Next Article in Journal
Impact of Exogenous dsRNA on miRNA Composition in Arabidopsis thaliana
Previous Article in Journal
MnasNet-SimAM: An Improved Deep Learning Model for the Identification of Common Wheat Diseases in Complex Real-Field Environments
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of New Wheat-Thinopyrum intermedium Derivative Lines with Superior Genes for Stripe Rust and Powdery Mildew Resistance

by
Zhihui Yu
1,
Guangrong Li
1,
Zhiqiang Zheng
1,
Hongjin Wang
2,* and
Zujun Yang
1,*
1
School of Life Science and Technology, University of Electronic Science and Technology of China, Chengdu 610054, China
2
College of Life Sciences, Zaozhuang University, Zaozhuang 277100, China
*
Authors to whom correspondence should be addressed.
Plants 2024, 13(16), 2333; https://doi.org/10.3390/plants13162333
Submission received: 24 May 2024 / Revised: 14 August 2024 / Accepted: 19 August 2024 / Published: 22 August 2024
(This article belongs to the Section Plant Genetics, Genomics and Biotechnology)

Abstract

The wild species Thinopyrum intermedium (genome JJJSJSStSt) serves as a valuable germplasm resource providing novel diseases resistance and agronomically important genes for wheat improvement. Two wheat-Th. intermedium partial amphiploids, TAI7045 (2n = 56) and 78784 (2n = 56), exhibit high resistance to stripe rust and powdery mildew, and their chromosome constitutions have been characterized. With the aim to transfer novel resistance genes from Th. intermedium, the crosses of common wheat line MY11 with TAI7045 and 78784 were produced, and their individual F2-F5 progenies were characterized using sequential non-denaturing fluorescence in situ hybridization (ND-FISH) and molecular markers. We identified a set of wheat-Th. intermedium addition lines, involving the chromosomes 1St-JS, 2St, 2St-JS, 3St, 4J, 4St, 5St, 5J.St, 6JS.J, and 7JS. Above all, the stable wheat-Th. intermedium small segmental translocation lines with chromosomes 4DS.4DL-4StL-4DL-4JL and 4DS.4DL-4StL-4DL were selected. Combining data from specific marker amplification and resistance evaluation, we mapped the gene(s) for resistance to powdery mildew and stripe rust in the 233.56–329.88 Mb region of the long arm of the 4St chromosome from the reference Th. intermedium genome. The new wheat-Th. intermedium introgressions will be used as novel germplasm for breeding purposes.

1. Introduction

As one of the three most important food crops, common wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is cultivated widely in the world, providing the staple food source for 30% of the global population [1]. The production of wheat is seriously affected by many diseases such as powdery mildew and rusts. Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), and stripe rust (yellow rust), caused by Puccinia striiformis f. sp. tritici (Pst), are two serious diseases that frequently occur in most wheat-growing regions subject to moderate temperatures and rainy conditions [2,3] and result in a huge loss of wheat yield [4]. The development and cultivation of resistant cultivars is regarded as the most economical, effective and environmentally friendly approach to control these diseases. Although considerable numbers of powdery mildew and stripe rust resistance genes have been identified and used in wheat breeding [5,6], many previously resistant wheat varieties are becoming susceptible due to the continuous appearance of new pathogen races [7,8]. For instance, there are 17 stripe rust resistance genes and 41 powdery mildew resistance genes with the official name originated from wild species of wheat [9]. Among them, genes such as Pm8, Yr9 and Yr17 have completely or partially lost their effectiveness [10,11]. It is thus essential to discover and exploit novel resistant sources for cultivar improvement via the wide hybridization of wheat with uncultivated species.
The intermedium wheatgrass (previously termed Agropyron intermedium) Thinopyrum intermedium (Host) Barkworth & D.R. Dewey (2n = 6x = 42, JJJSJSStSt) is an allohexaploid perennial species with a native distribution throughout the Mediterranean and Eastern Europe [12]. It possesses many potentially useful agronomic characteristics, such as stress tolerance and disease resistance, that could be used for wheat improvement [13,14]. Because of its high crossability with common wheat, researchers have developed a series of wheat-Th. intermedium partial amphiploids and a number of wheat-Thinopyrum chromosome addition, substitution and translocation lines in the past few decades [15,16]. Several genes for improving disease resistance and seed quality have been transferred into wheat from Th. intermedium through interspecific hybridization [16,17,18,19]. For example, two powdery mildew resistance genes, Pm40 and Pm43, and one stripe rust resistance gene, Yr50, which were derived from intermediate wheatgrass, have been mapped to chromosomes 7BS, 2DL and 4BL, respectively [20,21,22]. The introgressed Th. intermedium chromosome fragment can be identified and tracked by genomic in situ hybridization (GISH), fluorescence in situ hybridization (FISH), molecular marker analysis, SNP array analysis, etc. [23,24,25].
However, the efficiency of identifying individual Th. intermedium chromosomes in a wheat background is relatively low, since it takes a lot of time to assign polyploid alien chromosomes to specific homoeologous linkage groups and sub-genomes. For example, Yu et al. [26] identified two new wheat-Th. intermedium addition lines, Hy36 and Hy37, by 350 PLUG markers, 890 CINAU markers and 90K iSelect SNP array, and the results confirmed that the added chromosomes in Hy36 and Hy37 were 5JSS.3StS and 5JS.3StS, respectively. Given the complex genomic composition of Th. intermedium and numerous chromosomal rearrangements among three sub-genomes, we built a new combination of oligonucleotide probes and Oligo-FISH painting system to improve the identification efficiency of Th. intermedium chromosomes [26,27]. Two wheat-Th. intermedium partial amphiploids, TAI7045 and 78784, displayed high resistance to several fungal diseases including powdery mildew and stripe rust [18,27]. The objectives of the present study were to develop a set of wheat-Th. intermedium introgression lines from TAI7045 and 78784 and map the resistance gene(s) into specific Th. intermedium regions, which will potentially be useful for wheat germplasm innovation.

2. Results

2.1. Comparative Analysis of Karyotype between TAI7045 and 78784

The alien chromosomal constitution of two wheat-Th. intermedium partial amphiploids, TAI7045 (2n = 56) and 78784 (2n = 56), has been determined by the bulked Oligo-based FISH painting and ND-FISH in our previous study [27]. Seven pairs of Th. intermedium chromosomes of TAI7045 and 78784 can be identified using probes Oligo-B11, Oligo-pSc119.2-1 and Oligo-pTa535-1, the former as linkage groups 1St-JS, 2St, 3JS, 4J, 5J.St, 6JS.J and 7JS and the latter as linkage groups 1St-JS, 2St.JS, 3St, 4St, 5St, 6JS.J and 7JS (Figure 1). The chromosomes 1St-JS and 5J.St from TAI7045 and the chromosomes 1St-JS, 3St and 5St from 78784 can be distinguished easily with the probes Oligo-pTa71-2 and Oligo-pSc200 (Figure S1), and two 1St-JS chromosomes displayed different green bands labeled with Oligo-pSc200.
Strikingly, we also observed a pair of identical wheat-Th. intermedium intercalary translocation chromosomes in TAI7045 and 78784, tentatively named 4D-Th. The introgressed Th. intermedium chromosome segments were identified using the probe Oligo-B11, and it produced signals on the sub-telomeric regions in the long arm of 4D-Th (Figure 1a,i). Four newly developed probes, Oligo-7v108, Oligo-Dv86, Oligo-v03-86 and Oligo-Ae369, could be used for detecting different regions of the 4D chromosomes, particularly on its long arm (Figure S2 and Figure 1i). Probe Oligo-Ae369 could generate two adjacent strong signals on the 4DL; however, the long arms of 4D-Th chromosomes only showed one distinct Oligo-Ae369 signal away from the end. It is noteworthy that the 4D-Th chromosomes retained a weak Oligo-7v108 signal on the end of its long arm, which indicated the interstitial deficiency of 4DL. In addition, two visible differences in wheat chromosomes between TAI7045 and 78784 were detected with the probe Oligo-D, and four varied wheat chromosomes 1A-W and 2D-W in TAI7045 are shown in Figure 1i. One small D-genome chromosome segment was translocated interstitially into in the 1AL, and the recombinant chromosome 2D-W displayed a large deletion on 2DL.

2.2. Transmission of Thinopyrum Chromosomes and Identification of Stable Wheat-Th. intermedium-Derived Lines

The combination of the four probes Oligo-pSc119.2-1, Oligo-pTa535-1, Oligo-pTa71-2 and Oligo-pSc200 was applied to identify wheat and Th. intermedium chromosomes of individual plants from TAI7045- and 78784-derived progenies (Figure S3). A total of 314 F2 plants from the cross TAI7045/MY11 and 308 F2 plants from the cross 78784/MY11 were karyotypically analyzed using ND-FISH. The chromosomal numbers of two F2 populations were distributed from 39 to 54 (Figure 2). Plants possessing chromosome numbers less than 42 may be due to the abnormal meiotic behavior of wheat chromosomes affected by Thinopyrum chromatin introgression. In F2, the chromosomes 5J.St from TAI7045 and the chromosomes 4St from 78784 showed the highest transmission frequencies, 18.45% and 16.07%, in seven linkage groups, respectively. Chromosomes 7JS with relatively low transmission frequencies (12.07% and 12.33%) were also observed in the two F2 populations.
Meanwhile, a total of 72 and 61 F2 progenies were selected from the hybrids of TAI7045/MY11 and 78784/MY11, respectively. The seeds carrying one or two alien chromosomes were performed for karyotypic analysis using ND-FISH. In the F3 of TAI7045/MY11, except for 3JS chromosomes, the wheat-Th. intermedium 1St-JS, 2St, 6JS.J and 7JS disomic addition lines and 4J and 5J.St monosomic addition lines were successfully obtained (Figure S4). The wheat-Th. intermedium 1St-JS, 2St-JS, 3St, 4St and 6JS.J disomic addition lines and 5St and 7JS monosomic addition lines were also gained from the F3 populations of the cross 78784/MY11 (Figure S5). These novel wheat-Th. intermedium-derived lines are expected to benefit the genetic resource research and development of Th. intermedium. Moreover, we found some wheat-wheat chromosomal rearrangement events in the F3, such as 4BS.4AL and 4AS.4BL (Figure S5f,h), 3BS.5AS and 3BL.5AL (Figure S5j), 5BS.7BS and 5BL.7BL translocation chromosomes (Figure S5k), which may be caused by the introduction of Th. intermedium chromosomes in the wheat background.

2.3. ND-FISH of Two Distinct Wheat-Th. intermedium Translocation Lines by Multiple Oligo Probes

In addition to the above-mentioned wheat-Th. intermedium addition lines, we also identified two distinct wheat-Th. intermedium translocation lines WT4D-1 and WT4D-2 in F3 to F5 from the crosses TAI7045/MY11 and 78784/MY11, respectively. Sequential multi-color ND-FISH with eight probes, Oligo-B11, Oligo-D, Oligo-pSc119.2-1, Oligo-pTa535-1, Oligo-7v108, Oligo-Dv86, Oligo-v03-86 and Oligo-Ae369, was conducted to characterize the cytologically stable lines WT4D-1 and WT4D-2 (Figure 3). Probes Oligo-B11 and Oligo-D showed the occurrence of two translocation chromosomes between the Th. intermedium genomes and D-genome, and probes Oligo-pSc119.2-1 and Oligo-pTa535-1 further revealed the breakpoints located in the long arms of 4D chromosomes. Compared with the 4D chromosomes, the chromosomes WT4D-1 added weak Oligo-pSc119.2-1 signals on the telomeres of the long arm, while the chromosomes WT4D-2 reserved Oligo-7v108 signals located on the end of 4DL (Figure S1 and Figure 3b,g). The chromosomes WT4D-1 and WT4D-2 only carried one FISH pattern of Oligo-Ae369, which indicated the partial deletion of 4DL. Based on the cytogenetic analysis of the lines WT4D-1 and WT4D-2 and their respective parents, we posit that the chromosomes WT4D-1 might derive from the recombination between 4D-Th and 4J in TAI7045, while the chromosomes WT4D-2 were the same as the 4D-Th of 78784 in FISH patterns.

2.4. Molecular Marker Analysis for Structure of Chromosomes WT4D-1 and WT4D-2

In order to map the breakage-fusion structure of the chromosomes 4D-Th in TAI7045 and 78784, as well as the translocated chromosomes in lines WT4D-1 and WT4D-2 (Figure 4), 60 PLUG markers of wheat homoeologous group 4 specific [28], 89 CINAU markers derived from Dasypyrum villosum chromosome 4VL [29], and 58 Thi-specific markers from Th. intermedium 4St and/or 4J chromosomes [30] were used with their corresponding location blasted on the updated reference genomes of wheat (https://urgi.versailles.inra.fr/download/iwgsc/IWGSC_RefSeq_Assemblies/v2.0/, accessed on 12 April 2024) and Thinopyrum intermedium V3.1 (https://phytozome-next.jgi.doe.gov/info/Tintermedium_v3_1, accessed on 12 April 2024), respectively. The results showed that an intercalary deletion (flanking TNAC1407-CINAU1284) occurred in the chromosomes 4DL in lines 7045, 78784, WT4D-1 and WT4D-2 (Figure 4). The BLAST search showed that the proximal breakpoint may be located in the region of 420.35–425.06 Mb, while the distal breakpoint is in the region of 473.81–474.38 Mb of 4D (Figure 5). Compared to the chromosomes 4D-Th and WT4D-2, the chromosome WT4D-1 still presented a small terminal deficiency (covered TNAC1391 and Oligo-7v108) in the end of 4DL.
Subsequently, we analyzed the Th. intermedium-specific amplification patterns of the DNA from TAI7045, 78784, WT4D-1 and WT4D-2. A total of 41 markers produced the 4St-specific polymorphic bands in WT4D-1, WT4D-2, TAI7045, 78784 and WT78-4 (4St addition line) (Table S1). Of them, 34 markers could be located into the physical intervals 233.56–329.88 Mb of the chromosome 4St by blasting the reference genomic sequences Thinopyrum intermedium V3.1 (https://phytozome-next.jgi.doe.gov/info/Tintermedium_v3_1, accessed on 12 April 2024) (Figure 6c). Above all, the PCR of marker C10-56 produced a 4St-specific fragment size of 120 bp (Figure 4). The physical location of these 4St-specific markers indicated that the C10-56 may be closed to the breakpoint of 4St insertion (Figure 5 and Figure 6c). One pair of TNAC1391 primers generated 4J-specific bands in WT4D-1 and TAI7045, but not in WT4D-2 and 78784, which was located on the distal part of the long arm of the chromosome 4J (487.81 Mb). The ND-FISH results and molecular marker surveys indicated that the wheat-Th. intermedium translocation chromosomes WT4D-1 and WT4D-2 were 4DS.4DL-4StL-4DL-4JL and 4DS.4DL-4StL-4DL, respectively.

2.5. Powdery Mildew and Stripe Rust Reactions for the Wheat-Th. intermedium Lines

The wheat-Th. intermedium lines and their parents were inoculated with Pst races CYR32, CYR33, and CYR34 at the adult plant stage in the field. The wheat parent MY11 was highly susceptible to all of these stripe rust pathotypes, and its infection type (IT) was scored as 4, while two wheat-Th. intermedium partial amphiploids TAI7045 and 78784 were highly immune to the mixture of Pst races (IT = 0) (Figure 6a). The difference between two wheat-Th. intermedium introgression lines, 1St-JS (TAI7045) and 1St-JS (78784), in stripe rust resistance was scored, which may be caused by the structure of two chromosomes in the end of the long arm (Figure S1). The plants carrying 3St, 4J, 5J.St, 5St or 6JS.J had higher ITs (3 or 4) (Table 1). Plants with 2St, 2St-JS, 4St and 7JS chromosomes displayed high resistance for all Pst races tested (IT = 0–1). Noticeably, the recombinant lines WT4D-1 and WT4D-2 showed high Pst resistances as TAI70445 and 78784, indicating that the Yr locus originated from the 4St chromosome segment.
The lines WT4D-1 and WT4D-2 and their parents were further evaluated for resistance to powdery mildew in the greenhouse. The seedling ITs to powdery mildew were scored when the susceptible control MY11 was fully infected (IT = 4). In this stage, the lines WT4D-1 and WT4D-2 were susceptible to Bgt isolates with infection types 3–4. However, both of them displayed fully resistance (IT = 0;) from the five-leaf stage, indicating that they may have adult plant resistance (APR) (Figure 6b, Table 1). These results suggest that the Th. intermedium chromosome 4StL carries an excellent gene makeup for powdery mildew and stripe rust resistance and may be physically localized in the region 233.56–329.88 Mb. The chromosomal location of the resistance gene(s) will be verified using linkage analysis in future studies.

3. Discussion

Transferring desirable genes from wild relatives by interspecific hybridization is an important approach for broadening the genetic diversity of wheat [31,32]. A great number of wheat-alien species derivatives have been developed via distant hybridizations and chromosome engineering in the past few decades. However, the identification efficiency is relatively low in earlier research due to the complexity of the genomic composition, such as the allohexaploid species Th. intermedium [13,15,16,33,34]. Combining Oligo-FISH painting and ND-FISH using multiple oligo probes, we established an efficient system for precisely distinguishing Th. intermedium chromosome segments from wheat [27]. Based on this system, we screened a set of wheat-Th. intermedium addition lines from two hybrid populations, TAI7045/MY11 and 78784/MY11, in F3 generation. Although some introgressed complete Th. intermedium chromosomes carrying excellent genes, involving 2St, 3St, 4St, 4J and 7JS, have been reported in previous studies, they have different origins [16,23,35,36,37]. Han et al. [34] and Hu et al. [36] re-characterized a wheat-Th. intermedium addition line Z2 and found that it contained a substitution of one pair of 2D chromosomes by a pair of Th. intermedium chromosomes 2St-JS. In this study, five new wheat-Th. intermedium derivatives, including 1St-JS (TAI7045), 1St-JS (78784), 5St, 5J.St and 6JS.J, were found to cover several segments of the Th. intermedium genome, which can be important bridge materials for the excavation of Th. intermedium genetic resources.
Previous studies have suggested that the introduction of alien chromosomes may lead to structural variations of common wheat chromosomes [38,39]. Cui et al. [40] identified different types of chromosomal structural variation from three octoploid Trititrigia accessions (TE261-1, TE266-1, and TE346-1), which occurred in the chromosomes 1A, 6A, 6B, 2D and 7D. In the present study, two types of wheat recombinant chromosomes involving chromosomes 1A and 2D were also observed in TAI7045 (Figure 1), and a number of wheat chromosomal rearrangement events were detected in two hybrid populations (Figure S5). In addition, we also found two novel wheat-Th. intermedium insertional translocation chromosomes, T4DS.4DL-4StL-4DL and T4DS.4DL-4StL-4DL-4JL, which could be characterized by sequential ND-FISH with four newly developed probes and molecular marker analysis. We found that four markers including C10-56 were previously located in 4J by genetic mapping and comparison to the assembly of Th. intermedium v1.0 [30]; however, they were mapped on 4St by blasting for the updated Th. intermedium genome v3.1 and confirmed by PCR analysis in the present study (Figure 4, Table S1). It is thus pertinent to note that the combination of bioinformatic, cytogenetic and molecular analysis would be useful for precise identification of wheat-Thinopyrum introgression lines. The translocated chromosome T4DS.4DL-4StL-4DL from TAI7045 and 78784 has been transferred into common wheat individually. Another translocated chromosome was generated via the homoeologous chromosomal recombination between the chromosomes T4DS.4DL-4StL-4DL and 4J in the process of TAI7045/MY11. This may be due to a close relationship between Th. intermedium and Aegilops tauschii, and the chromosomes of linkage group 4 in wheat and Th. intermedium are highly prone to recombination [16,25,41].
The homoeologous group-4 chromosomes of the Thinopyrum species possess many desirable sources, such as a perennial habit, blue-grained characteristic, and resistance to stripe rust, powdery mildew, eyespot (Tapesia yallundae), etc. [42,43,44]. For example, Li et al. [45] found that the Th. intermedium chromosome 4Ai#2S (originating from Ag. intermedium, the Max Plank Institute in Germany) carries the eyespot-resistant gene(s). The 4Ai#2S.4DL translocation lines displayed superior resistance to WSMV (Wheat Streak Mosaic Virus) [46,47]. Two putative Th. intermedium-derived resistance genes, Yr50 and pmCH89, were mapped on wheat chromosome arm 4BL [18,22]. Li et al. [16] and Li et al. [25] located the resistance gene(s) to stripe rust on FL0.60-1.00 of the 4JSS and on FL0-0.60 of the 4JSL, respectively. Gong et al. [48] developed a new wheat-Th. scirpeum 4E (4D) chromosomal substitution line (K16-730-3) that is resistant to stripe rust and powdery mildew. In the present study, we identified two stable wheat-Th. intermedium small segmental translocation lines, WT4D-1 and WT4D-2, and found that they are highly resistant to stripe rust and powdery mildew at the adult stage. Combining data from cytogenetic analysis and specific marker amplification, the resistant gene(s) for the two fungi was mapped in the 233.56-329.88 Mb region of 4StL. However, Li et al. [16] observed that the addition line L4 with a 4Ai#1 (originating from Ag. intermedium accession no. 75) chromosome (St-genome) was susceptible to stripe rust. This phenomenon is probably due to the chromosome 4St originating from different Th. intermedium subspecies, indicating that the exploitation of diversified wheat-Th. intermedium introgression lines remains necessary.

4. Materials and Methods

4.1. Plant Materials

Wheat-Th. intermedium partial amphiploids TAI7045 and 78784 were kindly provided by Dr. Zhijian Chang, Shanxi Academy of Agricultural Sciences, China. Wheat lines Chinese Spring (CS) and Mianyang11 (MY11) and the nullisomic–tetrasomic (NT) lines of the cultivars CS [49] and X24C10 (4J/4B substitution) [16] are maintained by the Center for Informational Biology, School of Life Science and Technology, University of Electronic Science and Technology of China. Two crosses, TAI7045/MY11 and 78784/MY11, were created, and the F2 plants were used to detect the transmission of Thinopyrum chromosomes, and partial amphiploids of F3, originating from 133 F2 plants with one or two alien chromosomes, were used to screen the stable wheat-Th. intermedium-derived lines. Two wheat-Th. intermedium translocation lines, WT4D-1 and WT4D-2, were also identified in F3, and the selfing progenies (F4 and F5) were examined using cytogenetic analysis.

4.2. Oligonucleotide Probes Development

Four new oligonucleotide probes for ND-FISH were designed based on the recently reported D. villosum genome [50] and Ae. speltoides genome [51] sequences, referring to the method described by Lang et al. [52]. Six previously reported oligo probes including Oligo-pSc119.2-1 and Oligo-pTa535-1 [53], Oligo-D [54] and Oligo-B11 [55] were also used in this study for karyotype analysis. All oligo probe sequences are listed in Table 2. Oligonucleotide probes were labeled with 6-carboxyfluorescein (6-FAM) or 6-carboxytetramethylrhodamine (TAMRA), synthesized by Shanghai Invitrogen Biotechnology Co. Ltd. (Shanghai, China).

4.3. ND-FISH and Sequential ND-FISH

The chromosome spreads of materials were carried out according to the procedure of Han et al. [57]. ND-FISH by the synthesized probes was performed as described by Fu et al. [56] with some modifications. The slides were counter-stained with DAPI (4′,6-diamidino-2-phenylindole) and examined using an Olympus BX-51 microscope (Shinjuku, Tokyo, Japan). Microphotographs of ND-FISH chromosomes were captured using a cooled DP70 CCD camera. Sequential ND-FISH was conducted on the same slide with different probes following the description by Wang et al. [58]. All images were optimized using Adobe Photoshop CS6 software (Adobe Systems Incorporated, San Jose, CA, USA).

4.4. Molecular Marker Analysis

Genomic DNA was extracted from young leaves of CS, MY11, TAI7045, 78784 and derived lines using a sodium dodecyl sulfate (SDS) protocol [59]. PCR-based Landmark Unique Gene (PLUG) primers [29], the CINAU (Cytogenetics Institute, Nanjing Agricultural University, Nanjing, China) primers [30] and the Th. intermedium (Thi)-specific markers [31] were designed and used for the physical location in specific chromosomes. An integrated physical map of molecular markers (including oligo probes) was constructed by searching the database of Wheat Genome Assembly ref. v2.0 from https://urgi.versailles.inra.fr/download/iwgsc/IWGSC_RefSeq_Assemblies/v2.0/ (accessed on 12 April 2024) and Thinopyrum intermedium v3.1 DOE-JGI from https://phytozome-next.jgi.doe.gov/info/Tintermedium_v3_1 (accessed on 12 April 2024) as described by Lang et al. [35] and Yu et al. [26]. Polymerase chain reaction (PCR), restriction enzyme digestion of the amplified products and nondenaturing polyacrylamidegel electrophoresis (PAGE) were conducted according to the description by Yu et al. [26].

4.5. Powdery Mildew and Stripe Rust Response Observations

To survey the phenotype of lines to powdery mildew and stripe rust, we used local mixed Bgt isolates and a mixture of Pst races CYR32, CYR33 and CYR34, respectively. The inoculation of Bgt were carried out at the four-leaf stage in a greenhouse at 22 °C and photoperiod of 14 h of light per day, and the APR response was recorded at 20 days post-inoculation; refer to Mohler et al. [60]. Stripe rust reactions were observed at the heading and grain-filling stages in the field at the Xindu Experimental Station, Chengdu, China; refer to Li et al. [7]. The powdery-mildew- and stripe-rust-susceptible cultivar Mianyang 11 (MY11) was examined as a control. Resistance testing was carried out on the F3 generation, with ten plants assessed for each of the lines. ITs were scored according to the system described by Bariana and McIntosh [61].

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/plants13162333/s1: Figure S1: The karyotype analysis for the Th. intermedium chromosomes of TAI7045 (left) and 78784 (right) with probes Oligo-pSc119.2-1, Oligo-pTa535-1, Oligo-pDb12H, Oligo-pTa71-2 and Oligo-pSc200. Figure S2: Non-denaturing FISH of the common wheat MY11. The probes for sequential ND-FISH were Oligo-pSc119.2-1 (green) + Oligo-pTa535-1 (red) (a), Oligo-7v108 (green) + Dv86 (red) (b), Oligo-v03-86 (green) + Ae369 (red) (c), Oligo-v03-86 (green) (d), and Ae369 (red) (e). The 4D chromosomes are shown (f). Bars represent 10 μm. Figure S3: ND-FISH of the plants of F2 progenies from the two crosses TAI7045/MY11 (a–d) and 78784/MY11 (e–h) with the probes Oligo-pSc119.2-1 (green), Oligo-pTa535-1 (red), Oligo-pTa71-2 (red) and Oligo-pSc200 (green). The plants TAI7045-MY11-237 (2n = 44) (a), TAI7045-MY11-200 (2n = 48) (b), TAI7045-MY11-130 (2n = 50) (c), TAI7045-MY11-232 (2n = 53) (d), 78784-MY11-178 (2n = 43) (e), 78784-MY11-241 (2n = 45) (f), 78784-MY11-311 (2n = 47) (f), and 78784-MY11-205 (2n = 51) (h) were selected for displaying the variation in chromosome numbers and the transmission of Thinopyrum chromosomes. Bars represent 10 μm. Figure S4: Cytogenetic characterization of Thinopyrum chromosome introgression lines from F3 generations of the cross TAI7045/MY11. The introgressed Thinopyrum chromosomes 1St-JS (a,b), 2St (c,d), 4J (e), 5J.St (f), 6JS.J (g), and 7JS (h). Yellow arrows and text notes indicate the Thinopyrum chromosomes. Bars represent 10 μm. Figure S5: Cytogenetic characterisation of Thinopyrum chromosome introgression lines from F3 generations of the cross 78784/MY11. The introgressed Thinopyrum chromosomes 1St-JS (a,b), 2St-JS (c,d), 3St (e,f), 5St (g,h), 4St (i), 6JS.J (g), and 7JS (h). Yellow arrows and text notes indicate the Thinopyrum chromosomes. Bars represent 10 μm. Table S1: Sequences of 42 pairs of Thinopyrum intermedium chromosome 4St-specific primers in WT4D-1 and WT4D-2.

Author Contributions

Z.Y. (Zhihui Yu), Z.Z. and H.W. performed the experiments; G.L. developed the materials; H.W. wrote the draft of the manuscript; Z.Y. (Zujun Yang) revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This project was supported by National Natural Science Foundation of China (31971886), International Cooperation Program (2022YFH0012) of the Science and Technology Department of Sichuan, the Natural Science Foundation of Shandong province of China (No. ZR2023QC307).

Data Availability Statement

Data are contained within the article or Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. International Wheat Genome Sequencing Consortium (IWGSC). A chromosome-based draft sequence of the hexaploid bread wheat (Triticum aestivum) genome. Science 2014, 345, 1251788. [Google Scholar] [CrossRef] [Scilit]
  2. Morgounov, A.; Tufan, H.A.; Sharma, R.; Akin, B.; Bagci, A.; Braun, H.J.; Kaya, Y.; Keser, M.; Payne, T.S.; Sonder, K.; et al. Global incidence of wheat rusts and powdery mildew during 1969–2010 and durability of resistance of winter wheat variety bezostaya 1. Eur. J. Plant Pathol. 2012, 132, 323–340. [Google Scholar] [CrossRef] [Scilit]
  3. Chen, W.Q.; Wellings, C.; Chen, X.M.; Kang, Z.S.; Liu, T.G. Wheat stripe (yellow) rust caused by Puccinia striiformis f. sp. tritici. Mol. Plant Pathol. 2014, 15, 433–446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Savary, S.; Willocquet, L.; Pethybridge, S.J.; Esker, P.; McRoberts, N.; Nelson, A. The global burden of pathogens and pests on major food crops. Nat. Ecol. Evol. 2019, 3, 430–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. McIntosh, R.A.; Dubcovsky, J.; Rogers, W.J.; Xia, X.C.; Raupp, W.J. Catalogue of gene symbols for wheat. Ann. Wheat Newsl. 2018, 64 (Suppl. S19), 73–93. [Google Scholar]
  6. Tan, C.; Li, G.; Cowger, C.; Carver, B.F.; Xu, X. Characterization of Pm63, a powdery mildew resistance gene in Iranian landrace PI 628024. Theor. Appl. Genet. 2019, 132, 1137–1144. [Google Scholar] [CrossRef] [Scilit]
  7. Li, G.R.; Tang, L.R.; Yin, Y.; Zhang, A.H.; Yu, Z.H.; Yang, E.N.; Tang, Z.X.; Fu, S.L.; Yang, Z.J. Molecular dissection of Secale africanum chromosome 6Rafr in wheat enabled localization of genes for resistance to powdery mildew and stripe rust. BMC Plant Biol. 2020, 20, 134. [Google Scholar] [CrossRef] [Scilit]
  8. Baker, L.; Grewal, S.; Yang, C.Y.; Hubbart-Edwards, S.; Scholefield, D.; Ashling, S.; Burridge, A.J.; Przewieslik-Allen, A.M.; Wilkinson, P.A.; King, I.P.; et al. Exploiting the genome of Thinopyrum elongatum to expand the gene pool of hexaploid wheat. Theor. Appl. Genet. 2020, 133, 2213–2226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Liu, C.; Han, R.; Wang, X.L.; Gong, W.P.; Cheng, D.G.; Cao, X.Y.; Liu, A.F.; Li, H.S.; Liu, J.J. Research progress of wheat wild hybridization, disease resistance genes transfer and utilization. Sci. Agric. Sin. 2020, 53, 1287–1308. [Google Scholar]
  10. Wan, A.M.; Zhao, Z.H.; Chen, X.M.; He, Z.H.; Jin, S.L.; Jia, Q.Z.; Yao, G.; Yang, J.X.; Wang, B.T.; Li, G.B.; et al. Wheat stripe rust epidemic and virulence of Puccinia striiformis f. sp. tritici in China in 2002. Plant Dis. 2004, 88, 896–904. [Google Scholar] [CrossRef] [Scilit]
  11. Zhang, H.T.; Guan, H.Y.; Li, J.T.; Zhu, J.; Xie, C.J.; Zhou, Y.L.; Duan, X.Y.; Yang, T.; Sun, Q.X.; Liu, Z.Y. Genetic and comparative genomics mapping reveals that a powdery mildew resistance gene Ml3D232 originating from wild emmer co-segregates with an NBS-LRR analog in common wheat (Triticum aestivum L.). Theor. Appl. Genet. 2010, 121, 1613–1621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Tsvelev, N.N.; Fedorov, A.A. Grasses of the Soviet Union; Oxonian Press Pvt. Ltd.: New Delhi, India, 1983; pp. 196–298. [Google Scholar]
  13. Bao, Y.G.; Wu, X.; Zhang, C.; Li, X.F.; He, F.; Qi, X.L.; Wang, H.G. Chromosomal constitutions and reactions to powdery mildew and stripe rust of four novel wheat-Thinopyrum intermedium partial amphiploids. J. Genet. Genom. 2014, 41, 663–666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Zhang, X.; Cui, C.H.; Bao, Y.G.; Wang, H.G.; Li, X.F. Molecular cytogenetic characterization of a novel wheat-Thinopyrum intermedium introgression line tolerant to phosphorus deficiency. Crop J. 2020, 9, 816–822. [Google Scholar] [CrossRef] [Scilit]
  15. Chen, Q.; Conner, R.L.; Laroche, A.; Ji, W.; Armstrong, K.C.; Fedak, G. Genomic in situ hybridization analysis of Thinopyrum chromatin in a wheat-Th. intermedium partial amphiploid and six derived chromosome addition lines. Genome 1999, 42, 1217–1223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Li, J.B.; Lang, T.; Li, B.; Yu, Z.H.; Wang, H.J.; Li, G.; Yang, E.N.; Yang, Z.J. Introduction of Thinopyrum intermedium ssp. trichophorum chromosomes to wheat by trigeneric hybridization involving Triticum, Secale and Thinopyrum genera. Planta 2017, 245, 1121–1135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Fedak, G.; Chen, Q.; Conner, R.L.; Laroche, A.; Petroski, R.; Armstrong, K.W. Characterization of wheat-Thinopyrum partial amphiploids by meiotic analysis and genomic in situ hybridization. Genome 2000, 43, 712–719. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Hou, L.Y.; Zhang, X.J.; Li, X.; Jia, J.Q.; Yang, H.Z.; Zhan, H.X.; Qiao, L.Y.; Guo, H.J.; Chang, Z.J. Mapping of powdery mildew resistance gene pmCH89 in a putative wheat-Thinopyrum intermedium introgression line. Int. J. Mol. Sci. 2015, 16, 17231–17244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Yang, G.T.; Zhang, N.; Boshoff, W.H.P.; Li, H.W.; Li, B.; Li, Z.S.; Zheng, Q. Identification and introgression of a novel leaf rust resistance gene from Thinopyrum intermedium chromosome 7JS into wheat. Theor. Appl. Genet. 2023, 136, 231. [Google Scholar] [CrossRef] [Scilit]
  20. Luo, P.G.; Luo, H.Y.; Chang, Z.J.; Zhang, H.Y.; Zhang, M.; Ren, Z.L. Characterization and chromosomal location of Pm40 in common wheat: A new gene for resistance to powdery mildew derived from Elytrigia intermedium. Theor. Appl. Genet. 2009, 118, 1059–1064. [Google Scholar] [CrossRef] [Scilit]
  21. He, R.L.; Chang, Z.J.; Yang, Z.J.; Zhan, H.X.; Zhang, X.J.; Liu, J.X. Inheritance and mapping of powdery mildew resistance gene Pm43 introgressed from Thinopyrum intermedium into wheat. Theor. Appl. Genet. 2009, 118, 1173–1180. [Google Scholar] [CrossRef] [Scilit]
  22. Liu, J.; Chang, Z.J.; Zhang, X.J.; Yang, Z.J.; Li, X.; Jia, J.Q.; Zhan, H.X.; Guo, H.J.; Wang, J.M. Putative Thinopyrum intermedium-derived stripe rust resistance gene Yr50 maps on wheat chromosome arm 4BL. Theor. Appl. Genet. 2013, 126, 265–274. [Google Scholar] [CrossRef] [Scilit]
  23. Wang, S.W.; Wang, C.Y.; Feng, X.B.; Zhao, J.X.; Deng, P.C.; Wang, Y.J.; Zhang, H.; Liu, X.L.; Li, T.D.; Chen, C.H.; et al. Molecular cytogenetics and development of St-chromosome-specific molecular markers of novel stripe rust resistant wheat-Thinopyrum intermedium and wheat-Thinopyrum ponticum substitution lines. BMC Plant Biol. 2022, 22, 111. [Google Scholar] [CrossRef] [Scilit]
  24. Zhang, X.J.; Li, J.B.; Ge, Y.D.; Guan, H.X.; Li, G.R.; Zhang, S.W.; Wang, X.L.; Li, X.; Chang, Z.J.; Zhang, P.; et al. Molecular cytogenetic characterization of a new wheat-Thinopyrum intermedium homoeologous group-6 chromosome disomic substitution line with resistance to leaf rust and stripe rust. Front. Plant Sci. 2022, 13, 1000281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Li, G.R.; Chen, Q.H.; Jiang, W.X.; Zhang, A.H.; Yang, E.N.; Yang, Z.J. Molecular and cytogenetic identification of wheat-Thinopyrum intermedium double substitution line-derived progenies for stripe rust resistance. Plants 2022, 12, 28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Yu, Z.H.; Wang, H.J.; Xu, Y.F.; Li, Y.S.; Lang, T.; Yang, Z.J.; Li, G.R. Characterization of chromosomal rearrangement in new wheat-Thinopyrum intermedium addition lines carrying Thinopyrum-specific grain hardness genes. Agronomy 2019, 9, 18. [Google Scholar] [CrossRef] [Scilit]
  27. Yu, Z.H.; Wang, H.J.; Yang, E.N.; Li, G.R.; Yang, Z.J. Precise identification of chromosome constitution and rearrangements in wheat–Thinopyrum intermedium derivatives by ND-FISH and Oligo-FISH painting. Plants 2022, 11, 2109. [Google Scholar] [CrossRef] [Scilit]
  28. Ishikawa, G.; Nakamura, T.; Ashida, T.; Saito, M.; Nasuda, S.; Endo, T.R.; Wu, J.Z.; Matsumoto, T. Localization of anchor loci representing five hundred annotated rice genes to wheat chromosomes using PLUG markers. Theor. Appl. Genet. 2009, 118, 499–514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Wang, H.Y.; Dai, K.L.; Xiao, J.; Yuan, C.X.; Zhao, R.H.; Doležel, J.; Wu, Y.F.; Cao, A.Z.; Chen, P.D.; Zhang, S.Z.; et al. Development of intron targeting (IT) markers specific for chromosome arm 4VS of Haynaldia villosa by chromosome sorting and next-generation sequencing. BMC Genom. 2017, 18, 167. [Google Scholar] [CrossRef] [Scilit]
  30. Qiao, L.Y.; Liu, S.J.; Li, J.B.; Li, S.J.; Yu, Z.H.; Liu, C.; Li, X.; Liu, J.; Ren, Y.K.; Zhang, P.; et al. Development of sequence-tagged site marker set for identification of J, JS, and St sub-genomes of Thinopyrum intermedium in wheat background. Front. Plant Sci. 2021, 12, 685216. [Google Scholar] [CrossRef] [Scilit]
  31. Chen, Q.; Conner, R.L.; Li, H.J.; Sun, S.C.; Ahmad, F.; Laroche, A.; Graf, R.J. Molecular cytogenetic discrimination and reaction to wheat streak mosaic virus and the wheat curl mite in Zhong series of wheat-Thinopyrum intermedium partial amphiploids. Genome 2003, 46, 135–145. [Google Scholar] [CrossRef] [Scilit]
  32. Sepsi, A.; Molnár, I.; Szalay, D.; Molnár-Láng, M. Characterization of a leaf rust-resistant wheat-Thinopyrum ponticum partial amphiploid BE-1, using sequential multicolor GISH and FISH. Theor. Appl. Genet. 2008, 116, 825–834. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. He, M.Y.; Xu, Z.Y.; Zou, M.Q.; Dawei, Z.; Zhensan, P.; Shui, H. The establishment of two sets of alien addition lines of wheat-wheatgrass. Sci. China Ser. B 1988, 32, 695–705. [Google Scholar]
  34. Han, F.P.; Fedak, G.; Benabdelmouna, A.; Armstrong, K.; Ouellet, T. Characterization of six wheat x Thinopyrum intermedium derivatives by GISH, RFLP, and multicolor GISH. Genome 2003, 46, 490–495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Lang, T.; La, S.X.; Li, B.; Yu, Z.H.; Chen, Q.H.; Li, J.B.; Yang, E.N.; Li, G.R.; Yang, Z.J. Precise identification of wheat-Thinopyrum intermedium translocation chromosomes carrying resistance to wheat stripe rust in line Z4 and its derived progenies. Genome 2018, 61, 177–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Hu, L.J.; Li, G.R.; Zhan, H.X.; Liu, C.; Yang, Z.J. New St-chromosome-specific molecular markers for identifying wheat-Thinopyrum intermedium derivative lines. J. Genet. 2012, 91, e69–e74. [Google Scholar] [CrossRef] [Scilit]
  37. Nie, L.M.; Yang, Y.N.; Zhang, J.; Fu, T.H. Disomic chromosome addition from Thinopyrum intermedium to bread wheat appears to confer stripe rust resistance. Euphytica 2019, 215, 1–8. [Google Scholar] [CrossRef] [Scilit]
  38. Rey, E.; Abrouk, M.; Keeble-Gagnère, G.; Karafiátová, M.; Vrána, J.; Balzergue, S.; Soubigou-Taconnat, L.; Brunaud, V.; Martin-Magniette, M.L.; Endo, T.R.; et al. Transcriptome reprogramming due to the introduction of a barley telosome into bread wheat affects more barley genes than wheat. Plant Biotechnol. J. 2018, 16, 1767–1777. [Google Scholar] [CrossRef] [Scilit]
  39. Wang, Y.Z.; Cao, Q.; Zhang, J.J.; Wang, S.W.; Chen, C.H.; Wang, C.Y.; Zhang, H.; Wang, Y.J.; Ji, W.Q. Cytogenetic analysis and molecular marker development for a new wheat-Thinopyrum ponticum 1JS (1D) disomic substitution line with resistance to stripe rust and powdery mildew. Front. Plant Sci. 2020, 11, 1282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Cui, Y.; Xing, P.Y.; Qi, X.L.; Bao, Y.G.; Wang, H.G.; Wang, R.R.; Li, X.F. Characterization of chromosome constitution in three wheat-Thinopyrum intermedium amphiploids revealed frequent rearrangement of alien and wheat chromosomes. BMC Plant Biol. 2021, 21, 129. [Google Scholar] [CrossRef] [Scilit]
  41. Mahelka, V.; Kopecký, D.; Paštová, L. On the genome constitution and evolution of intermediate wheatgrass (Thinopyrum intermedium: Poaceae, Triticeae). BMC Evol. Biol. 2011, 11, 127. [Google Scholar] [CrossRef] [Scilit]
  42. Lammer, D.; Cai, X.W.; Arterburn, M.; Chatelain, J.; Murray, T.; Jones, S. A single chromosome addition from Thinopyrum elongatum confers a polycarpic, perennial habit to annual wheat. J. Exp. Bot. 2004, 55, 1715–1720. [Google Scholar] [CrossRef] [Scilit]
  43. Li, Z.S.; Mu, S.M.; Zhou, H.P.; Wu, J. The establishment and application of blue-grained monosomics in wheat chromosome engineering. Cereal Res. Commun. 1986, 14, 133–137. [Google Scholar]
  44. Yang, G.T.; Deng, P.C.; Ji, W.Q.; Fu, S.L.; Li, H.W.; Li, B.; Li, Z.S.; Zheng, Q. Physical mapping of a new powdery mildew resistance locus from Thinopyrum ponticum chromosome 4AgS. Front. Plant Sci. 2023, 14, 1131205. [Google Scholar] [CrossRef] [Scilit]
  45. Li, H.J.; Arterburn, M.; Jones, S.S.; Murray, T.D. Resistance to eyespot of wheat, caused by Tapesia yallundae, derived from Thinopyrum intermedium homoeologous group 4 chromosome. Theor. Appl. Genet. 2005, 111, 932–940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Wang, R.R.; Zhang, X.Y. Characterization of the translocated chromosome using fluorescence in situ hybridization and random amplified polymorphic DNA on two Triticum aestivum-Thinopyrum intermedium translocation lines resistant to wheat streak mosaic or barley yellow dwarf virus. Chromosome Res. 1996, 4, 583–587. [Google Scholar] [CrossRef] [Scilit]
  47. Ali, N.; Heslop-Harrison, J.P.; Ahmad, H.; Graybosch, R.A.; Hein, G.L.; Schwarzacher, T. Introgression of chromosome segments from multiple alien species in wheat breeding lines with wheat streak mosaic virus resistance. Heredity 2016, 117, 114–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Gong, B.; Zhang, H.; Yang, Y.L.; Zhang, J.W.; Zhu, W.; Xu, L.L.; Wang, Y.; Zeng, J.; Fan, X.; Sha, L.; et al. Development and identification of a novel wheat-Thinopyrum scirpeum 4E (4D) chromosomal substitution line with stripe rust and powdery mildew resistance. Plant Dis. 2022, 106, 975–983. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Sears, E.R. Nullisomic-tetrasomic combinations in hexaploid wheat. In Chromosome Manipulations and Plant Genetics; Riley, R., Lewis, K.R., Eds.; Oliver and Boyd: Edinburgh, UK, 1966; pp. 29–45. [Google Scholar]
  50. Zhang, X.; Wang, H.Y.; Sun, H.J.; Li, Y.B.; Feng, Y.L.; Jiao, C.Z.; Li, M.L.; Song, X.Y.; Wang, T.; Wang, Z.K.; et al. A chromosome-scale genome assembly of Dasypyrum villosum provides insights into its application as a broad-spectrum disease resistance resource for wheat improvement. Mol. Plant 2023, 16, 432–451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Wang, X.F.; Zhang, Y.X.; Niu, Y.Q.; Sha, Y.; Wang, Z.H.; Zhang, Z.B.; Yang, J.; Liu, B.; Li, L.F. Post-hybridization introgression and natural selection promoted genomic divergence of Aegilops speltoides and the four S*-genome diploid species. Plant J. 2023, 115, 1500–1513. [Google Scholar] [CrossRef] [Scilit]
  52. Lang, T.; Li, G.R.; Wang, H.J.; Yu, Z.H.; Chen, Q.H.; Yang, E.N.; Fu, S.L.; Tang, Z.X.; Yang, Z.J. Physical location of tandem repeats in the wheat genome and application for chromosome identification. Planta 2019, 249, 663–675. [Google Scholar] [CrossRef] [Scilit]
  53. Tang, Z.X.; Yang, Z.J.; Fu, S.L. Oligonucleotides replacing the roles of repetitive sequences pAs1, pSc119.2, pTa-535, pTa71, CCS1, and pAWRC.1 for FISH analysis. J. Appl. Genet. 2014, 55, 313–318. [Google Scholar] [CrossRef] [Scilit]
  54. Xi, W.; Tang, Z.X.; Tang, S.Y.; Yang, Z.J.; Luo, J.; Fu, S.L. New ND-FISH-positive Oligo probes for identifying Thinopyrum Chromosomes in wheat backgrounds. Int. J. Mol. Sci. 2019, 20, 2031. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Tang, S.Y.; Tang, Z.X.; Qiu, L.; Yang, Z.J.; Li, G.R.; Lang, T.; Zhu, W.Q.; Zhang, J.H.; Fu, S.L. Developing new oligo probes to distinguish specific chromosomal segments and the A, B, D genomes of wheat (Triticum aestivum L.) using ND-FISH. Front. Plant Sci. 2018, 9, 1104. [Google Scholar] [CrossRef] [Scilit]
  56. Fu, S.L.; Chen, L.; Wang, Y.Y.; Li, M.; Yang, Z.J.; Qiu, L.; Yan, B.J.; Ren, Z.L.; Tang, Z.X. Oligonucleotide probes for ND-FISH analysis to identify rye and wheat chromosomes. Sci. Rep. 2015, 5, 10552. [Google Scholar] [CrossRef] [Scilit]
  57. Han, F.P.; Lamb, J.C.; Birchler, J.A. High frequency of centromere inactivation resulting in stable dicentric chromosomes of maize. Proc. Natl. Acad. Sci. USA 2006, 103, 3238–3243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Wang, H.J.; Yu, Z.H.; Li, G.R.; Yang, Z.J. Diversified chromosome rearrangements detected in a wheat–Dasypyrum breviaristatum substitution line induced by gamma-ray irradiation. Plants 2019, 14, 175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Liu, C.; Li, G.R.; Sehgal, S.K.; Jia, J.Q.; Yang, Z.J.; Friebe, B.; Gill, B.S. Genome relationships in the genus Dasypyrum: Evidence from molecular phylogenetic analysis and in situ hybridization. Plant Syst. Evol. 2010, 288, 149–156. [Google Scholar] [CrossRef] [Scilit]
  60. Mohler, V.; Stadlmeier, M. Dynamic QTL for adult plant resistance to powdery mildew in common wheat (Triticum aestivum L.). J. Appl. Genet. 2019, 60, 291–300. [Google Scholar] [CrossRef] [Scilit]
  61. Bariana, H.S.; McIntosh, R.A. Cytogenetic studies in wheat. 15. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A. Genome 1993, 36, 476–482. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Sequential ND-FISH patterns of wheat-Th. intermedium partial amphiploid TAI7045 (a,b,e, f) and 78784 (c,d,g,h) with multiple probes. The probes Oligo-B11 (green) + Oligo-D (red) (a,c), Oligo-pSc119.2-1 (green) and Oligo-pTa535-1 (red) (b,d), Oligo-7v108 (green) + Oligo-Dv86 (red) (e,g), and Oligo-v03-86 (green) + Oligo-Ae369 (red) (f,h) are presented, respectively. White arrows indicate the recombinant chromosomes in wheat background, while yellow arrows indicate the translocation chromosomes between wheat and Th. intermedium. The Th. intermedium chromosomes and recombinant chromosomes of TAI7045 and 78784 are shown (i). The period “.” means that the breakpoint of the chromosome translocation events was located in the region of the centromere, and the hyphen “-” means that the breakpoint was located in the other regions. Bars represent 10 μm.
Figure 1. Sequential ND-FISH patterns of wheat-Th. intermedium partial amphiploid TAI7045 (a,b,e, f) and 78784 (c,d,g,h) with multiple probes. The probes Oligo-B11 (green) + Oligo-D (red) (a,c), Oligo-pSc119.2-1 (green) and Oligo-pTa535-1 (red) (b,d), Oligo-7v108 (green) + Oligo-Dv86 (red) (e,g), and Oligo-v03-86 (green) + Oligo-Ae369 (red) (f,h) are presented, respectively. White arrows indicate the recombinant chromosomes in wheat background, while yellow arrows indicate the translocation chromosomes between wheat and Th. intermedium. The Th. intermedium chromosomes and recombinant chromosomes of TAI7045 and 78784 are shown (i). The period “.” means that the breakpoint of the chromosome translocation events was located in the region of the centromere, and the hyphen “-” means that the breakpoint was located in the other regions. Bars represent 10 μm.
Plants 13 02333 g001
Figure 2. Number of Thinopyrum chromosomes in F2 generation of two crosses, TAI7045/MY11 (left) and 78784/MY11 (right).
Figure 2. Number of Thinopyrum chromosomes in F2 generation of two crosses, TAI7045/MY11 (left) and 78784/MY11 (right).
Plants 13 02333 g002
Figure 3. Sequential ND-FISH of the lines WT4D-1 (ad) and WT4D-2 (eh) by multiple probes. The probes Oligo-B11 (green) + Oligo-D (red) (a,e), Oligo-pSc119.2-1 (green) + Oligo-pTa535-1 (red) (b,f), Oligo-7v108 (green) + Oligo-Dv86 (red) (c,g), and Oligo-v03-86 (green) + Oligo-Ae369 (red) (d,h). The wheat-Th. intermedium translocation chromosomes are shown by arrows and the cut-and-paste chromosomes at the top right. Bars represent 10 μm.
Figure 3. Sequential ND-FISH of the lines WT4D-1 (ad) and WT4D-2 (eh) by multiple probes. The probes Oligo-B11 (green) + Oligo-D (red) (a,e), Oligo-pSc119.2-1 (green) + Oligo-pTa535-1 (red) (b,f), Oligo-7v108 (green) + Oligo-Dv86 (red) (c,g), and Oligo-v03-86 (green) + Oligo-Ae369 (red) (d,h). The wheat-Th. intermedium translocation chromosomes are shown by arrows and the cut-and-paste chromosomes at the top right. Bars represent 10 μm.
Plants 13 02333 g003
Figure 4. PCR profiling of molecular markers in wheat-Th. intermedium lines. M, molecular marker; lane 1: a wheat cultivar Chinese Spring (CS); lane 2: MY11; lane 3: TAI7045; lane 4: WT4D-1; lane 5: 78784; lane 6: WT4D-2; lane 7: nullisomic-4D tetrasomic-4B of CS; lane 8: nullisomic-4A tetrasomic-4D of CS; lane 9: X24C10 (4J/4B substitution line); lane 10: WT78-4 (4St addition line). The chromosome 4A- and 4D-specific bands are indicated in red, and the yellow arrows and blue arrows indicate the chromosome 4J-specific bands and chromosome 4St-specific bands, respectively.
Figure 4. PCR profiling of molecular markers in wheat-Th. intermedium lines. M, molecular marker; lane 1: a wheat cultivar Chinese Spring (CS); lane 2: MY11; lane 3: TAI7045; lane 4: WT4D-1; lane 5: 78784; lane 6: WT4D-2; lane 7: nullisomic-4D tetrasomic-4B of CS; lane 8: nullisomic-4A tetrasomic-4D of CS; lane 9: X24C10 (4J/4B substitution line); lane 10: WT78-4 (4St addition line). The chromosome 4A- and 4D-specific bands are indicated in red, and the yellow arrows and blue arrows indicate the chromosome 4J-specific bands and chromosome 4St-specific bands, respectively.
Plants 13 02333 g004
Figure 5. Physical map of the translocation chromosomes 4D-Th, WT4D-1 and WT4D-2 in comparison with 4D chromosomes. The blue molecular markers and Oligo probes indicate the deletion of 4D chromosome fragments. The 4St-specific marker C10-56 indicates the putative breakpoint of the translocation. The chromosome fragments with blue and orange backgrounds represent the introgression of chromosomes 4St and 4J, respectively.
Figure 5. Physical map of the translocation chromosomes 4D-Th, WT4D-1 and WT4D-2 in comparison with 4D chromosomes. The blue molecular markers and Oligo probes indicate the deletion of 4D chromosome fragments. The 4St-specific marker C10-56 indicates the putative breakpoint of the translocation. The chromosome fragments with blue and orange backgrounds represent the introgression of chromosomes 4St and 4J, respectively.
Plants 13 02333 g005
Figure 6. Physical location of wheat-Th. intermedium lines using rust resistance survey and molecular marker map. Stripe rust response (a) and powdery mildew response (b). The 34 4St-specific markers were screened and blasted to located on the 4StL of Th. intermedium genome sequence of V3.1 (c). The chromosome fragments with blue and orange backgrounds represent the introgression of chromosomes 4St and 4J, respectively.
Figure 6. Physical location of wheat-Th. intermedium lines using rust resistance survey and molecular marker map. Stripe rust response (a) and powdery mildew response (b). The 34 4St-specific markers were screened and blasted to located on the 4StL of Th. intermedium genome sequence of V3.1 (c). The chromosome fragments with blue and orange backgrounds represent the introgression of chromosomes 4St and 4J, respectively.
Plants 13 02333 g006
Table 1. Responses of tested materials to stripe rust (Pst) and powdery mildew (Bgt) at the adult stage.
Table 1. Responses of tested materials to stripe rust (Pst) and powdery mildew (Bgt) at the adult stage.
Material NameThe Added Alien Chromosome or the Wheat-Th. intermedium Recombinant ChromosomeITs for PstITs for Bgt
MY11/44
TAI70451St-JS, 2St, 3JS, 4J, 5J.St, 6JS.J, 7JS00
WT75-11St-JS4nt
WT75-22St;10
WT75-44J33
WT75-55J.St44
WT75-66JS.J3nt
WT75-77JS;3
WT4D-14DS.4DL-4StL-4DL-4JL00;
787841St-JS, 2St.JS, 3St, 4St, 5St, 6JS.J, 7JS00
WT78-11St-JS;nt
WT78-22St.JS;11
WT78-33St44
WT78-44St00
WT78-55St4nt
WT78-66JS.J3nt
WT78-77JS;3
WT4D-24DS.4DL-4StL-4DL00
“/” indicates that the line did not carry the alien chromosome. “nt” means not tested. ITs of “0” mean immune (no symptoms), “;” means near to immune (necrotic or chlorotic blotches without sporulation), 1–2 indicate resistance (necrotic or chlorotic blotches with only a trace of slight sporulation) and 3–4 indicate susceptible (moderate to abundant sporulation, with or without chlorosis or necrosis). “0;” means “0” or “;” and “;1” means “;” or “1”.
Table 2. Sequences of synthesized oligonucleotide probes.
Table 2. Sequences of synthesized oligonucleotide probes.
Name of ProbesNucleotide Sequences of Probes (5′-3′)Length of Oligo Probes (bp)Reference
Oligo-Dv86 GTCGTCGCTACCGCGACGACGTCCGCCTCGACTCGCGTTACCCTAAGAC 49/
Oligo-7v108 TATTAACGTGGATAATCGAAATACTGAATTTTAGTATT 38/
Oligo-v03-86 CGAGGCGGACGTCGTCGCGGTAGCGACGACGGACGCCGAGACGAGCACGT 50/
Oligo-Ae369 GAAAGAATCCTTTGAAGCATCTGGTCGTCACAAACGTTTTGACTACT 47/
Oligo-pSc119.2-1 CCGTTTTGTGGACTATTACTCACCGCTTTGGGGTCCCATAGCTAT 45[53]
Oligo-pTa535-1 GACGAGAACTCATCTGTTACATGGGCACTTCAATGTTTTTTAAACTTATTTGAACTCCA 59[53]
Oligo-B11 TCCGCTCACCTTGATGACAACATCAGGTGGAATTCCGTTCGAGGG 45[54]
Oligo-D TACGGGTGCCAAACGAGTGTCTGAAAGACTCCTCGAGAGGAAAATGCGAA 50[55]
Oligo-pTa71-2 GGGCAAAACCACGTACGTGGCACACGCCGCGTA 33[53]
Oligo-pSc200 CTCACTTGCTTTGAGAGTCTCGATCAATTCGGACTCTAGGTTGATTTTTGTATTTTCT 58[56]
“/” refers to the newly developed probes in this study.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yu, Z.; Li, G.; Zheng, Z.; Wang, H.; Yang, Z. Characterization of New Wheat-Thinopyrum intermedium Derivative Lines with Superior Genes for Stripe Rust and Powdery Mildew Resistance. Plants 2024, 13, 2333. https://doi.org/10.3390/plants13162333

AMA Style

Yu Z, Li G, Zheng Z, Wang H, Yang Z. Characterization of New Wheat-Thinopyrum intermedium Derivative Lines with Superior Genes for Stripe Rust and Powdery Mildew Resistance. Plants. 2024; 13(16):2333. https://doi.org/10.3390/plants13162333

Chicago/Turabian Style

Yu, Zhihui, Guangrong Li, Zhiqiang Zheng, Hongjin Wang, and Zujun Yang. 2024. "Characterization of New Wheat-Thinopyrum intermedium Derivative Lines with Superior Genes for Stripe Rust and Powdery Mildew Resistance" Plants 13, no. 16: 2333. https://doi.org/10.3390/plants13162333

APA Style

Yu, Z., Li, G., Zheng, Z., Wang, H., & Yang, Z. (2024). Characterization of New Wheat-Thinopyrum intermedium Derivative Lines with Superior Genes for Stripe Rust and Powdery Mildew Resistance. Plants, 13(16), 2333. https://doi.org/10.3390/plants13162333

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop