent [5].
During the initiation of germination, the seed’s embryo transitions from a quiescent state to heightened physiological activity. This metamorphosis begins with suckering and culminates as the radicle penetrates the seed coat, prompting the elongation of the radicle and the embryonic axis [8]. Seed germination, the pivotal onset in the life cycle of a plant, plays a determinative role in influencing subsequent phases of growth, maturation, and overall plant development [9,10]. Given the inherent immobility of plants, the strategic oscillation between dormancy and germination becomes imperative for their evolutionary continuity and reproductive process [10,11,12]. In an agronomic context, the precision and robustness of seed germination bear directly upon the quality of the seedlings and the eventual crop yield. The germination process can be segmented into suckering, activation, and emergence [9,11,13]. Following water uptake, the seeds undergo volumetric expansion, triggering a series of metabolic enzyme activations. This process is accompanied by significant changes in the internal hormonal balance, notably a surge in gibberellin (GA) synthesis and a marked reduction in abscisic acid (ABA) levels. These molecular alterations effectively terminate dormancy, enabling the embryonic axis and roots to penetrate their surrounding tissues, culminating in the completion of germination [11,13,14,15]. This complex orchestration involves an array of physiological and biochemical operations, including the catabolism of organic substrates, the genesis and modification of RNA and proteins, hormone synthesis, and overarching metabolic realignments [11,14,16].
Brassinosteroids (BRs), often designated as “the sixth plant hormone”, are a collection of approximately 40 steroid hormones that are ubiquitous in plants [17]. They have a crucial function in enhancing a plant’s resilience against an extensive array of both biotic and abiotic stress factors, encompassing various environmental and biological challenges. Central to numerous physiological processes, BRs are integral for seed germination, cell elongation, cotyledon expansion, dark morphogenesis, and ethylene production initiation [17,18]. Plant adaptability to various biotic and abiotic stressors is a critical area of horticultural research. The germination phase is especially vulnerable to environmental stressors such as salinity, drought, heavy metals, and extreme temperatures. Accumulating evidence has highlighted the instrumental role of BRs in counteracting these challenges [12]. Specifically, under saline conditions, BRs have been empirically demonstrated to ameliorate membrane damage, reduce seed deterioration, and enhance the intrinsic salt tolerance in non-halophytic plants [19,20]. Brassinosteroids (BRs) play a crucial part in the process of seed germination. While they are essential for standard germination, the Arabidopsis mutants det2-1 (involved in BR biosynthesis) and bri1-1 (BR-insensitive) show increased susceptibility to ABA-mediated inhibition compared to the wild-type counterparts. Notably, exogenous BRs facilitate germination in both gibberellin (GA) synthesis mutants and GA-insensitive mutants [12].
As a globally cultivated crop, cucumber is notably susceptible to salinity stress, whether grown in open fields or greenhouses [1,21]. This susceptibility intensifies when coupled with soil crusting, elevating the risk of pathogenic attacks on seeds and seedlings [5,22,23]. Alkaline stress, distinguished by its high pH, poses a distinct challenge, exerting more pronounced inhibitory effects on plant growth and germination than neutral salts [24,25,26]. Our research examines the role of externally applied 2,4-Epibrassinolide (EBR) in counteracting the detrimental effects of alkalinity on cucumber seed germination, shedding light on its remedial properties and the integral physiological processes involved. Our research seeks to establish a foundational understanding that supports the strategic application of EBR in confronting alkaline stress challenges in cucumber cultivation.

2. Results

The germination rate is an essential measure of seed vigor and is vital in the germination process. Typically, cucumber seeds exhibit a 95% germination rate within 24 h. However, the addition of external NaHCO3 notably suppressed this rate, with the inhibition intensifying as NaHCO3 concentrations increased. Figure 1 illustrates these effects. At a concentration of 200 mmol L−1 NaHCO3, the germination rate drastically dropped to 30% after 24 h and 42% after 36 h. For the purpose of this study, a NaHCO3 concentration of 75 mmol L−1 was selected, at which the germination rate was approximately 30% at 24 h and 42% at 36 h.
Figure 2 underscores the significant effect of exogenous EBR on the germination rate and percentage of cucumber seedlings under NaHCO3 stress (p < 0.05). After 20 h of treatment, the germination rate was recorded at 63%, which increased to 77.67% following the addition of EBR. After 36 h, EBR application led to a notable 46.67% increase in the fresh weight of stressed seeds (p < 0.05), significantly enhancing radicle elongation. TTC staining indicated limited and pale staining in seeds under NaHCO3 stress, while the inclusion of EBR resulted in a marked increase in stained seeds with deeper coloration.
Figure 3 distinctly shows that NaHCO3 stress induced a significant rise in the levels of H2O2, O2 generation rate, and MDA content in cucumber seeds, illustrating a marked increase in oxidative stress compared to the control group (p < 0.05). Importantly, the introduction of exogenous EBR markedly mitigated these stress indicators, demonstrating a significant reduction in the concentrations of ROS and malondialdehyde (MDA) in seeds exposed to NaHCO3 (p < 0.05). This highlights the pivotal role of EBR in reducing the oxidative harm resulting from alkaline stress.
Moreover, the application of NaHCO3 during germination notably diminished the activities of crucial antioxidant enzymes, including superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), when contrasted with the control group (Figure 4). The addition of exogenous EBR, however, not only counteracted this decline but also notably enhanced the activities of these enzymes under NaHCO3 conditions. These observations indicate exogenous EBR strengthens the antioxidative defense mechanism in cucumber seeds, promoting ROS scavenging during germination in alkaline conditions.
Figure 5 reveals crucial observations regarding the regulatory impact of exogenous EBR upon antioxidative gene activity within cucumber seeds exposed to NaHCO3. Exogenous EBR significantly increased the activity of genes such as Cu-Zn SOD, CAT, and POD under NaHCO3 stress conditions. This upregulation was consistently observed for POD and Cu-Zn SOD genes throughout the experimental period. In particular, the elevation in the expression of the CAT gene was predominantly significant between 12 and 24 h after initiating NaHCO3 treatment. These findings highlight the specific role of EBR in upregulating crucial antioxidative genes, thereby potentially mitigating the oxidative stress effects induced by NaHCO3 in cucumber seed germination.
Figure 6 offers a comprehensive profile of amylase activity in cucumber seeds during germination. Initially, there was a spike in α-amylase activity, which then decreased, juxtaposing the consistent rise in total activities of amylase and β-amylase. Alongside this, a steady decline in the content of starch was observed. Under the NaHCO3 condition, amylase activity was significantly reduced, while starch content increased compared to the control. The introduction of exogenous EBR, however, led to an elevation in α-amylase activity and a reduction in starch content under alkali stress. In the initial 12 h period of NaHCO3 treatment, the influence of EBR on β-amylase and total amylase activities was minimal. After this period, EBR substantially augmented both activities. These observations suggest that EBR effectively counters the challenges to cucumber seed germination induced by alkali stress, primarily via increasing the activity of amylase and aiding in the breakdown of starch.
Figure 7 presents the fluctuating expression pattern of the AMY (amylase) gene in cucumber seeds during germination, characterized by an initial surge followed by a subsequent decrease. In contrast, the expression of BMY (beta-amylase) genes consistently increased. Exposure to NaHCO3 suppressed the activity of both AMY and BMY genes, with this effect being most pronounced within the first 24 h of germination.
Upon the application of exogenous EBR, there was an observed increase in the expression levels of both AMY and BMY genes in cucumber seeds under NaHCO3 stress. While EBR did not completely negate the suppressive effect of NaHCO3 on these genes, it played a significant role in mitigating their reduced expression. The influence of EBR on the AMY gene was particularly notable during the first 24 h of germination, whereas its effect on BMY gene expression extended throughout the 36 h period of the experiment. This indicates that EBR, while not fully reversing the NaHCO3-induced inhibition, contributes to a partial recovery of the expression of these key genes of amylolytic under alkaline stress.
Figure 8 demonstrates that NaHCO3 application reduced the accumulation of ABA and GA3 in cucumber seeds while simultaneously increasing the ABA/GA3 ratio. Conversely, the application of external EBR decreased ABA levels and the ABA/GA3 ratio in stressed seeds, concurrently elevating GA3 levels.
Figure 9 reveals that NaHCO3 treatment upregulated the expression of ABA synthesis-related genes NCED1 and NCED2 and downregulated the ABA catabolism gene CYP707A1 (p < 0.05), with minimal impact on CYP707A2. The application of exogenous EBR notably decreased the expression of NCED1 and NCED2, indicating its role in suppressing ABA production and promoting ABA breakdown under NaHCO3 stress. This modulation in gene expression is instrumental in reducing ABA synthesis and enhancing its degradation, thereby reducing the suppressive impact of ABA during seed germination. Moreover, alkali stress suppressed the expression of GA3ox and GA20ox genes in cucumber seeds. However, the addition of exogenous EBR stimulated the expression of GA3ox and GA20ox genes, suggesting that EBR enhances the production of active GA via catalytic synthesis under alkali stress.

3. Discussion

Brassinosteroids (BRs), characterized as polyhydroxylated steroidal phytohormones, have gained recognition for their pivotal roles in modulating plant developmental trajectories, encompassing stages from flowering to germination, and extending their influence to optimize crop yields. Similarly, BRs, owing to their multifaceted attributes, occupy a central position in plant hormonal regulation. The adaptive machinery of plants is frequently engaged when confronted with an array of environmental stressors: extreme temperature deviations, elevated salinity, water scarcity, mechanical injury, fungal assaults, and challenges associated with metal toxicity. Such adversities instigate a cascade of phytohormonal responses, enabling plants to negotiate both abiotic and biotic impediments. Significant results of these stressors are the intensified production of ROS, encompassing superoxide ions and peroxides. Such unchecked ROS can jeopardize cellular integrity and functionality. Strategically timed exogenous applications of BRs can augment the inherent defense mechanisms of plants, offering them a bulwark against the oxidative repercussions of stress. In the face of environmentally inimical conditions, BRs fortify the plant’s capabilities by amplifying carbon dioxide assimilation, invigorating chlorophyll synthesis, and accentuating the reserves of key antioxidants like ascorbic acid, carotenoids, and proline. Transcending their role as mere stress mitigators, BRs also orchestrate vital growth processes, thereby catalyzing seed germination and ensuring the timely maturation of fruits [27].
Seed vigor and the germination rate stand as paramount indices when evaluating the germinative attributes of seeds, capturing nuances of both the tempo and homogeneity of germination, complemented by the latent vigor of ensuing seedlings [28]. Existing studies clearly demonstrate that the impact of alkaline salt stress surpasses that of neutral salts in hindering the germination processes of oilseed rape (Brassica napus L.) and Chenopodium glaucum [28,29]. Amplifying this, elevated salt concentrations discernibly attenuate the germination characteristics and vegetative propagation of hemp (Cannabis sativa), with the repercussions being more pronounced from alkaline salts compared to neutral variants [30]. In congruence with these insights, our present research documented a curtailment in cucumber seed germination in tandem with augmented alkali concentrations (Figure 1). This observation resonates with antecedent studies spotlighting the inverse dynamics between Cannabis sativa seed germination and escalating alkali salinity.
Recent studies highlight a notable increase in maize (Zea mays L.) germination under salt-induced stress, particularly following BR seed pretreatment [31]. Our research supports these observations. We demonstrate that exogenous EBR effectively mitigates the negative effects of NaHCO3 stress on cucumber seed germination. The resultant amplified germination rates and vigor of seeds parallel earlier investigations on BRs modulatory effects in rice (Oryza sativa L.) [32] as well as maize (Zea mays L.) [31]. Furthermore, these compounds have been identified to counter salt and drought stress in both barley (Hordeum vulgare L.) [32] and cucumber (Cucumis sativus L.) [33] samples. Complementing this, studies have pinpointed the role of BRs in attenuating seed germination setbacks instigated by salt stress, suggesting a potential interaction with the ethylene synthesis pathway [33].
According to reports, BR supplementation counteracts the negative consequences of water stress during the germination process of radish (Raphanus sativus) seeds [34]. Harmonizing with outcomes from salt-stressed quinoa (Chenopodium quinoa) seeds [35]. Within our experimental confines, the repercussions of NaHCO3 stress were evident in the slowed germination rates and curtailed seed hydration, manifesting as reduced fresh weights relative to controls. However, the integration of exogenous EBR effectively countered these effects, enhancing cucumber seed weight and fostering embryonic axis elongation, as illustrated in Figure 2. Such transformations likely originate from BRs’ regulatory interplay with cellular division and MDP40 phosphorylation, influencing microtubule configurations [36].
Salinity stress disrupts cell membrane function and triggers an upsurge in ROS accumulation [1]. Our study revealed that exposure to NaHCO3 stress provoked a marked increase in ROS, resulting in oxidative damage accompanied by a spike in MDA concentrations within cucumber seeds. Impressively, the introduction of exogenous EBR counteracted these effects, markedly reducing ROS and MDA levels. This suggests that EBR not only alleviates the oxidative damages induced by alkali stress but also reinforces the cell membrane’s stability. Advanced plants employ sophisticated antioxidant systems as defense mechanisms against oxidative threats [37]. Central to these systems are vital antioxidant molecules, such as AsA and GSH, reinforced by the collective actions of enzymes like SOD, POD, and CAT, known for their antioxidant properties [38]. Previous literature has highlighted EBR’s capacity to modulate these antioxidant systems, efficiently neutralizing excessive reactive oxygen species during stress and thereby bolstering plant resilience [39,40,41,42]. Echoing these findings, our experiments demonstrated that EBR application under NaHCO3 stress conditions amplified the key antioxidant enzyme activities of cucumber seeds while concomitantly suppressing ROS and MDA levels. Germination relies heavily on amylases that metabolize stored starch in plant seeds into simpler sugars, which then fuel vital physiological processes [14,43,44]. This enzymatic conversion of starch is crucial for effective seed germination [44]. Amylase, ubiquitous in plants, efficiently hydrolyzes starch by cleaving its glycosidic linkages, yielding simpler sugars [45,46]. Its activity peaks in germinating seeds where α-amylase predominates, spearheading starch decomposition. This enzymatic intervention releases reducing sugars, primarily maltose and dextrin. Subsequently, α-amylase further processes maltose and catalyzes dextrin saccharification. It is noteworthy that stressful environmental factors can suppress amylase activity in germinating cucumber seeds [47]. Contrastingly, exogenous BRs have been documented to invigorate α-amylase activity even amidst such adversities [31,48,49]. BRs’ seed priming significantly enhanced maize (Zea mays L.) germination metrics and α-amylase activity in salt-stressed soil, increasing cumulative germination; conversely, it reduced germination time, days to 50% emergence [32]. In our investigations, we discerned that NaHCO3-induced stress diminished amylase functionality in cucumber seeds. This hindered the starch conversion in cotyledons, jeopardizing normal germination. Intriguingly, when augmented with exogenous EBR, the seeds exhibited rejuvenated amylase activity despite the NaHCO3 stress, fostering starch metabolism during germination. This observed resurgence could be ascribed to EBR’s potency in bolstering the antioxidant defenses of cucumber seeds, mitigating oxidative perturbations, and fostering an amenable physiological ambiance for amylase.
Abscisic acid (ABA) and gibberellic acid (GA) are fundamental hormones directing seed germination. Their dynamic interplay is pivotal in the germination continuum, with the equilibrium between their synthesis and degradation being especially influential [50,51,52]. As seeds initiate germination, ABA concentrations decline while GA levels ascend, leading to the cessation of dormancy and the commencement of germination [50,52,53]. Notably, alkaline stress can obstruct ABA degradation, thereby thwarting germination. The recent literature underscores the capacity of brassinosteroids (BRs) to counterbalance the repressive effects of ABA on germination. Furthermore, an intact BR signaling pathway appears indispensable for negating ABA-mediated germination restraint [12]. In our study, the application of 24-epibrassinolide (EBR) resulted in the downregulation of ABA synthesis genes, namely NCED1 and NCED2, but simultaneously upregulated the transcription of genes central to ABA breakdown, CYP707A1 and CYP707A2. This dual mechanism curbed ABA synthesis, accelerated its breakdown, and thus attenuated its overall concentration, providing a respite from the germination constraints of alkaline stress. It is worth noting that EBR’s modulation of the CYP707A2 gene—crucial for ABA metabolism—was particularly pronounced [54,55]. In the realm of plant developmental biology, BRs and GA share overlapping regulatory functions. Genetic mutants with disrupted BR or GA pathways or heightened sensitivity thereto consistently manifest a suite of characteristics, including compromised germination, stunted growth, and deferred flowering [12,56,57]. In our experiments, we discerned that EBR heightened the transcriptional activity of primary GA biosynthetic genes GA20ox and GA3ox under alkaline duress. This action bolstered GA synthesis in cucumber seeds, fortifying their germinative potential. Given that BR administration is known to induce an upsurge in hydrogen peroxide (H2O2) concentrations and considering H2O2’s role in facilitating ABA metabolism and GA synthesis [58], this might offer a mechanistic insight into EBR’s germination-enhancing properties under alkaline conditions.

4. Materials and Methods

4.1. Experimental Materials and Design

This study employed “JinYan 4” (Cucumis sativus L.) as the cucumber variety for experimentation. The experimental trials were conducted at Shandong Agricultural University, Tai’an, China. 24-Epibrassinolide (EBR) was procured from Sigma-Aldrich, Burlington, VT, USA.
Adopting the approach by Božena ŠERÁ [59], our study involved a specific pretreatment of cucumber seeds. These seeds were first immersed in solutions with varying concentrations of EBR (24-epibrassinolide), as well as a control group in distilled water, maintaining a consistent temperature of 28 °C for 12 h. After immersion, the seeds underwent a sterilization process, exposed to a 0.5% (v/v) sodium hypochlorite solution for 10 min. This was followed by a series of five extensive rinses with distilled water to eliminate any residual sterilizing agent. Subsequently, the seeds were carefully placed in Petri dishes, each lined with three layers of filter paper to promote uniform conditions for germination. We introduced 10 mL of the respective treatment solution into each dish, ensuring a consistently moist environment for the duration of the experiment. The experimental design included three replicates for each treatment, with each replicate comprising 200 seeds. Germination was carried out in a dark environment at a stable temperature of 28 °C. Critical measures such as germination rates and various physiological indices were systematically recorded at set intervals after the treatment, aiming to evaluate the influence of different EBR concentrations on seed germination.
To assess the impacts of varying degrees of alkali stress, a comprehensive screening experiment was designed involving seven distinct concentrations of sodium bicarbonate (NaHCO3). The groups subjected to treatment included (1) 0 mmol L−1 NaHCO3 (control with distilled water), (2) 25 mmol L−1 NaHCO3, (3) 50 mmol L−1 NaHCO3, (4) 75 mmol L−1 NaHCO3, (5) 100 mmol L−1 NaHCO3, (6) 150 mmol L−1 NaHCO3, and (7) 200 mmol L−1 NaHCO3.
In subsequent experiments, we assessed the efficacy of exogenous 2,4-epibrassinolide (EBR) in alleviating the repressive influence of alkaline stress on the germination of cucumber seeds. This experiment encompassed three distinct treatments: (1) CK (control, distilled water), (2) S (75 mmol L−1 NaHCO3), and (3) S + EBR (0.2 μmol L−1 EBR with 75 mmol L−1 NaHCO3). Seed pretreatment involved immersion in either distilled water or a 0.2 μmol L−1 EBR solution for 12 h.

4.2. Determination of Seed Germination Rate and Fresh Weight

To accurately assess the efficacy of the different treatments, the seed germination rate was systematically documented at predefined intervals post-treatment, specifically at 0, 12, 16, 20, 24, and 36 h. In this analysis, the emergence of the radicle from the seed coat was employed as the definitive criterion for germination. This methodology facilitated an in-depth examination of both the germination timeline and the corresponding responses to the treatments. Additionally, the fresh weight of the seeds, which had successfully germinated, was quantitatively measured at the 36 h mark only.
For the calculation of germination percentages, we adhered to the method proposed by Božena ŠERÁ [59]: Germination (%) = [100 × (number of germinated seeds/total number of seeds)]. This approach provided a standardized measure for comparing germination across different treatments.

4.3. Assessment of Seed Viability

The viability of the seeds was ascertained by employing the 2,3,5-triphenyltetrazolium chloride (TTC) staining technique, a technique well documented in previous research [60,61]. After a 36 h treatment, the seeds were carefully extracted and bisected along the embryonic axis. The radicle was removed, and the halves were then submerged in a 0.1% (w/v) TTC solution. Subsequently, the seeds underwent a one-hour incubation period at ambient temperature. Post-incubation, a series of three thorough water rinses were applied to the seeds. The staining results were visually evaluated and documented photographically. Each treatment was replicated thrice, with each replicate comprising 20 germinated seeds.

4.4. Determination of Reactive Oxygen Species (ROS) Levels and MDA Contents

The O2·− production rate was determined following Xia’s method [62]. Fresh seeds (1 g) underwent homogenization in a phosphate-buffered solution (pH 7.8), followed by centrifugation at 4000× g for a quarter-hour, subsequently reacting with hydroxylamine. After incubation, α-naphthylamine solution and p-aminobenzene sulfonic acid were added to the reaction mixture, followed by further incubation. The measurement of absorbance at 530 nm facilitated the calculation of the quantification of H2O2 levels in a NaNO2 standard curve. The quantification of H2O2 levels was assessed using Gong’s method [4], which involved the quantification of absorbance for the titanium peroxide complex at 415 nm.
The content of malondialdehyde (MDA) is indicative of lipid peroxidation measured according to the protocol of Hodges et al. [63]. Fresh seed tissue (1 g) was homogenized in a 10% (v/v) trichloroacetic acid (TCA) solution. Subsequently, the homogenate underwent centrifugation at 4000× g for a duration of 10 min. Following this, the supernatant was combined with 0.6% thiobarbituric acid (TBA) and heated in a boiling water bath for 15 min. Following cooling, it was centrifuged again. The absorbance levels of the resulting supernatant were quantified at 532 nm, 600 nm, and 450 nm for the assessment of MDA content, subsequently calculated using a standard linear equation.

4.5. Determination of Antioxidant Enzyme Activity

The quantification of antioxidant enzyme SOD, POD, and CAT activities was conducted following the protocol described by Shalata et al. [64]. Fresh samples of germinating cucumber seeds weighing 0.3 g were homogenized in 3 mL of 50 mM phosphate-buffered saline (PBS) buffer (pH 7.8) containing 2 mM ascorbate, 0.2 mM EDTA, and 2% polyvinylpyrrolidone. The homogenate was then centrifuged at 4 °C and 12,000× g for 20 min, with the supernatant used for enzyme activity assays. SOD activity was indicative of its capacity to obstruct the photochemical reduction of nitroblue tetrazolium (NBT). The measurement was taken at 560 nm following the protocol described by Gong et al. [4]. In this context, a 50% decrease in NBT photoreduction was considered equivalent to one unit of enzymatic activity”. The activity of POD was ascertained by recording the increase in absorbance at 470 nm, indicative of guaiacol oxidation, following Shalata et al.’s methodology [64]. CAT activity was quantified by monitoring the reduction in absorbance noted at 240 nm, correlating with the degradation of hydrogen peroxide (H2O2), according to the approach of Shalata et al. [64].

4.6. Determination of Abscisic Acid (ABA) and Gibberellin (GA3) Content

Following the methodology outlined by Chen and colleagues [65], we accurately measured the levels of ABA and GA3 at different stages of germination in cucumber seeds using ELISA (enzyme-linked immunosorbent assay). Utilizing mlbio’s Plant ABA ELISA KIT and Plant GA ELISA KIT, hormone levels were assessed at critical post-treatment intervals of 16 and 36 h. This was carried out across three independent biological replicates to ensure the reliability of the data.
Initially, each batch of cucumber seeds, weighing 0.3 g, was swiftly frozen using liquid nitrogen, followed by blending with 2 mL of the extraction buffer supplied in the kit. The samples, kept in an ice-cold environment, were homogenized and subsequently transferred into 10 mL centrifuge tubes. For thorough sample transfer, the mortar received an extra 2 mL of extraction solution rinse, with these washings then being amalgamated with the tube-contained homogenate, succeeded by intense shaking. The mixture was chilled at 4 °C for a duration of 4 h to allow phase separation and subsequently subjected to centrifugation at a force of 1000× g for a quarter of an hour. The upper liquid layer was then cautiously extracted, and a volume of 1 mL was fused back with the sediment, agitated rigorously, and exposed to additional extraction at a temperature of 4 °C across 60 min. After another round of centrifugation for 15 min, the combined supernatant was measured for its total volume. Purification of the extract was conducted utilizing a cartridge of Agilent Bond Elut C18 for Solid Phase Extraction (SPE). Subsequently, the purified eluent was relocated into a centrifuge tube of 5 mL and concentrated by applying a vacuum or inducing evaporation of methanol via nitrogen gas. Once concentrated, the sample was diluted to a specified volume according to the kit’s instructions. For the final assay, the prepared samples were incubated with specific antibodies, and absorbance was quantitatively determined at 492 nm using an enzyme marker (Thermo Multiskan FC, Thermo Fisher Scientific, Waltham, MA, USA). This comprehensive procedure enabled the accurate measurement of ABA and GA concentrations.

4.7. Determination of Amylase Activity and Starch Content

Determination of Starch content: In accordance with the esteemed methodology delineated by Allfrey and Northcote [66], the quantification of starch content was meticulously executed. The experimental protocol commenced with the meticulous homogenization of 36 cotyledon pairs or axes in a 16 mL aliquot of 80% (v/v) ethanol, employing an ice-cold mortar and pestle to ensure optimal conditions. This was followed by a centrifugation step, exerting a force of 30,000× g for 10 min at a controlled temperature of 2 °C to effectively separate the components. Subsequent to this, 6 mL of 30% (v/v) perchloric acid (HClO4) was judiciously added to the homogenate, facilitating the dissolution of starch within the granules. The solution was then allowed to equilibrate at ambient temperature for a duration of 6 h, setting the stage for the starch assay. For the quantification, a bespoke I2-KI reagent was prepared, entailing the dilution of 0.1 mL of a concentrated stock solution (comprising 0.06 g I2 and 0.60 g KI in 10 mL deionized water) with 0.05 M HCl, tailored specifically for this analysis. A volume of 0.5 mL from the starch solution was meticulously mixed with an equal volume of the I2-KI reagent, followed by the addition of 1 mL of 30% (v/v) perchloric acid. The resultant mixture was vortexed and allowed to stabilize at room temperature. The critical assessment of starch concentration was conducted by measuring the absorbance at 620 nm, correlating it with a meticulously established standard curve ranging from 0 to 5 mg/mL, using the identical I2-KI reagent derived from starch solubilized in 30% HClO4. Rigor was maintained by repeating the analysis for each sample in triplicate, ensuring the reliability and precision of the data obtained.
Determination of Amylase activity: The extraction of total amylase followed the method outlined by Li and colleagues [67]. In conditions of 4 °C, 0.3 g of freshly germinated cucumber seed samples underwent homogenization in 2 mL of acetate buffer (0.05 M, pH 6.0) utilizing a pestle. The homogenate obtained was first passed through cheesecloth, subsequently centrifuged at 18,000× g for 10 min, and then subjected to filtration. The protocol for α-amylase preparation was largely akin to that for total amylase extraction, except it involved an additional step of heating at 70 ± 0.5 °C for a duration of 15 min subsequent to filtration. For conducting amylase assays, the employed substrate comprised a 1% soluble starch solution in 0.1 mol L−1 acetate buffer, maintaining a pH of 5.6. The enzyme solution prepared was initially diluted to a volume of 1 mL using water, which was then supplemented with 1 mL of starch solution. This mixture was incubated at a constant temperature of 25 °C for one hour. Following incubation, 2 mL of 3,5-dinitrosalicylic acid reagent was introduced into the mixture. The tubes containing this reaction mixture were then heated in a boiling water bath for 5 min. Post-heating, the tubes were allowed to return to room temperature and were further diluted with 20 mL of water. The intensity of the colored solutions was quantified using a spectrophotometer. The intensity of the colored solutions was quantified using a spectrophotometer. β-amylase was calculated from the difference between α-amylase and the total contents of amylase.

4.8. Gene Expression Analysis

The isolation of total RNA from these seeds using an RNA extraction kit from Invitrogen using the TRIzol method. Assessments of RNA quality and quantity were carried out via 1% agarose gel electrophoresis, complemented by measurements using a NanoDrop Photometer spectrophotometer (IM-PLEN, Westlake Village, CA, USA). This process preceded the reverse transcription of the isolated RNA into cDNA, utilizing the Super-Script™ First-Strand Synthesis System for RT-PCR kit (18091050; Invitrogen, Waltham, MA, USA). Subsequently, the cDNA underwent qRT-PCR (quantitative real-time PCR), with primer sequences meticulously designed as delineated in Table 1. Actin served as an internal control. Primer designs for qRT-PCR were facilitated using Primer Premier 5 software (Biosoft International, Palo Alto, CA, USA). The qRT-PCR experiments utilized the ABI Prism 7900 HT system (Applied Biosystems, Waltham, MA, USA). The ascertainment of relative gene expression levels was achieved via the 2−ΔΔCT method, with analysis conducted using the 7500 software v2.0.6 (Applied Biosystems).

4.9. Data Processing

In this research, a fully randomized experimental design was implemented, with each treatment group undergoing three sets of replications. We represented the data as mean values accompanied by the standard error. For identifying significant variances among the means, Duncan’s New Multiple Range Test, as facilitated by SPSS software version 22.0, was employed. Statistical significance was inferred when the p-value was lower than 0.05. Additionally, for further data analysis and chart creation, Excel 2010 was utilized.

5. Conclusions

The application of exogenous EBR effectively countered the negative impact of alkaline stress on cucumber seed germination. This positive outcome is attributed to EBR’s regulatory influence on the antioxidant defense system, its modulation of phytohormonal dynamics, and its governance over amylase activity. Given the multifaceted physiological process of seed germination, it is imperative to delve deeper into the nuanced regulatory roles of EBR, especially in the context of alkaline stress on cucumber seed germination (Figure 10).

Author Contributions

Conceptualization, Q.S. and W.N.; validation, B.G. (Biao Gong), W.N., B.G. (Bing Geng) and P.Q.; formal analysis, W.N. and D.W.; investigation, W.N. and D.W.; data curation, W.N. and D.W.; writing—original draft preparation, W.N.; writing—review and editing, Q.S. and H.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Shandong Province Key R&D Program (2022CXGC020708 and 2022CXGC010610); the Special Funds for the Central Government to Guide Local Scientific and Technological Development (YCZX2021073); the Agricultural Scientific and Technological Innovation Project of Shandong Academy of Agricultural Sciences (CXGC2023G07, CXGC2023A42 and CXGC2023A16); the Shandong Province “Bohai Grain Silo” Science and Technology Demonstration Project (2019BHLC005); and the Yantai Science and Technology Program (2022XCZX087).

Data Availability Statement

The study’s data can be obtained by contacting the corresponding author upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Nie, W.; Gong, B.; Chen, Y.; Wang, J.; Wei, M.; Shi, Q. Photosynthetic capacity, ion homeostasis and reactive oxygen metabolism were involved in exogenous salicylic acid increasing cucumber seedlings tolerance to alkaline stress. Sci. Hortic. 2018, 235, 413–423. [Google Scholar] [CrossRef]
  2. Liu, N.; Gong, B.; Jin, Z.; Wang, X.; Wei, M.; Yang, F.; Li, Y.; Shi, Q. Sodic alkaline stress mitigation by exogenous melatonin in tomato needs nitric oxide as a downstream signal. J. Plant Physiol. 2015, 186, 68–77. [Google Scholar] [CrossRef] [PubMed]
  3. Wei, L.-X.; Lv, B.-S.; Wang, M.-M.; Ma, H.-Y.; Yang, H.-Y.; Liu, X.-L.; Jiang, C.-J.; Liang, Z.-W. Priming effect of abscisic acid on alkaline stress tolerance in rice (Oryza sativa L.) seedlings. Plant Physiol. Biochem. 2015, 90, 50–57. [Google Scholar] [CrossRef] [PubMed]
  4. Gong, B.; Miao, L.; Kong, W.; Bai, J.-G.; Wang, X.; Wei, M.; Shi, Q. Nitric oxide, as a downstream signal, plays a vital role in auxin-induced cucumber tolerance to sodic alkaline stress. Plant Physiol. Biochem. 2014, 83, 258–266. [Google Scholar] [CrossRef] [PubMed]
  5. Fang, S.; Hou, X.; Liang, X. Response mechanisms of plants under saline-alkali stress. Front. Plant Sci. 2021, 12, 667458. [Google Scholar] [CrossRef] [PubMed]
  6. Abdel Latef, A.A.; Tran, L.-S.P. Impacts of priming with silicon on the growth and tolerance of maize plants to alkaline stress. Front. Plant Sci. 2016, 7, 243. [Google Scholar] [CrossRef] [PubMed]
  7. Zhang, Y.; Zhang, H.; Zou, Z.-R.; Liu, Y.; Hu, X.-H. Deciphering the protective role of spermidine against saline–alkaline stress at physiological and proteomic levels in tomato. Phytochemistry 2015, 110, 13–21. [Google Scholar] [CrossRef] [PubMed]
  8. Bewley, J.D. Seed germination and dormancy. Plant Cell 1997, 9, 1055. [Google Scholar] [CrossRef]
  9. Carrera-Castaño, G.; Calleja-Cabrera, J.; Pernas, M.; Gómez, L.; Oñate-Sánchez, L. An updated overview on the regulation of seed germination. Plants 2020, 9, 703. [Google Scholar] [CrossRef]
  10. Reed, R.C.; Bradford, K.J.; Khanday, I. Seed germination and vigor: Ensuring crop sustainability in a changing climate. Heredity 2022, 128, 450–459. [Google Scholar] [CrossRef]
  11. Tuan, P.A.; Sun, M.; Nguyen, T.-N.; Park, S.; Ayele, B.T. Molecular mechanisms of seed germination. In Sprouted Grains; Elsevier: Amsterdam, The Netherlands, 2019; pp. 1–24. [Google Scholar] [CrossRef]
  12. Steber, C.M.; McCourt, P. A role for brassinosteroids in germination in Arabidopsis. Plant Physiol. 2001, 125, 763–769. [Google Scholar] [CrossRef]
  13. Urbanova, T.; Leubner-Metzger, G. Gibberellins and seed germination. Ann. Plant Rev. 2016, 49, 253–284. [Google Scholar] [CrossRef]
  14. Han, C.; Yang, P. Studies on the molecular mechanisms of seed germination. Proteomics 2015, 15, 1671–1679. [Google Scholar] [CrossRef] [PubMed]
  15. Farooq, M.A.; Ma, W.; Shen, S.; Gu, A. Underlying biochemical and molecular mechanisms for seed germination. Int. J. Mol. Sci. 2022, 23, 8502. [Google Scholar] [CrossRef] [PubMed]
  16. Nonogaki, H. Seed germination—The biochemical and molecular mechanisms. Breed. Sci. 2006, 56, 93–105. [Google Scholar] [CrossRef]
  17. Kim, E.-J.; Russinova, E. Brassinosteroid signalling. Curr. Biol. 2020, 30, R294–R298. [Google Scholar] [CrossRef] [PubMed]
  18. Li, J.; Nagpal, P.; Vitart, V.; McMorris, T.C.; Chory, J. A role for brassinosteroids in light-dependent development of Arabidopsis. Science 1996, 272, 398–401. [Google Scholar] [CrossRef] [PubMed]
  19. Planas-Riverola, A.; Gupta, A.; Betegón-Putze, I.; Bosch, N.; Ibañes, M.; Caño-Delgado, A.I. Brassinosteroid signaling in plant development and adaptation to stress. Development 2019, 146, dev151894. [Google Scholar] [CrossRef] [PubMed]
  20. Anwar, A.; Liu, Y.; Dong, R.; Bai, L.; Yu, X.; Li, Y. The physiological and molecular mechanism of brassinosteroid in response to stress: A review. Biol. Res. 2018, 51, 46. [Google Scholar] [CrossRef]
  21. Abdel-Farid, I.B.; Marghany, M.R.; Rowezek, M.M.; Sheded, M.G. Effect of Salinity stress on growth and metabolomic profiling of Cucumis sativus and Solanum lycopersicum. Plants 2020, 9, 1626. [Google Scholar] [CrossRef]
  22. Ondrasek, G.; Rathod, S.; Manohara, K.K.; Gireesh, C.; Anantha, M.S.; Sakhare, A.S.; Parmar, B.; Yadav, B.K.; Bandumula, N.; Raihan, F. Salt stress in plants and mitigation approaches. Plants 2022, 11, 717. [Google Scholar] [CrossRef]
  23. Wei, Y.; Li, L.; Hu, W.; Ju, H.; Zhang, M.; Qin, Q.; Zhang, S.; Li, G. Suppression of rice blast by bacterial strains isolated from cultivated soda saline-sodic soils. Int. J. Environ. Res. Public Health 2020, 17, 5248. [Google Scholar] [CrossRef] [PubMed]
  24. Yang, C.-W.; Xu, H.-H.; Wang, L.-L.; Liu, J.; Shi, D.-C.; Wang, D.-L. Comparative effects of salt-stress and alkali-stress on the growth, photosynthesis, solute accumulation, and ion balance of barley plants. Photosynthetica 2009, 47, 79–86. [Google Scholar] [CrossRef]
  25. Lu, X.; Ma, L.; Zhang, C.; Yan, H.; Bao, J.; Gong, M.; Wang, W.; Li, S.; Ma, S.; Chen, B. Grapevine (Vitis vinifera) responses to salt stress and alkali stress: Transcriptional and metabolic profiling. BMC Plant Biol. 2022, 22, 528. [Google Scholar] [CrossRef] [PubMed]
  26. Wang, H.; Wu, Z.; Chen, Y.; Yang, C.; Shi, D. Effects of salt and alkali stresses on growth and ion balance in rice (Oryza sativa L.). Plant Soil Environ. 2011, 57, 286–294. [Google Scholar] [CrossRef]
  27. Siddiqi, K.S.; Husen, A. Significance of brassinosteroids and their derivatives in the development and protection of plants under abiotic stress. Biologia 2021, 76, 2837–2857. [Google Scholar] [CrossRef]
  28. Wang, W.; Zhang, F.; Sun, L.; Yang, L.; Yang, Y.; Wang, Y.; Siddique, K.H.; Pang, J. Alkaline salt inhibits seed germination and seedling growth of canola more than neutral salt. Front. Plant Sci. 2022, 13, 814755. [Google Scholar] [CrossRef] [PubMed]
  29. Chen, S.; Xing, J.; Lan, H. Comparative effects of neutral salt and alkaline salt stress on seed germination, early seedling growth and physiological response of a halophyte species Chenopodium glaucum. Afr. J. Biotechnol. 2012, 11, 9572–9581. [Google Scholar] [CrossRef]
  30. Hu, H.; Liu, H.; Deng, G.; Xu, Y.; Liu, F. Effects of different salt-alkaline stresses on seed germination and seedling growth of Cannabis sativa. J. Plant Resour. Environ. 2015, 24, 61–68. [Google Scholar]
  31. Alhammad, B.A.; Ahmad, A.; Seleiman, M.F.; Tola, E. Seed priming with nanoparticles and 24-epibrassinolide improved seed germination and enzymatic performance of Zea mays L. in salt-stressed soil. Plants 2023, 12, 690. [Google Scholar] [CrossRef]
  32. Anuradha, S.; Seeta Ram Rao, S. Effect of brassinosteroids on salinity stress induced inhibition of seed germination and seedling growth of rice (Oryza sativa L.). Plant Growth Regul. 2001, 33, 151–153. [Google Scholar] [CrossRef]
  33. Wang, B.; Zhang, J.; Xia, X.; Zhang, W.-H. Ameliorative effect of brassinosteroid and ethylene on germination of cucumber seeds in the presence of sodium chloride. Plant Growth Regul. 2011, 65, 407–413. [Google Scholar] [CrossRef]
  34. Mahesh, K.; Balaraju, P.; Ramakrishna, B.; Rao, S.S.R. Effect of brassinosteroids on germination and seedling growth of radish (Raphanus sativus L.) under PEG-6000 induced water stress. Am. J. Plant Sci. 2013, 9, 40442. [Google Scholar] [CrossRef]
  35. Hajihashemi, S.; Skalicky, M.; Brestic, M.; Pavla, V. Cross-talk between nitric oxide, hydrogen peroxide and calcium in salt-stressed Chenopodium quinoa Willd. at seed germination stage. Plant Physiol. Biochem. 2020, 154, 657–664. [Google Scholar] [CrossRef] [PubMed]
  36. Wang, L.; Hart, B.E.; Khan, G.A.; Cruz, E.R.; Persson, S.; Wallace, I.S. Associations between phytohormones and cellulose biosynthesis in land plants. Ann. Bot. 2020, 126, 807–824. [Google Scholar] [CrossRef] [PubMed]
  37. Sharma, P.; Dubey, R.S. Drought induces oxidative stress and enhances the activities of antioxidant enzymes in growing rice seedlings. Plant Growth Regul. 2005, 46, 209–221. [Google Scholar] [CrossRef]
  38. Li, Y.; Liu, Y.; Zhang, J. Advances in the research on the AsA-GSH cycle in horticultural crops. Front. Agric. China 2010, 4, 84–90. [Google Scholar] [CrossRef]
  39. Wang, Y.-T.; Chen, Z.-Y.; Jiang, Y.; Duan, B.-B.; Xi, Z.-M. Involvement of ABA and antioxidant system in brassinosteroid-induced water stress tolerance of grapevine (Vitis vinifera L.). Sci. Hortic. 2019, 256, 108596. [Google Scholar] [CrossRef]
  40. Kaya, C.; Ashraf, M.; Alyemeni, M.N.; Ahmad, P. The role of nitrate reductase in brassinosteroid-induced endogenous nitric oxide generation to improve cadmium stress tolerance of pepper plants by upregulating the ascorbate-glutathione cycle. Ecotoxicol. Environ. Saf. 2020, 196, 110483. [Google Scholar] [CrossRef]
  41. Ahanger, M.A.; Mir, R.A.; Alyemeni, M.N.; Ahmad, P. Combined effects of brassinosteroid and kinetin mitigates salinity stress in tomato through the modulation of antioxidant and osmolyte metabolism. Plant Physiol. Biochem. 2020, 147, 31–42. [Google Scholar] [CrossRef]
  42. Xia, X.J.; Fang, P.P.; Guo, X.; Qian, X.J.; Zhou, J.; Shi, K.; Zhou, Y.H.; Yu, J.Q. Brassinosteroid-mediated apoplastic H2O2-glutaredoxin 12/14 cascade regulates antioxidant capacity in response to chilling in tomato. Plant Cell Environ. 2018, 41, 1052–1064. [Google Scholar] [CrossRef] [PubMed]
  43. Steup, M. Starch degradation. Biochem. Plants 1988, 14, 255–296. [Google Scholar]
  44. Niittylä, T.; Messerli, G.; Trevisan, M.; Chen, J.; Smith, A.M.; Zeeman, S.C. A previously unknown maltose transporter essential for starch degradation in leaves. Science 2004, 303, 87–89. [Google Scholar] [CrossRef] [PubMed]
  45. Damaris, R.N.; Lin, Z.; Yang, P.; He, D. The rice alpha-amylase, conserved regulator of seed maturation and germination. Int. J. Mol. Sci. 2019, 20, 450. [Google Scholar] [CrossRef]
  46. MacNeill, G.J.; Mehrpouyan, S.; Minow, M.A.; Patterson, J.A.; Tetlow, I.J.; Emes, M.J. Starch as a source, starch as a sink: The bifunctional role of starch in carbon allocation. J. Exp. Bot. 2017, 68, 4433–4453. [Google Scholar] [CrossRef] [PubMed]
  47. Yu, L.-X.; Zhang, C.-J.; Shang, H.-Q.; Wang, X.-F.; Min, W.; Yang, F.-J.; Shi, Q.-H. Exogenous hydrogen sulfide enhanced antioxidant capacity, amylase activities and salt tolerance of cucumber hypocotyls and radicles. J. Integr. Agric. 2013, 12, 445–456. [Google Scholar] [CrossRef]
  48. Xiong, M.; Yu, J.; Wang, J.; Gao, Q.; Huang, L.; Chen, C.; Zhang, C.; Fan, X.; Zhao, D.; Liu, Q.-Q. Brassinosteroids regulate rice seed germination through the BZR1-RAmy3D transcriptional module. Plant Physiol. 2022, 189, 402–418. [Google Scholar] [CrossRef]
  49. Maleki, A.; Fathi, A.; Bahamin, S. The effect of gibberellin hormone on yield, growth indices, and biochemical traits of corn (Zea Mays L.) under drought stress. J. Iran. Plant Ecophysiol. Res. 2020, 15, 1–16. [Google Scholar]
  50. Kaneko, M.; Itoh, H.; Ueguchi-Tanaka, M.; Ashikari, M.; Matsuoka, M. The α-amylase induction in endosperm during rice seed germination is caused by gibberellin synthesized in epithelium. Plant Physiol. 2002, 128, 1264–1270. [Google Scholar] [CrossRef]
  51. Yamaguchi, S.; Kamiya, Y.; Nambara, E. Regulation of ABA and GA levels during seed development and germination in Arabidopsis. Ann. Plant Rev. Seed Dev. Dormancy Germin. 2007, 27, 224–247. [Google Scholar] [CrossRef]
  52. Ali, F.; Qanmber, G.; Li, F.; Wang, Z. Updated role of ABA in seed maturation, dormancy, and germination. J. Adv. Res. 2022, 35, 199–214. [Google Scholar] [CrossRef]
  53. Srivastava, A.K.; Suresh Kumar, J.; Suprasanna, P. Seed ‘primeomics’: Plants memorize their germination under stress. Biol. Rev. 2021, 96, 1723–1743. [Google Scholar] [CrossRef]
  54. Okamoto, M.; Kuwahara, A.; Seo, M.; Kushiro, T.; Asami, T.; Hirai, N.; Kamiya, Y.; Koshiba, T.; Nambara, E. CYP707A1 and CYP707A2, which encode abscisic acid 8′-hydroxylases, are indispensable for proper control of seed dormancy and germination in Arabidopsis. Plant Physiol. 2006, 141, 97–107. [Google Scholar] [CrossRef]
  55. Preston, J.; Tatematsu, K.; Kanno, Y.; Hobo, T.; Kimura, M.; Jikumaru, Y.; Yano, R.; Kamiya, Y.; Nambara, E. Temporal expression patterns of hormone metabolism genes during imbibition of Arabidopsis thaliana seeds: A comparative study on dormant and non-dormant accessions. Plant Cell Physiol. 2009, 50, 1786–1800. [Google Scholar] [CrossRef]
  56. Alabadí, D.; Gil, J.; Blázquez, M.A.; García-Martiínez, J.L. Gibberellins repress photomorphogenesis in darkness. Plant Physiol. 2004, 134, 1050–1057. [Google Scholar] [CrossRef]
  57. Kim, T.-W.; Wang, Z.-Y. Brassinosteroid signal transduction from receptor kinases to transcription factors. Annu. Rev. Plant Biol. 2010, 61, 681–704. [Google Scholar] [CrossRef] [PubMed]
  58. Oracz, K.; Bouteau, H.E.M.; Farrant, J.M.; Cooper, K.; Belghazi, M.; Job, C.; Job, D.; Corbineau, F.; Bailly, C. ROS production and protein oxidation as a novel mechanism for seed dormancy alleviation. Plant J. 2007, 50, 452–465. [Google Scholar] [CrossRef] [PubMed]
  59. Šerá, B. Methodological contribution on seed germination and seedling initial growth tests in wild plants. Not. Bot. Horti Agrobot. 2023, 51, 13164. [Google Scholar] [CrossRef]
  60. Souza, C.R.d.; Ohlson, O.d.C.; Gavazza, M.I.A.; Panobianco, M. Tetrazolium test for evaluating triticale seed viability. Rev. Bras. Sementes 2010, 32, 163–169. [Google Scholar] [CrossRef]
  61. Lopez Del Egido, L.; Navarro-Miró, D.; Martinez-Heredia, V.; Toorop, P.E.; Iannetta, P.P. A spectrophotometric assay for robust viability testing of seed batches using 2,3,5-triphenyl tetrazolium chloride: Using Hordeum vulgare L. as a model. Front. Plant Sci. 2017, 8, 747. [Google Scholar] [CrossRef] [PubMed]
  62. Xia, X.-J.; Wang, Y.-J.; Zhou, Y.-H.; Tao, Y.; Mao, W.-H.; Shi, K.; Asami, T.; Chen, Z.; Yu, J.-Q. Reactive oxygen species are involved in brassinosteroid-induced stress tolerance in cucumber. Plant Physiol. 2009, 150, 801–814. [Google Scholar] [CrossRef]
  63. Hodges, D.M.; DeLong, J.M.; Forney, C.F.; Prange, R.K. Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 1999, 207, 604–611. [Google Scholar] [CrossRef]
  64. Shalata, A.; Mittova, V.; Volokita, M.; Guy, M.; Tal, M. Response of the cultivated tomato and its wild salt-tolerant relative Lycopersicon pennellii to salt-dependent oxidative stress: The root antioxidative system. Physiol. Plant. 2001, 112, 487–494. [Google Scholar] [CrossRef]
  65. Chen, L.; Lu, B.; Liu, L.; Duan, W.; Jiang, D.; Li, J.; Zhang, K.; Sun, H.; Zhang, Y.; Li, C. Melatonin promotes seed germination under salt stress by regulating ABA and GA3 in cotton (Gossypium hirsutum L.). Plant Physiol. Biochem. 2021, 162, 506–516. [Google Scholar] [CrossRef] [PubMed]
  66. Allefrey, J.M.; Northcote, D.H. The effects of the axis and plant hormones on the mobilization of storage materials in the groundnut (Arachis hypogaea) during germination. New Phytol. 1977, 78, 547–563. [Google Scholar] [CrossRef]
  67. Liu, X.; Zhang, S.; Shan, X.; Zhu, Y.-G. Toxicity of arsenate and arsenite on germination, seedling growth and amylolytic activity of wheat. Chemosphere 2005, 61, 293–301. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Effects of NaHCO3 with different concentrations on germination rate of cucumber seeds. Treatments include (1) Control (CK) with distilled water, representing the baseline condition; (2) Stress (S), induced by exposure to 75 mmol L−1 NaHCO3, simulating alkaline stress; and (3) Stress Mitigation with EBR (S + EBR), a combined treatment of 0.2 μmol L−1 EBR and 75 mmol L−1 NaHCO3, demonstrating EBR’s efficacy in stress response modulation. Seeds were pretreated for 12 h in either distilled water or a 0.2 μmol L−1 EBR solution prior to the commencement of germination tests.
Figure 1. Effects of NaHCO3 with different concentrations on germination rate of cucumber seeds. Treatments include (1) Control (CK) with distilled water, representing the baseline condition; (2) Stress (S), induced by exposure to 75 mmol L−1 NaHCO3, simulating alkaline stress; and (3) Stress Mitigation with EBR (S + EBR), a combined treatment of 0.2 μmol L−1 EBR and 75 mmol L−1 NaHCO3, demonstrating EBR’s efficacy in stress response modulation. Seeds were pretreated for 12 h in either distilled water or a 0.2 μmol L−1 EBR solution prior to the commencement of germination tests.
Plants 13 00394 g001
Figure 2. Effects of exogenous EBR on germination rate (A), fresh weight (B), phenotypes (C), and vigor (D) of cucumber seeds under NaHCO3 stress. Treatments include (1) Control (CK) with distilled water, representing the baseline condition; (2) Stress (S), induced by exposure to 75 mmol L−1 NaHCO3, simulating alkaline stress; and (3) Stress Mitigation with EBR (S + EBR), a combined treatment of 0.2 μmol L−1 EBR and 75 mmol L−1 NaHCO3, demonstrating EBR’s efficacy in stress response modulation. Seeds were pretreated for 12 h in either distilled water or a 0.2 μmol L−1 EBR solution prior to the commencement of germination tests. Different letters above bars indicate significance among different treatments as determined using Duncan’s samples comparison test (p < 0.05).
Figure 2. Effects of exogenous EBR on germination rate (A), fresh weight (B), phenotypes (C), and vigor (D) of cucumber seeds under NaHCO3 stress. Treatments include (1) Control (CK) with distilled water, representing the baseline condition; (2) Stress (S), induced by exposure to 75 mmol L−1 NaHCO3, simulating alkaline stress; and (3) Stress Mitigation with EBR (S + EBR), a combined treatment of 0.2 μmol L−1 EBR and 75 mmol L−1 NaHCO3, demonstrating EBR’s efficacy in stress response modulation. Seeds were pretreated for 12 h in either distilled water or a 0.2 μmol L−1 EBR solution prior to the commencement of germination tests. Different letters above bars indicate significance among different treatments as determined using Duncan’s samples comparison test (p < 0.05).
Plants 13 00394 g002
Figure 3. Effects of EBR on H2O2 content (A), O2 product activity rate (B), and MDA content (C) in the process of cucumber seed germination under NaHCO3 stress.
Figure 3. Effects of EBR on H2O2 content (A), O2 product activity rate (B), and MDA content (C) in the process of cucumber seed germination under NaHCO3 stress.
Plants 13 00394 g003
Figure 4. Effects of exogenous EBR on SOD (A), POD (B), and CAT (C) activity in the process of cucumber seed germination under NaHCO3 stress.
Figure 4. Effects of exogenous EBR on SOD (A), POD (B), and CAT (C) activity in the process of cucumber seed germination under NaHCO3 stress.
Plants 13 00394 g004
Figure 5. Effects of exogenous EBR on gene expression of Cu-Zn SOD (A), POD (B), and CAT (C) in the process of cucumber seed germination under NaHCO3 stress.
Figure 5. Effects of exogenous EBR on gene expression of Cu-Zn SOD (A), POD (B), and CAT (C) in the process of cucumber seed germination under NaHCO3 stress.
Plants 13 00394 g005
Figure 6. Effects of EBR on activities of total amylase (A), α-amylase (B), β-amylase activity (C), and the starch content (D) in the process of cucumber seed germination under NaHCO3 stress.
Figure 6. Effects of EBR on activities of total amylase (A), α-amylase (B), β-amylase activity (C), and the starch content (D) in the process of cucumber seed germination under NaHCO3 stress.
Plants 13 00394 g006
Figure 7. Effects of exogenous EBR on gene expression of AMY (A) and BMY (B) in the process of cucumber seed germination under NaHCO3 stress.
Figure 7. Effects of exogenous EBR on gene expression of AMY (A) and BMY (B) in the process of cucumber seed germination under NaHCO3 stress.
Plants 13 00394 g007
Figure 8. Effects of exogenous EBR on the content of ABA (A), GA3 (B), and ABA/GA3 ratio (C) in the process of cucumber seed germination under NaHCO3 stress. Different letters above bars indicate significance among different treatments as determined using Duncan’s samples comparison test (p < 0.05).
Figure 8. Effects of exogenous EBR on the content of ABA (A), GA3 (B), and ABA/GA3 ratio (C) in the process of cucumber seed germination under NaHCO3 stress. Different letters above bars indicate significance among different treatments as determined using Duncan’s samples comparison test (p < 0.05).
Plants 13 00394 g008
Figure 9. Effects of EBR on transcript levels of key genes involved in ABA and GA biosynthesis and catabolism in germinated cucumber seeds under NaHCO3 stress. The expression of ABA synthesis-related genes NCED1 (A) and NCED2 (B), GA biosynthesis-related genes GA20ox (C) and GA3ox (D), and ABA catabolism-related genes CYP707A1 (E) and CYP707A2 (F). Data are means ± SD with three biological replicate samples. Different letters above bars indicate significance among different treatments as determined using Duncan’s samples comparison test (p < 0.05).
Figure 9. Effects of EBR on transcript levels of key genes involved in ABA and GA biosynthesis and catabolism in germinated cucumber seeds under NaHCO3 stress. The expression of ABA synthesis-related genes NCED1 (A) and NCED2 (B), GA biosynthesis-related genes GA20ox (C) and GA3ox (D), and ABA catabolism-related genes CYP707A1 (E) and CYP707A2 (F). Data are means ± SD with three biological replicate samples. Different letters above bars indicate significance among different treatments as determined using Duncan’s samples comparison test (p < 0.05).
Plants 13 00394 g009
Figure 10. Schematic representation of three mechanisms by which exogenous EBR mitigates the inhibitory effects of NaHCO3 stress on the germination of cucumber seeds. EBR application results in ROS regulation, hormone balance, and starch accumulation. Genes or molecules highlighted in red indicate upregulation, while those in green signify downregulation in response to exogenous EBR.
Figure 10. Schematic representation of three mechanisms by which exogenous EBR mitigates the inhibitory effects of NaHCO3 stress on the germination of cucumber seeds. EBR application results in ROS regulation, hormone balance, and starch accumulation. Genes or molecules highlighted in red indicate upregulation, while those in green signify downregulation in response to exogenous EBR.
Plants 13 00394 g010
Table 1. Primers sequences.
Table 1. Primers sequences.
Gene NamePrimer Sequences
ActinF: CCCCGATGGGCAGGTAATA; R: AAGAGCAGGACGAACAGCAGA
AMFF: CACGGTTATTACACCCAGGACT; R: TAAATCACTTGGTTGCCCAT
BMFF: GGTGTCAAGTGGTAGCAACAATAAC; R: TGTCCTCTCTTTCTCTTCTAATGGTCT
Cu/Zn SODF: CAAGTTAACGCATGGTGCTC; R: GGCAGTTATGTTTCCCAGGT
PODF: CAGGAAGGAGGGATGGTTT; R: TGGTGTTAGGTTCACTGTTGGA
CATF: ATGCTGGAAGAGGAGGCTAT; R: ATGGTGAGGACATTTGGGAG
NCED1F: CAGGGGGTTATTTGGTCTTGTT; R: ATCATCGTTGGCTGAGGCA
NCED2F: CAAATCCGAAGTTTAGCCCAG; R: CATAATCCAGCAGACCAAGCG
CYP707A1F: TCGGAGTTCTGTTTGCGGCT; R: TGGTAAAGGGCATAGTTCGT
CYP707A2F: CCCAACATCCAACCTCCT; R: CTCGGGCGTCGCTAACAT
GA20oxF: ATCCGTTCCTTATGTTGCTG; R: CCTCATTATTGATTCATTGTCC
GA3oxF: ATTCCCTCTTCTCCCTTCCT; R: ACGCAACCCACATCAGCC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Nie, W.; Gong, B.; Geng, B.; Wen, D.; Qiao, P.; Guo, H.; Shi, Q. The Effects of Exogenous 2,4-Epibrassinolide on the Germination of Cucumber Seeds under NaHCO3 Stress. Plants 2024, 13, 394. https://doi.org/10.3390/plants13030394

AMA Style

Nie W, Gong B, Geng B, Wen D, Qiao P, Guo H, Shi Q. The Effects of Exogenous 2,4-Epibrassinolide on the Germination of Cucumber Seeds under NaHCO3 Stress. Plants. 2024; 13(3):394. https://doi.org/10.3390/plants13030394

Chicago/Turabian Style

Nie, Wenjing, Biao Gong, Bing Geng, Dan Wen, Peng Qiao, Hongen Guo, and Qinghua Shi. 2024. "The Effects of Exogenous 2,4-Epibrassinolide on the Germination of Cucumber Seeds under NaHCO3 Stress" Plants 13, no. 3: 394. https://doi.org/10.3390/plants13030394

APA Style

Nie, W., Gong, B., Geng, B., Wen, D., Qiao, P., Guo, H., & Shi, Q. (2024). The Effects of Exogenous 2,4-Epibrassinolide on the Germination of Cucumber Seeds under NaHCO3 Stress. Plants, 13(3), 394. https://doi.org/10.3390/plants13030394

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop