Analysis of Stress Response Genes in Microtuberization of Potato Solanum tuberosum L.: Contributions to Osmotic and Combined Abiotic Stress Tolerance
Abstract
1. Introduction
2. Results
2.1. Microtuber (MT) Development Under Osmotic and Combined Abiotic Stresses
2.2. Identification of Stress-Responsive Genes
2.3. Quantitative PCR Analysis of Selected Genes Under Osmotic, Heat–Osmotic, Cold–Osmotic, Salt–Osmotic, and Combined-All Stresses
2.4. PCA Under Different Stresses
2.5. Cis-Acting Elements Present in the Genes with the Highest Variance in Different Stresses
3. Discussion
3.1. Role of Histone H3.2, Nucleosome, DNA Priming, and Memory Stress
3.2. Generation of Energy and Primary Metabolites Through GAPCP1
3.3. Combined-All Stresses
Farnesyl Pyrophosphate Synthase FPS1 Isoprenoids Biosynthesis
3.4. Triosephosphate Isomerase, TPI: The Perfect Catalyst
3.5. Ribosomal Protein 4, RPL4
3.6. Superoxide Dismutase, FeSOD, Is the First SOD to Evolve Due to the Abundance of Iron and Low Levels of Oxygen in Earth’s Primitive Atmosphere
3.7. Salt–Osmotic Stress
3-Oxoacyl-[Acyl-Carrier-Protein] Synthase II, KAS2
3.8. Enolase 1, ENO1
3.9. Heat Shock 70 kDa Protein 8, HSP70-8
3.10. Peroxidase, PER
4. Materials and Methods
4.1. Plant Material and MT Induction
4.2. Isolation of RNA, qPCR, and Transcriptome Sequencing
4.3. Analysis of DEG and Interaction Analysis of Stress Genes
4.4. Reconciliation Trees
4.5. Transcriptional Analysis Through qPCR of Genes Involved in Stress Response
4.6. Principal Component Analysis of Gene Expression
4.7. Analysis of Cis-Acting Regulatory Elements in Genes
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hardigan, M.A.; Laimbeer, F.P.E.; Newton, L.; Crisovan, E.; Hamilton, J.P.; Vaillancourt, B.; Wiegert-Rininger, K.; Wood, J.C.; Douches, D.S.; Farré, E.M.; et al. Genome diversity of tuber-bearing Solanum uncovers complex evolutionary history and targets of domestication in the cultivated potato. Proc. Natl. Acad. Sci. USA 2017, 114, E9999–E10008. [Google Scholar] [CrossRef]
- Bradshaw, J.E.; Bradshaw, J.E. Domestication to Twenty-First-Century Potato Cultivars. Potato Breeding: Theory and Practice; Springer: Cham, Switzerland, 2021; pp. 3–51. [Google Scholar] [CrossRef]
- Hijmans, R.J. The effect of climate change on global potato production. Am. Potato J. 2003, 80, 271–279. [Google Scholar] [CrossRef]
- Pino, M.T.; Skinner, J.S.; Park, E.J.; Jeknić, Z.; Hayes, P.M.; Thomashow, M.F.; Chen, T.H. Use of a stress inducible promoter to drive ectopic AtCBF expression improves potato freezing tolerance while minimizing negative effects on tuber yield. Plant Biotechnol. J. 2007, 5, 591–604. [Google Scholar] [CrossRef] [PubMed]
- Pino, M.T.; Ávila, A.; Alvarado, A.M.; Jeknic, Z.; Chen, T.H. Enhanced in vitro drought tolerance of Solanum tuberosum and Solanum commersonii plants overexpressing the ScCBF1 gene. Cienc. Investig. Agrar. 2013, 40, 171–184. [Google Scholar] [CrossRef]
- Vasquez-Robinet, C.; Mane, S.P.; Ulanov, A.V.; Watkinson, J.I.; Stromberg, V.K.; De Koeyer, D.; Schafleitner, R.; Willmot, D.B.; Bonierbale, M.; Bohnert, H.J.; et al. Physiological and molecular adaptations to drought in Andean potato. J. Exp. Bot. 2008, 59, 2109–2123. [Google Scholar] [CrossRef] [PubMed]
- Evers, D.; Lefevre, I.; Legay, S.; Lamoureux, D.; Hausman, J.F.; Rosales, R.O.G.; Marca, L.R.T.; Hoffmann, L.; Bonierbale, M.; Schafleitner, R. Identification of drought-responsive compounds in potato through a combined transcriptomic and targeted metabolite approach. J. Exp. Bot. 2010, 61, 2327–2343. [Google Scholar] [CrossRef]
- Thiele, G.; Theisen, K.; Bonierbale, M.; Walker, T. Targeting the poor and hungry with potato science. Potato J. 2010, 37, 75–86. [Google Scholar]
- Cabello, R.; Monneveux, P.; De Mendiburu, F.; Bonierbale, M. Comparison of yield-based drought tolerance indices in improved varieties, genetic stocks and landraces of potato (Solanum tuberosum L.). Euphytica 2013, 193, 147–156. [Google Scholar] [CrossRef]
- Lehretz, G.G.; Sonnewald, S.; Hornyik, C.; Corral, J.M.; Sonnewald, U. Post-transcriptional regulation of FLOWERING LOCUS T modulates heat-dependent source-sink development in potato. Curr. Biol. 2019, 29, 1614–1624. [Google Scholar] [CrossRef]
- Morris, W.L.; Ducreux, L.J.; Morris, J.; Campbell, R.; Usman, M.; Hedley, P.E.; Taylor, M.A. Identification of TIMING OF CAB EXPRESSION 1 as a temperature-sensitive negative regulator of tuberization in potato. J. Exp. Bot. 2019, 70, 5703–5714. [Google Scholar] [CrossRef]
- Mittler, R. Abiotic stress, the field environment and stress combination. Trends Sci. 2006, 11, 15–19. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Vinocur, B.; Altman, A. Plant responses to drought, salinity and extreme temperatures: Towards genetic engineering for stress tolerance. Planta 2003, 218, 1–14. [Google Scholar] [CrossRef]
- Levy, D.; Veilleux, R.E. Adaptation of potato to high temperatures and salinity-a review. Am. J. Potato Res. 2007, 84, 487–506. [Google Scholar] [CrossRef]
- Trapero-Mozos, A.; Morris, W.L.; Ducreux, L.J.; McLean, K.; Stephens, J.; Torrance, L.; Bryan, G.J.; Hancock, R.D.; Taylor, M.A. Engineering heat tolerance in potato by temperature-dependent expression of a specific allele of HEAT-SHOCK COGNATE 70. Plant Biotechnol. J. 2018, 16, 197–207. [Google Scholar] [CrossRef]
- Valencia-Lozano, E.; Herrera-Isidrón, L.; Flores-López, J.A.; Recoder-Meléndez, O.S.; Barraza, A.; Cabrera-Ponce, J.L. Solanum Tuberosum Microtuber Development under Darkness Unveiled through RNAseq Transcriptomic Analysis. Int. J. Mol. Sci. 2022, 23, 13835. [Google Scholar] [CrossRef]
- Valencia-Lozano, E.; Herrera-Isidrón, L.; Flores-López, J.A.; Recoder-Meléndez, O.S.; Uribe-López, B.; Barraza, A.; Cabrera-Ponce, J.L. Exploring the Potential Role of Ribosomal Proteins to Enhance Potato Resilience in the Face of Changing Climatic Conditions. Genes 2023, 14, 1463. [Google Scholar] [CrossRef] [PubMed]
- Herrera-Isidron, L.; Valencia-Lozano, E.; Uribe-Lopez, B.; Delano-Frier, J.P.; Barraza, A.; Cabrera-Ponce, J.L. Molecular Insights into the Role of Sterols in Microtuber Development of Potato Solanum tuberosum L. Plants 2024, 13, 2391. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Liu, X.; Luo, M.; Yang, S.; Wu, K. Involvement of histone modifications in plant abiotic stress responses. J. Integr. Plant Biol. 2013, 55, 892–901. [Google Scholar] [CrossRef]
- Han, S.K.; Wagner, D. Role of chromatin in water stress responses in plants. J. Exp. Bot. 2014, 65, 2785–2799. [Google Scholar] [CrossRef]
- Mehrotra, R.; Bhalothia, P.; Bansal, P.; Basantani, M.K.; Bharti, V.; Mehrotra, S. Abscisic acid and abiotic stress tolerance–Different tiers of regulation. J. Plant Physiol. 2014, 171, 486–496. [Google Scholar] [CrossRef]
- Deinlein, U.; Stephan, A.B.; Horie, T.; Luo, W.; Xu, G.; Schroeder, J.I. Plant salt-tolerance mechanisms. Trends Plant Sci. 2014, 19, 371–379. [Google Scholar] [CrossRef] [PubMed]
- Pecinka, A.; Dinh, H.Q.; Baubec, T.; Rosa, M.; Lettner, N.; Scheid, O.M. Epigenetic regulation of repetitive elements is attenuated by prolonged heat stress in Arabidopsis. Plant Cell 2010, 22, 3118–3129. [Google Scholar] [CrossRef] [PubMed]
- Law, R.D.; Suttle, J.C. Changes in histone H3 and H4 multi-acetylation during natural and forced dormancy break in potato tubers. Physiol. Plant. 2004, 120, 642–649. [Google Scholar] [CrossRef]
- Zeng, Z.; Zhang, W.; Marand, A.P.; Zhu, B.; Buell, C.R.; Jiang, J. Cold stress induces enhanced chromatin accessibility and bivalent histone modifications H3K4me3 and H3K27me3 of active genes in potato. Genome Biol. 2019, 20, 123. [Google Scholar] [CrossRef] [PubMed]
- Mali, S.; Zinta, G. Genome-wide identification and expression analysis reveal the role of histone methyltransferase and demethylase genes in heat stress response in potato (Solanum tuberosum L.). Biochim. Biophys. Acta 2024, 1868, 130507. [Google Scholar] [CrossRef] [PubMed]
- Sheng-Ping, Q.I.U.; Huang, J.I.; Li-Juan, P.A.N.; Mei-Mei, W.A.N.G.; Zhang, H.S. Salt induces expression of RH3. 2A, encoding an H3. 2-type histone H3 protein in rice (Oryza sativa L.). Acta Genet. Sin. 2006, 33, 833–840. [Google Scholar] [CrossRef]
- Zhang, T.; Wang, Y.; Munir, S.; Wang, T.; Ye, Z.; Zhang, J.; Zhang, Y. Cyclin gene SlCycB1 alters plant architecture in association with histone H3.2 in tomato. Hortic. Plant J. 2022, 8, 341–350. [Google Scholar] [CrossRef]
- Roy, D.; Paul, A.; Roy, A.; Ghosh, R.; Ganguly, P.; Chaudhuri, S. Differential acetylation of histone H3 at the regulatory region of OsDREB1b promoter facilitates chromatin remodelling and transcription activation during cold stress. PLoS ONE 2014, 9, e100343. [Google Scholar] [CrossRef]
- Song, T.; Zhang, Q.; Wang, H.; Han, J.; Xu, Z.; Yan, S.; Zhu, Z. OsJMJ703, a rice histone demethylase gene, plays key roles in plant development and responds to drought stress. Plant Physiol. Biochem. 2018, 132, 183–188. [Google Scholar] [CrossRef]
- Petersen, J.; Brinkmann, H.; Cerff, R. Origin, evolution, and metabolic role of a novel glycolytic GAPDH enzyme recruited by land plant plastids. J. Mol. Evol. 2003, 57, 16–26. [Google Scholar] [CrossRef]
- Backhausen, J.E.; Vetter, S.; Baalmann, E.; Kitzmann, C.; Scheibe, R. NAD-dependent malate dehydrogenase and glyceraldehyde 3-phosphate dehydrogenase isoenzymes play an important role in dark metabolism of various plastid types. Planta 1998, 205, 359–366. [Google Scholar] [CrossRef]
- Kappachery, S.; Baniekal-Hiremath, G.; Yu, J.W.; Park, S.W. Effect of over-and under-expression of glyceraldehyde 3-phosphate dehydrogenase on tolerance of plants to water-deficit stress. Plant Cell Tissue Organ Cult. PCTOC 2015, 121, 97–107. [Google Scholar] [CrossRef]
- Jeong, M.J.; Park, S.C.; Byun, M.O. Improvement of salt tolerance in transgenic potato plants by glyceraldehyde-3 phosphate dehydrogenase gene transfer. Mol. Cells 2001, 12, 185–189. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Hong, H.; Wang, J.; Zhan, Y.; Teng, W.; Li, H.; Li, W.; Li, Y.; Zhao, X.; Han, Y. Genome-wide identification and analysis of glyceraldehyde-3-phosphate dehydrogenase family reveals the role of GmGAPDH14 to improve salt tolerance in soybean (Glycine max L.). Front. Plant Sci. 2023, 14, 1193044. [Google Scholar] [CrossRef] [PubMed]
- Lim, H.; Hwang, H.; Kim, T.; Kim, S.; Chung, H.; Lee, D.; Kim, S.; Park, S.; Cho, W.; Ji, H.; et al. Transcriptomic analysis of rice plants overexpressing PsGAPDH in response to salinity stress. Genes 2021, 12, 641. [Google Scholar] [CrossRef]
- Munoz-Bertomeu, J.; Cascales-Minana, B.; Mulet, J.M.; Baroja-Fernández, E.; Pozueta-Romero, J.; Kuhn, J.M.; Segura, J.; Ros, R. Plastidial glyceraldehyde-3-phosphate dehydrogenase deficiency leads to altered root development and affects the sugar and amino acid balance in Arabidopsis. Plant Physiol. 2009, 151, 541–558. [Google Scholar] [CrossRef]
- Li, X.; Wei, W.; Li, F.; Zhang, L.; Deng, X.; Liu, Y.; Yang, S. The plastidial glyceraldehyde-3-phosphate dehydrogenase is critical for abiotic stress response in wheat. Int. J. Mol. Sci. 2019, 20, 1104. [Google Scholar] [CrossRef]
- Kappachery, S.; Sasi, S.; Alyammahi, O.; Alyassi, A.; Venkatesh, J.; Gururani, M.A. Overexpression of cytoplasmic Solanum tuberosum Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene improves PSII efficiency and alleviates salinity stress in Arabidopsis. J. Plant Interact. 2021, 16, 398–410. [Google Scholar] [CrossRef]
- Liu, T.; Fang, H.; Liu, J.; Reid, S.; Hou, J.; Zhou, T.; Tian, Z.; Song, B.; Xie, C. Cytosolic glyceraldehyde-3-phosphate dehydrogenases play crucial roles in controlling cold-induced sweetening and apical dominance of potato (Solanum tuberosum L.) tubers. Plant Cell Environ. 2017, 40, 3043–3054. [Google Scholar] [CrossRef]
- Liu, J.; Song, J.; Zhuang, X.; Lu, Y.; Wang, Q.; Yang, S.; Lu, L.; Wang, X.; Li, L. Overexpression of cytosolic glyceraldehyde-3-phosphate dehydrogenase 1 gene improves nitrogen absorption and utilization in potato. Horticulturae 2023, 9, 1105. [Google Scholar] [CrossRef]
- Kim, S.C.; Guo, L.; Wang, X. Nuclear moonlighting of cytosolic glyceraldehyde-3-phosphate dehydrogenase regulates Arabidopsis response to heat stress. Nat. Commun. 2020, 11, 3439. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.H.; Rao, X.L.; Shi, H.T.; Li, R.J.; Lu, Y.T. Overexpression of a cytosolic glyceraldehyde-3-phosphate dehydrogenase gene OsGAPC3 confers salt tolerance in rice. Plant Cell Tissue Organ Cult. PCTOC 2011, 107, 1–11. [Google Scholar] [CrossRef]
- Manzano, D.; Andrade, P.; Caudepón, D.; Altabella, T.; Arró, M.; Ferrer, A. Suppressing Farnesyl Diphosphate Synthase Alters Chloroplast Development and Triggers Sterol-Dependent Induction of Jasmonate- and Fe-Related Responses. Plant Physiol. 2016, 172, 93–117. [Google Scholar] [CrossRef] [PubMed]
- Cai, B.; Li, Q.; Liu, F.; Bi, H.; Ai, X. Decreasing fructose-1, 6-bisphosphate aldolase activity reduces plant growth and tolerance to chilling stress in tomato seedlings. Physiol. Plant. 2018, 163, 247–258. [Google Scholar] [CrossRef] [PubMed]
- Elsadek, M.A.; Wang, R.; Xu, K.; Wang, T.; Zhang, A.; Qi, Z.; Liu, B.; Yuan, L.; Chen, L. Tuber quality enhancement via grafting potato onto a wooden goji rootstock through vitalizing multi-pathways. Plant Physiol. Biochem. 2024, 214, 108927. [Google Scholar] [CrossRef]
- Kang, Y.; Tong, J.; Liu, W.; Jiang, Z.; Pan, G.; Ning, X.; Yang, X.; Zhong, M. Comprehensive analysis of major latex-like protein family genes in cucumber (Cucumis sativus L.) and their potential roles in phytophthora blight resistance. Int. J. Mol. Sci. 2023, 24, 784. [Google Scholar] [CrossRef]
- Li, C.; Ng, C.K.Y.; Fan, L.M. MYB transcription factors, active players in abiotic stress signaling. Environ. Exp. Bot. 2015, 114, 80–91. [Google Scholar] [CrossRef]
- Moehninsi; Lange, I.; Lange, B.M.; Navarre, D.A. Altering Potato Isoprenoid Metabolism Increases Biomass and Induces Early Flowering. J. Exp. Bot. 2020, 71, 4109–4124. [Google Scholar] [CrossRef]
- Closa, M.; Vranová, E.; Bortolotti, C.; Bigler, L.; Arró, M.; Ferrer, A.; Gruissem, W. The Arabidopsis thaliana FPP synthase isozymes have overlapping and specific functions in isoprenoid biosynthesis, and complete loss of FPP synthase activity causes early developmental arrest: Arabidopsis thaliana FPP synthase mutants. Plant J. 2010, 63, 512–525. [Google Scholar] [CrossRef]
- Patel, P.; Prasad, A.; Srivastava, D.; Niranjan, A.; Saxena, G.; Singh, S.S.; Misra, P.; Chakrabarty, D. Genotype-dependent and temperature-induced modulation of secondary metabolites, antioxidative defense and gene expression profile in Solanum viarum Dunal. Environ. Exp. Bot. 2022, 194, 104686. [Google Scholar] [CrossRef]
- Zhang, X.; Li, J.; Li, M.; Zhang, S.; Song, S.; Wang, W.; Wang, S.; Chang, J.; Xia, Z.; Zhang, S.; et al. NtHSP70-8b positively regulates heat tolerance and seed size in Nicotiana tabacum. Plant Physiol. Biochem. 2023, 201, 107901. [Google Scholar] [CrossRef] [PubMed]
- Wei, G.; Chen, Y.; Wang, J.; Feng, L. Molecular cloning and characterization of farnesyl diphosphate synthase from Rosa rugosa Thunb associated with salinity stress. PeerJ 2024, 12, e16929. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Tang, X.; Chen, L.; Qiu, X.; Song, C.; Wang, H.; Chang, Y. Functional characterization and transcriptional activity analysis of Dryopteris fragrans farnesyl diphosphate synthase genes. Front. Plant Sci. 2023, 14, 1105240. [Google Scholar] [CrossRef] [PubMed]
- Souleyre, E.J.; Bowen, J.K.; Matich, A.J.; Tomes, S.; Chen, X.; Hunt, M.B.; Wang, M.Y.; Ileperuma, N.R.; Richards, K.; Rowan, D.D.; et al. Genetic control of α-farnesene production in apple fruit and its role in fungal pathogenesis. Plant J. 2019, 100, 1148–1162. [Google Scholar] [CrossRef]
- Helliwell, J.R. Triosephosphate isomerase: The perfect enzyme, but how does it work? IUCrJ 2021, 8, 480–481. [Google Scholar] [CrossRef]
- Awana, M.; Jain, N.; Samota, M.K.; Rani, K.; Kumar, A.; Ray, M.; Gaikwad, K.; Praveen, S.; Singh, N.K.; Singh, A. Protein and gene integration analysis through proteome and transcriptome brings new insight into salt stress tolerance in pigeonpea (Cajanus cajan L.). Int. J. Biol. Macromol. 2020, 164, 3589–3602. [Google Scholar] [CrossRef]
- Salekdeh, G.H.; Siopongco, J.; Wade, L.J.; Ghareyazie, B.; Bennett, J. Proteomic analysis of rice leaves during drought stress and recovery. Proteomics 2002, 2, 1131–1145. [Google Scholar] [CrossRef]
- Riccardi, F.; Gazeau, P.; de Vienne, D.; Zivy, M. Protein changes in response to progressive water deficit in maize: Quantitative variation and polypeptide identification. Plant Physiol. 1998, 117, 1253–1263. [Google Scholar] [CrossRef]
- Chen, C.; Zhang, M.; Ma, X.; Meng, Q.; Zhuang, K. Differential heat-response characteristics of two plastid isoforms of triose phosphate isomerase in tomato. Plant Biotechnol. J. 2024, 22, 650–661. [Google Scholar] [CrossRef]
- Evers, D.; Legay, S.; Lamoureux, D.; Hausman, J.F.; Hoffmann, L.; Renaut, J. Towards a synthetic view of potato cold and salt stress response by transcriptomic and proteomic analyses. Plant Mol. Biol. 2012, 78, 503–514. [Google Scholar] [CrossRef]
- Romani, I.; Tadini, L.; Rossi, F.; Masiero, S.; Pribil, M.; Jahns, P.; Kater, M.; Leister, D.; Pesaresi, P. Versatile roles of Arabidopsis plastid ribosomal proteins in plant growth and development. Plant J. 2012, 72, 922–934. [Google Scholar] [CrossRef] [PubMed]
- Gangadhar, B.H.; Yu, J.W.; Sajeesh, K.; Park, S.W. A systematic exploration of high-temperature stress-responsive genes in potato using large-scale yeast functional screening. Mol. Genet. Genom. 2014, 289, 185–201. [Google Scholar] [CrossRef] [PubMed]
- Moin, M.; Bakshi, A.; Saha, A.; Dutta, M.; Madhav, S.M.; Kirti, P.B. Rice ribosomal protein large subunit genes and their spatio-temporal and stress regulation. Front. Plant Sci. 2016, 7, 1284. [Google Scholar] [CrossRef] [PubMed]
- Trifa, Y.; Privat, I.; Gagnon, J.; Baeza, L.; Lerbs-Mache, S. The nuclear RPL4 gene encodes a chloroplast protein that co-purifies with the T7-like transcription complex as well as plastid ribosomes. J. Biol. Chem. 1998, 273, 3980–3985. [Google Scholar] [CrossRef]
- Rosado, A.; Sohn, E.J.; Drakakaki, G.; Pan, S.; Swidergal, A.; Xiong, Y.; Kang, B.H.; Bressan, R.A.; Raikhel, N.V. Auxin-mediated ribosomal biogenesis regulates vacuolar trafficking in Arabidopsis. Plant Cell 2010, 22, 143–158. [Google Scholar] [CrossRef]
- Gangadhar, B.H.; Sajeesh, K.; Venkatesh, J.; Baskar, V.; Abhinandan, K.; Moon, S.H.; Jarso, T.S.; Yu, J.W. Identification and characterization of genes associated with thermo-tolerance using virus induced gene silencing in Nicotiana benthamiana. Plant Growth Regul. 2016, 80, 355–366. [Google Scholar] [CrossRef]
- Broxton, C.N.; Culotta, V.C. SOD enzymes and microbial pathogens: Surviving the oxidative storm of infection. PLoS Pathog. 2016, 12, e1005295. [Google Scholar] [CrossRef]
- Zhou, X.; Zhang, N.; Yang, J.; Tang, X.; Wen, Y.; Si, H. Functional analysis of StDWF4 gene in response to salt stress in potato. Plant Physiol. Biochem. 2018, 125, 63–73. [Google Scholar] [CrossRef]
- Seppänen, M.M.; Fagerstedt, K. The role of superoxide dismutase activity in response to cold acclimation in potato. Physiol. Plant. 2000, 108, 279–285. [Google Scholar] [CrossRef]
- Xu, J.; Yang, J.; Duan, X.; Jiang, Y.; Zhang, P. Increased expression of native cytosolic Cu/Zn superoxide dismutase and ascorbate peroxidase improves tolerance to oxidative and chilling stresses in cassava (Manihot esculenta Crantz). BMC Plant Biol. 2014, 14, 208. [Google Scholar] [CrossRef]
- Taghvaei, M.M.; Lahiji, H.S.; Golfazani, M.M. Evaluation of expression changes, proteins interaction network, and microRNAs targeting catalase and superoxide dismutase genes under cold stress in rapeseed (Brassica napus L.). OCL 2022, 29, 3. [Google Scholar] [CrossRef]
- Triantaphylides, C.; Krischke, M.; Hoeberichts, F.A.; Ksas, B.; Gresser, G.; Havaux, M.; Van Breusegem, F.; Mueller, M.J. Singlet oxygen is the major reactive oxygen species involved in photooxidative damage to plants. Plant Physiol. 2008, 148, 960–968. [Google Scholar] [CrossRef]
- Zhao, Q.; Zhou, L.; Liu, J.; Du, X.; Huang, F.; Pan, G.; Cheng, F. Relationship of ROS accumulation and superoxide dismutase isozymes in developing anther with floret fertility of rice under heat stress. Plant Physiol. Biochem. 2018, 122, 90–101. [Google Scholar] [CrossRef] [PubMed]
- Kumar, R.R.; Dubey, K.; Goswami, S.; Hasija, S.; Pandey, R.; Singh, P.K.; Singh, B.; Sareen, S.; Rai, G.K.; Singh, G.P.; et al. Heterologous expression and characterization of novel manganese superoxide dismutase (Mn-SOD)–A potential biochemical marker for heat stress-tolerance in wheat (Triticum aestivum). Int. J. Biol. Macromol. 2020, 161, 1029–1039. [Google Scholar] [CrossRef]
- Panahi, B.; Hejazi, M.A. Weighted gene co-expression network analysis of the salt-responsive transcriptomes reveals novel hub genes in green halophytic microalgae Dunaliella salina. Sci. Rep. 2021, 11, 1607. [Google Scholar] [CrossRef]
- Panahi, B. Global transcriptome analysis identifies critical functional modules associated with multiple abiotic stress responses in microalgae Chromochloris zofingiensis. PLoS ONE 2024, 19, e0307248. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.J.; Zhang, Y.H.; Ma, X.F.; Ye, P.; Gao, F.; Li, X.F.; Zhou, Y.J.; Shi, Z.H.; Cheng, H.M.; Zheng, C.X.; et al. Biological functions of Arabidopsis thaliana MBP-1-like protein encoded by ENO2 in the response to drought and salt stresses. Physiol. Plant. 2020, 168, 660–674. [Google Scholar] [CrossRef]
- Zeng, T.; Cao, Y.; Gu, T.; Chen, L.; Tian, Y.; Li, G.; Shen, J.; Tao, Z.; Lu, L. Alpha-enolase protects hepatocyte against heat stress through focal adhesion kinase-mediated phosphatidylinositol 3-kinase/Akt pathway. Front. Genet. 2021, 12, 693780. [Google Scholar] [CrossRef]
- Lee, H.; Guo, Y.; Ohta, M.; Xiong, L.; Stevenson, B.; Zhu, J.K. LOS2, a genetic locus required for cold-responsive gene transcription encodes a bi-functional enolase. EMBO J. 2002, 21, 2692–2702. [Google Scholar] [CrossRef]
- Liu, J.; Pang, X.; Cheng, Y.; Yin, Y.; Zhang, Q.; Su, W.; Hu, B.; Guo, Q.; Ha, S.; Zhang, J.; et al. The Hsp70 gene family in Solanum tuberosum: Genome-wide identification, phylogeny, and expression patterns. Sci. Rep. 2018, 8, 16628. [Google Scholar] [CrossRef]
- Song, Z.; Li, Y.; Jia, Y.; Lian, W.; Jia, H. An endoplasmic reticulum-localized NtHSP70-8 confers. Environ. Exp. Bot. 2021, 188, 104519. [Google Scholar] [CrossRef]
- Al Khateeb, W.; Muhaidat, R.; Alahmed, S.; Al Zoubi, M.S.; Al-Batayneh, K.M.; El-Oqlah, A.; Abo Gamar, M.; Hussein, E.; Aljabali, A.A.; Alkaraki, A.K. Heat shock proteins gene expression and physiological responses in durum wheat (Triticum durum) under salt stress. Physiol. Mol. Biol. Plants 2020, 26, 1599–1608. [Google Scholar] [CrossRef] [PubMed]
- Aghaie, P.; Tafreshi, S.A.H. Central role of 70-kDa heat shock protein in adaptation of plants to drought stress. Cell Stress Chaperones 2020, 25, 1071–1081. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Qin, Y.; Hu, X.; Li, G.; Ding, H.; Xiong, X.; Wang, W. Transcriptome analysis uncovers the gene expression profile of salt-stressed potato (Solanum tuberosum L.). Sci. Rep. 2020, 10, 5411. [Google Scholar] [CrossRef]
- Park, S.Y.; Ryu, S.H.; Kwon, S.Y.; Lee, H.S.; Kim, J.G.; Kwak, S.S. Differential expression of six novel peroxidase cDNAs from cell cultures of sweetpotato in response to stress. Mol. Genet. Genom. 2003, 269, 542–552. [Google Scholar] [CrossRef]
- Koca, H.; Ozdemir, F.; Turkan, I. Effect of salt stress on lipid peroxidation and superoxide dismutase and peroxidase activities of Lycopersicon esculentum and L. pennellii. Biol. Plant. 2006, 50, 745–748. [Google Scholar] [CrossRef]
- Meloni, D.A.; Oliva, M.A.; Martinez, C.A.; Cambraia, J. Photosynthesis and activity of superoxide dismutase, peroxidase and glutathione reductase in cotton under salt stress. Environ. Exp. Bot. 2003, 49, 69–76. [Google Scholar] [CrossRef]
- Jebara, S.; Jebara, M.; Limam, F.; Aouani, M.E. Changes in ascorbate peroxidase, catalase, guaiacol peroxidase and superoxide dismutase activities in common bean (Phaseolus vulgaris) nodules under salt stress. J. Plant Physiol. 2005, 162, 929–936. [Google Scholar] [CrossRef]
- Huang, Y.; Bie, Z.; Liu, Z.; Zhen, A.; Wang, W. Protective role of proline against salt stress is partially related to the improvement of water status and peroxidase enzyme activity in cucumber. Soil Sci. Plant Nutr. 2009, 55, 698–704. [Google Scholar] [CrossRef]
- Gulen, H.; Eris, A. Effect of heat stress on peroxidase activity and total protein content in strawberry plants. Plant Sci. 2004, 166, 739–744. [Google Scholar] [CrossRef]
- Vicuna Requesens, D.; Malone, R.P.; Dix, P. Expression of a barley peroxidase in transgenic apple (Malus domestica L.) results in altered growth, xylem formation and tolerance to heat stress. J. Plant Sci. 2014, 9, 58–66. [Google Scholar] [CrossRef][Green Version]
- Zhang, J.; Kirkham, M.B. Drought-stress-induced changes in activities of superoxide dismutase, catalase, and peroxidase in wheat species. Plant Cell Physiol. 1994, 35, 785–791. [Google Scholar] [CrossRef]
- Lotfi, N.; Vahdati, K.; Hassani, D.; Kholdebarin, B.; Amiri, R. Peroxidase, guaiacol peroxidase and ascorbate peroxidase activity accumulation in leaves and roots of walnut trees in response to drought stress. VI Int. Walnut Symp. 2009, 861, 309–316. [Google Scholar] [CrossRef]
- Acar, O.K.A.N.; Türkan, I.; Özdemir, F. Superoxide dismutase and peroxidase activities in drought sensitive and resistant barley (Hordeum vulgare L.) varieties. Acta Physiol. Plant. 2001, 23, 351–356. [Google Scholar] [CrossRef]
- Mohamed, E.A.; Osama, E.; Manal, E.; Samah, A.; Salah, G.; Hazem, K.M.; Jacek, W.; Nabil, E. Impact of gamma irradiation pretreatment on biochemical and molecular responses of potato growing under salt stress. Chem. Biol. Technol. Agric. 2021, 8, 35. [Google Scholar] [CrossRef]
- Navarrete, O.; Van Daele, J.; Stove, C.; Lambert, W.; Van Der Straeten, D.; Storozhenko, S. A folate independent role for cytosolic HPPK/DHPS upon stress in Arabidopsis thaliana. Phytochemistry 2012, 73, 23–33. [Google Scholar] [CrossRef]
- Joshi, R.; Karan, R.; Singla-Pareek, S.L.; Pareek, A. Ectopic expression of Pokkali phosphoglycerate kinase-2 (OsPGK2-P) improves yield in tobacco plants under salinity stress. Plant Cell Rep. 2016, 35, 27–41. [Google Scholar] [CrossRef]
- Ma, C.; Wang, Y.; Gu, D.; Nan, J.; Chen, S.; Li, H. Overexpression of S-adenosyl-L-methionine synthetase 2 from sugar beet M14 increased Arabidopsis tolerance to salt and oxidative stress. Int. J. Mol. Sci. 2017, 18, 847. [Google Scholar] [CrossRef]
- Bakshi, A.; Moin, M.; Gayatri, M.B.; Reddy, A.B.; Datla, R.; Madhav, M.S.; Kirti, P.B. Involvement of target of rapamycin (TOR) signaling in the regulation of crosstalk between ribosomal protein small subunit 6 kinase-1 (RPS6K-1) and ribosomal proteins. Plants 2023, 12, 176. [Google Scholar] [CrossRef]
- Huang, J.; Xue, C.; Wang, H.; Wang, L.; Schmidt, W.; Shen, R.; Lan, P. Genes of ACYL CARRIER PROTEIN family show different expression profiles and overexpression of ACYL CARRIER PROTEIN 5 modulates fatty acid composition and enhances salt stress tolerance in Arabidopsis. Front. Plant Sci. 2017, 8, 987. [Google Scholar] [CrossRef]
- Ramírez-Rafael, J.A.; Korchmaros, A.; Aviña-Padilla, K.; López Sánchez, A.; España-Tinajero, A.A.; Hellmuth, M.; Hernández-Rosales, M. REvolutionH-tl: Reconstruction of Evolutionary Histories tool. In RECOMB International Workshop on Comparative Genomics; Springer Nature: Cham, Switzerland, 2024; pp. 89–109. [Google Scholar]
- FAOSTAT. FAO Statistics, Food and Agriculture Organization of the United Nations. 2020. Available online: http://faostat.fao.org/ (accessed on 7 October 2024).
- Johns, T.; Alonso, J.G. Glycoalkaloid change during the domestication of the potato, Solanum Section Petota. Euphytica 1990, 50, 203–210. [Google Scholar] [CrossRef]
- Herrera-Isidron, L.; Valencia-Lozano, E.; Rosiles-Loeza, P.Y.; Robles-Hernández, M.G.; Napsuciale-Heredia, A.; Cabrera-Ponce, J.L. Gene expression analysis of microtubers of potato Solanum tuberosum L. induced in cytokinin containing medium and osmotic stress. Plants 2021, 10, 876. [Google Scholar] [CrossRef] [PubMed]
- Szklarczyk, D.; Franceschini, A.; Wyder, S.; Forslund, K.; Heller, D.; Huerta-Cepas, J.; Simonovic, M.; Roth, A.; Santos, A.; Tsafou, K.P.; et al. STRING V10: Protein–Protein Interaction Networks, Integrated over the Tree of Life. Nucleic Acids Res. 2015, 43, D447–D452. [Google Scholar] [CrossRef] [PubMed]
- The UniProt Consortium; Bateman, A.; Martin, M.-J.; Orchard, S.; Magrane, M.; Agivetova, R.; Ahmad, S.; Alpi, E.; Bowler-Barnett, E.H.; Britto, R.; et al. UniProt: The Universal Protein Knowledgebase in 2021. Nucleic Acids Res. 2021, 49, D480–D489. [Google Scholar] [CrossRef]
- Sherry, S.T. dbSNP: The NCBI Database of Genetic Variation. Nucleic Acids Res. 2001, 29, 308–311. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Horton, N.J.; Kleinman, K. Using R and RStudio for Data Management, Statistical Analysis, and Graphics; CRC Press: Boca Raton, FL, USA, 2015. [Google Scholar]
- Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
Stress | MTs Diameter (mm) | MTs Per Explant Mean ± SE |
---|---|---|
Osmotic | 3.60 ± 0.13 | 0.85 ± 0.11 |
Heat–Osmotic | 3.04 ± 0.08 | 0.75 ± 0.24 |
Cold–Osmotic | 2.90 ± 0.07 | 0.70 ± 0.21 |
Salt–Osmotic | 3.57 ± 0.09 | 0.75 ± 0.35 |
Combined-all stresses | 2.62 ± 0.06 | 0.35 ± 0.14 |
Potato ID String v11.5 | Potato ID String v12.0 | A. thaliana | INT/ DOMc | Annotation | Reference Systematic Review |
---|---|---|---|---|---|
PGSC0003DMT400006945 | M0ZS78 | PK1 | INT | Pyruvate kinase 1 | [1] |
PGSC0003DMT400002870 | M0ZKT2 | H3.2 | DOMc | Histone H3.2-like | [19,20,21,22,23,24,25,26,27,28,29,30] |
PGSC0003DMT400029242 | M1ASG7 | GAPCP1 | INT | Glyceraldehyde-3-phosphate dehydrogenase | [31,32,33,34,35,36,37,38,39,40,41,42,43] |
PGSC0003DMT400032266 | M1AX44 | MMDH | INT | Malate dehydrogenase | [34] |
PGSC0003DMT400076602 | M1CX22 | FPS1 | Farnesyl pyrophosphate synthase 1-like | [18,44,45,46,47,48,49,50,51,52,53,54,55] | |
PGSC0003DMT400071330 | M1CNK1 | TPI | DOMc | Triosephosphate isomerase | [56,57,58,59,60,61] |
PGSC0003DMT400071725 | M1CP75 | RPL4 | DOMc | 60S ribosomal protein L4 | [62,63,64,65,66,67] |
PGSC0003DMT400070920 | M1CMY9 | SOD/Fe | Superoxide dismutase [Fe] | [68,69,70,71,72,73,74,75] | |
PGSC0003DMT400007585 | M0ZT85 | KAS2 | 3-oxoacyl-[acyl-carrier-protein] synthase II | [76,77] | |
PGSC0003DMT400062986 | M1C9 × 0 | ENO1 | DOMc | Enolase 1 | [78,79,80] |
PGSC0003DMT400077358 | M1CYA5 | HSP70-8 | INT | Heat shock 70 kDa protein 8 | [81,82,83,84] |
PGSC0003DMT400035521 | M1B2E4 | PER | INT | Peroxidase | [85,86,87,88,89,90,91,92,93,94,95,96] |
PGSC0003DMT400001937 | M0ZJD1 | THY-1 | Bifunctional dihydrofolate reductase-thymidylate synthase-like | [97] | |
PGSC0003DMT400056871 | M1C005 | PGK | Phosphoglycerate kinase | [98] | |
PGSC0003DMT400087679 | Q38JH8 | METK2 | S-adenosylmethionine synthase 2 | [99] | |
PGSC0003DMT400060739 | M1C6C4 | RPL51 | 54S ribosomal protein L51 | [100] | |
PGSC0003DMT400036981 | M1B4L2 | ACP | Acyl carrier protein 1 | [101] |
Potato ID String v11.5 | ID String v.12 | ID | NCBI | Forward | Reverse |
---|---|---|---|---|---|
PGSC0003DMT400001937 | M0ZJD1 | THY-1 | XM_015304289.1 | GTGCTAAGGTCCTACAAGGAAG | CCAAATCACCCTCTTCCCTATC |
PGSC0003DMT400002870 | M0ZKT2 | H3.2 | XM_006349079.2 | GTATCAGAAGTCGACGGAGTTG | ACCTCAGATCCGTCTTGAAATC |
PGSC0003DMT400006945 | M0ZS78 | PK1 | XM_006341124.2 | CGAAGAGGGCTTGACACATT | CCTTCTCAGGTGGGAGATCTAT |
PGSC0003DMT400076602 | M1CX22 | FPS1 | XM_006344841.2 | GGAGGTGTACTCTGTGCTTAAA | GATAGTCCTCGATTCAGCTTCC |
PGSC0003DMT400029242 | M1ASG7 | GAPCP1 | XM_006352526.2 | GGTTACACAGACGAGGATGTT | GAGACGAGCTTCACGAATGA |
PGSC0003DMT400056871 | M1C005 | PGK | NM_001288522.1 | CCACTTGTGCCTAGACTTTCA | AGTTCAGCCACCAAGTTCTC |
PGSC0003DMT400062986 | M1C9 × 0 | ENO1 | XM_006345012.2 | CTACTAACGTCTCCTCCAAAGC | ATAGGAAAGTCCGCCGAAAG |
PGSC0003DMT400071725 | M1CP75 | RPL4 | XM_049512576.1 | TGAGGCACAAAGAGTCAAGG | TTTGCCTGCTGACCTGATAG |
PGSC0003DMT400087679 | Q38JH8 | METK2 | NM_001318549.1 | GACTTGCTCGTCGCTGTATT | TCGGGAATTGTTCCTGTCTTG |
PGSC0003DMT400032266 | M1AX44 | MMDH | NM_001288105.1 | CGCACCAGAGAGGAAAGTT | CGTAGAGTGAAAGGCTGGTAC |
PGSC0003DMT400071330 | M1CNK1 | TPI | NM_001318582.1 | TGGGCTATTGGTACTGGAAAG | GCAGCAACTTCAGCACTAAC |
PGSC0003DMT400035521 | M1B2E4 | PER | XM_006364783.2 | GCACAGTTTCCAACGCTAAAG | GGACAACCAAGTCGAGAACA |
PGSC0003DMT400070920 | M1CMY9 | SOD/Fe | XM_006357250.2 | GGCCTGGAATCATCAGTTCTT | GCTGCAGCTGCCTTAAATTC |
PGSC0003DMT400060739 | M1C6C4 | RPL51 | XM_006346690.2 | GCCGACGTTCTACTTCTTACTC | TAGCTGACTACCAGCTTCCT |
PGSC0003DMT400007585 | M0ZT85 | KAS2 | XM_006345186.2 | GGTGGATCAGAGGCAGTAATTG | CAAGGCCGAGAAGCTTTAGTAG |
PGSC0003DMT400036981 | M1B4L2 | ACP | XM_006341431.2 | ACATCCCGCTTTCGTGTT | GTACTTTCAGGGCTGACCTTAG |
PGSC0003DMT400077358 | M1CYA5 | HSP70-8 | XM_006360745.2 | GCTCGTCAGAAACACGAGAA | CGTGAGCCAGTTCATCACTAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Herrera-Isidron, L.; Uribe-Lopez, B.; Barraza, A.; Cabrera-Ponce, J.L.; Valencia-Lozano, E. Analysis of Stress Response Genes in Microtuberization of Potato Solanum tuberosum L.: Contributions to Osmotic and Combined Abiotic Stress Tolerance. Plants 2024, 13, 2996. https://doi.org/10.3390/plants13212996
Herrera-Isidron L, Uribe-Lopez B, Barraza A, Cabrera-Ponce JL, Valencia-Lozano E. Analysis of Stress Response Genes in Microtuberization of Potato Solanum tuberosum L.: Contributions to Osmotic and Combined Abiotic Stress Tolerance. Plants. 2024; 13(21):2996. https://doi.org/10.3390/plants13212996
Chicago/Turabian StyleHerrera-Isidron, Lisset, Braulio Uribe-Lopez, Aaron Barraza, José Luis Cabrera-Ponce, and Eliana Valencia-Lozano. 2024. "Analysis of Stress Response Genes in Microtuberization of Potato Solanum tuberosum L.: Contributions to Osmotic and Combined Abiotic Stress Tolerance" Plants 13, no. 21: 2996. https://doi.org/10.3390/plants13212996
APA StyleHerrera-Isidron, L., Uribe-Lopez, B., Barraza, A., Cabrera-Ponce, J. L., & Valencia-Lozano, E. (2024). Analysis of Stress Response Genes in Microtuberization of Potato Solanum tuberosum L.: Contributions to Osmotic and Combined Abiotic Stress Tolerance. Plants, 13(21), 2996. https://doi.org/10.3390/plants13212996