Next Article in Journal
Chemical Profiling of Drimys granadensis (Winteraceae) Essential Oil, and Their Antimicrobial, Antioxidant, and Anticholinesterase Properties
Previous Article in Journal
Biomonitoring with the Use of the Herbal Plant Taraxacum officinale as a Source of Information on Environmental Contamination
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 13
10.3390/plants13131803
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Functional Identification of Malus halliana MhbZIP23 Gene Demonstrates That It Enhances Saline–Alkali Stress Tolerance in Arabidopsis thaliana

by
Wenqing Liu
†,
Peng Li
†,
Xiu Wang
,
Zhongxing Zhang
and
Yanxiu Wang
*
College of Horticulture, Gansu Agricultural University, Lanzhou 730070, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Plants 2024, 13(13), 1803; https://doi.org/10.3390/plants13131803
Submission received: 17 May 2024 / Revised: 24 June 2024 / Accepted: 28 June 2024 / Published: 29 June 2024
(This article belongs to the Section Plant Response to Abiotic Stress and Climate Change)
Browse Figures
Review Reports Versions Notes

Abstract

:
Saline–alkali stress is a significant abiotic stress that restricts plant growth globally. Basic region leucine zipper (bZIP) transcription factor proteins are widely involved in plants in response to abiotic stress such as saline–alkali stress. Based on transcriptome and quantitative real-time PCR (qRT-PCR), we found that the MhbZIP23 gene could respond to saline–alkali stress. Despite this discovery, the underlying mechanism by which the MhbZIP23 transcription factor responds to saline–alkaline stress remains unexplored. To address this gap in knowledge, we successfully cloned the MhbZIP23 (MD05G1121500) gene from Malus halliana for heterologous expression in Arabidopsis thaliana, facilitating the investigation of its functional role in stress response. Compared to the wild type (WT), Arabidopsis plants demonstrated enhanced growth and a lower degree of wilting when subjected to saline–alkali stress. Furthermore, several physiological indices of the plants altered under such stress conditions. The transgenic Arabidopsis plants (OE-5, 6, and 8), which grew normally, exhibited a higher chlorophyll content and had greater root length in comparison to the control check (CK). MhbZIP23 effectively regulated the levels of the osmoregulatory substance proline (Pro), enhanced the activities of antioxidant enzymes such as peroxidase (POD) and superoxide dismutase (SOD), and reduced the levels of malondialdehyde (MDA) and relative conductivity (REC). These actions improved the ability of plant cells in transgenic Arabidopsis to counteract ROS, as evidenced by the decreased accumulation of O2− and hydrogen peroxide (H2O2). In summary, the MhbZIP23 gene demonstrated effectiveness in alleviating saline–alkali stress in M. halliana, presenting itself as an outstanding resistance gene for apples to combat saline–alkali stress.

1. Introduction

The increasing severity of global soil salinization is significantly impacting the sustainable progress of contemporary agriculture [1]. Saline–alkali stress causes three types of damage to plant cells: osmotic stress, reactive oxygen species (ROS) imbalance, and ionic toxicity, with osmotic stress being the most common [2]. Osmotic stress and ionic toxicity may cause the accumulation of toxic compounds and nutrient uptake, resulting in the accumulation of ROS [3]. Excessive ROS buildup may cause membrane lipid peroxidation, leading to the loss of cellular hydration [4], ultimately severely damaging cellular structures and leading to a disturbance in metabolic pathways [5]. It is also possible to pass various plant transcription factors such as DREB, WRKY, bZIP, and NAC [6,7] to regulate gene expression so that the plant can adapt or mitigate the effects of saline–alkali stress, which enhances crop development and yield [8].
When plants are exposed to saline–alkali stress, a cascade of signals is produced to activate transcription factors. These factors then bind to specific regulatory elements [9], triggering RNA polymerase and transcription complexes to start transcribing and expressing particular genes [10]. Plants can also mediate signal transduction through various physiological pathways such as antioxidant enzymes, include superoxide dismutase SOD, POD, and catalase (CAT), as well as non-antioxidant enzymes such as H2O2 and MDA, effectively preventing oxidative stress [11]. The basic region leucine zipper (bZIP) family, known as one of the most extensive families of transcription factors linked to stress [10], plays a crucial part in overseeing plant development, growth, and response to abiotic stress [8]. The Triticum aestivum transcription factor TabZIP60 was reported to improve tolerance to multiple abiotic stresses in transgenic Arabidopsis [12]; Arabidopsis AtbZIP17 and AtbZIP28 regulate root length during stress response [13]. Overexpression of OsbZIP23 transgenic plants significantly increased drought tolerance, salt tolerance, and sensitivity to ABA in rice [14]. What is more interesting is that bZIP transcription factors at the level of post-translational modifications can similarly regulate saline–alkali stress. Kinases such as SnRK2 (Suc nonfermenting-1-related protein kinase 2) phosphorylate the bZIP proteins ABF2 and ABF3. These proteins then bind to the ABA response element (ABRE) in the promoter of specific genes, initiating downstream gene expression crucial for ABA signaling [15,16]. Additionally, bZIP23, a member of the bZIP transcription factor family [17], also plays a significant role in regulating abiotic stresses. However, little is known about the expression regulation mechanism of the MhbZIP23 gene under saline–alkali stress in apple.
M. halliana is a widely used rootstock in the northwestern production areas of China [18], known for its strong resistance to saline–alkali stress and other adverse conditions [19]. In this study, we identified the MhbZIP23 gene, which shows significant induction under saline–alkali stress, as evidenced by transcriptome analysis and qRT-PCR [20]. However, the regulatory mechanism of this gene under saline–alkali stress remains largely unexplored. Therefore, our study aimed to clone the gene and express it heterologously in Arabidopsis to characterize its function. Our goal is to identify the valuable resistance gene of M. halliana and establish a theoretical basis for selecting and breeding salt-resistant apple varieties.

2. Materials and Methods

2.1. Plant Materials and Treatments

The research on gene expression involved the utilization of M. halliana seedlings obtained from the Fruit Tree Tissue Culture Laboratory at the College of Horticulture, Gansu Agricultural University. The seedlings were first placed on rooting medium for 4 weeks and then transplanted into plastic pots (20.0 cm × 20.0 cm, with organic matter in a ratio of 3:1 with vermiculite) containing 5 plants each for consistent monitoring and nurturing. The apple rooting medium consisted of MS, 30 g/L sucrose, 8 g/L agar, 0.3 mg/L 6-BA, 0.2 mg/L IAA, and 0.1 mg/L GA3, pH 5.8–6.0.
Moreover, the WT Arabidopsis used is of the Col-0 strain, which was conserved and provided by the Xiao-Fei Wang Laboratory of Shandong [21]. WT Arabidopsis plants were cultivated in MS medium (MS + 30 g/L sucrose + 8 g/L agar, pH = 5.8–6.0) and subjected to vernalization at 4 °C for 3 days before being transferred to a 26 °C incubator. Upon emergence of green seedlings, they were transplanted to a growth substrate composed of substrate and vermiculite in a 3:1 ratio. Inflorescences were utilized for Arabidopsis infestation during the blooming phase, with weekly sessions conducted 3–4 times. Transgenic Arabidopsis seeds were isolated on a Kanamycin-containing medium to maintain the purity of the transgenic plants [22]. The culture conditions included a temperature of 25 °C with a light cycle of 16 h/8 h. Each treatment was replicated three times with five plants each.

2.2. Saline–Alkali Stress Treatment of M. halliana Seedlings

For gene expression analysis, M. halliana seedlings with 8 robust and consistent leaves were selected and cultivated in 1/2 Hoagland solution for 15 days [23]. Following the cultivation period, saline–alkali stress was induced using a nutrient mix with 100 mM 1:1 NaCl: NaHCO3 (pH 8.0), and leaves were collected at 0 h, 6 h, 12 h, 24 h, 48 h, and 72 h. Each treatment was repeated three times, with five plants per replicate [24].

2.3. Bioinformatic Analysis of bZIP23 Gene

The apple MhbZIP23 gene’s protein sequences were retrieved from the Phytozome database (https://phytozome-next.jgi.doe.gov/) (accessed on 10 October 2023). Basic physicochemical properties of these proteins were then predicted through ExPASy (https://web.expasy.org/protparam) (accessed on 8 April 2024). Online BLAST analyses were performed using the NCBI conserved domain database (https://www.ncbi.nlm.nih.gov/) (accessed on 8 April 2024), and motif predictions were performed using MEME (https://meme-suite.org/meme/) (accessed on 8 April 2024) [25,26,27]. The MhbZIP23 phylogenetic tree was constructed using MEGAX (v11.0.13) (default parameters). Promoter cis-acting elements were analyzed using PlantCARE (https://bioinformatics.psb.ugent.be/webtools/plantcare/html/) (accessed on 10 April 2024) [28]. The MhbZIP23 gene was examined for systematic clustering, gene structure, and conserved motifs through visualization and mapping with TBtools software (v2.096) [29].

2.4. Cloning and Expression Vector Construction of bZIP23 Gene

Total RNA was extracted from the samples using an RNA extraction kit from BioTeke Corporation in Beijing, China. Reverse transcription was carried out using TaKaRa’s PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time). Using DNAMAN software (v9.0), specific primers (Table 1) were designed for amplification by qRT-PCR after searching the apple genome database for the CDS sequence of MhbZIP23. The cDNA of Malus halliana plantlets was used as the template for qRT-PCR, with GAPDH serving as a reference. Quantitative data analysis was conducted using the 2−ΔΔCt method, and differences were evaluated using Duncan’s test (p < 0.05) for one-way ANOVA. The PCR reaction program consisted of the following steps: 95 °C for 5 min, 95 °C for 30 s, 57 °C for 42 s, 72 °C for 100 s, and 72 °C for 10 min. The resulting PCR products underwent electrophoresis on an agarose gel for the purpose of isolating the desired genes. Subsequently, they were ligated into the pMD19-T cloning vector and transformed into Escherichia coli DH5α. Positive clones were identified and screened for sequencing accuracy. The accurately sequenced MhbZIP23 plasmid was extracted and digested with Sma I and Kpn I restriction endonucleases for ligation into the pRI101 expression vector. Subsequently, screened bacteria were selected by the constitutively strong promoter 35S, which was introduced into Escherichia coli, and single positive colonies were identified and transferred to Agrobacterium GV3101 for genetic transformation using the freeze–thaw method [30]. Each sample was repeated three times.

2.5. Treatment and Screening of Genetically Modified Arabidopsis

Genetic modification was used to obtain transgenic Arabidopsis seeds with the MhbZIP23 gene [31], and these seeds were screened on MS medium with 30 mg/L Kanamycin. Following this, the seeds were immersed in 75% ethanol for 5 min and then treated with 26% sodium hypochlorite for 10 min before being washed multiple times with ddH2O. The seeds were then placed on MS medium supplemented with 30 mg/L Kanamycin for cultivation. Resistant plants were identified through qRT-PCR amplification, resulting in the isolation of heterozygous transgenic Arabidopsis. To obtain pure transgenic Arabidopsis in the T3 generation, three generations were screened in total.

2.6. Transgenic Arabidopsis under Saline–Alkali Stress and Determination of Related Indicators

WT and T3 generation pure transgenic Arabidopsis seeds were aseptically treated before being inoculated on MS medium. They were subsequently incubated at 4 °C for 3 days. Afterwards, the seedlings were moved to MS and MS + 100 mmol/L of a NaCl and NaHCO3 mixture, respectively, where they were cultured in an incubator set to a constant temperature. Phenotypes and various indicators were observed and measured after 20 days.
For DAB staining, leaf samples were immersed in a 50 mM DAB solution for either 12 or 24 h before being decolorized in 95% ethanol until they turned white. For NBT staining, root tips or leaf samples were soaked in a 50 mM NBT solution for 4 h and subsequently decolorized in 95% ethanol until they appeared white. Chlorophyll content was measured as described by Cheng (2020) [32], and proline content was analyzed according to the method stated by Ferreira Junior (2018) [33]. MDA content was quantified using the thiobarbituric acid method [20]. The activities of SOD, POD, and CAT were determined spectrophotometrically with kits from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). Relative conductivity was measured using the conductivity method (DDS-307) [34]. Each experiment was carried out in triplicate.

2.7. Data Analysis

In organizing the statistical data, Excel 2019 was utilized, while for data analysis, SPSS 21.0 was employed. Origin 2021 Pro was utilized to create visual representations, and the significance of the test data was analyzed using the least significant difference (LSD) test ANOVA method.

3. Results

3.1. Analysis of the MhbZIP23 Gene

The encoding protein of M. halliana MhbZIP23 (MD05G1121500) contains 263 amino acids, with a molecular weight of 28.48 kD, a theoretical isoelectric point of 6.18, and an acidic protein. In addition, it had an aliphatic index of 61.98, an instability index of 35.77, and a more stable protein with an average hydrophilicity of −0.617 (Table 2). This suggests that MhbZIP23 is a more stable acidic hydrophilic protein. Subcellular localization revealed that the vast majority of MhbZIP23 is located in the nucleus, with very few in the cell membrane. The structural domain prediction results showed that the amino acid sequence encoded by MhbZIP23 has the structural features of bZIP family member, and the N-terminus contains a conserved BRLZ (the basic region leucin zipper domain) structural domain (Figure 1A). Chromosomal localization results showed that MhbZIP23 was located on chromosome 5 (Figure 1B). The intron–exon results showed (Figure 1C) that the MhbZIP23 gene contains four exons and three introns. The findings from the analysis of conserved motifs (Figure 1D) revealed that within the M. halliana MhbZIP23 gene, there are three conserved motifs, namely, motif 1, motif 2, and motif 3. Notably, motif 1 corresponds to a leucine bZIP structural domain.

3.2. Protein Sequence Analysis of MhbZIP23 Gene

Comparison of the amino acid sequences of apple MhbZIP23 with bZIP homologous proteins from other species, utilizing the NCBI database and DNAMAN software, revealed that MhbZIP23 differed from other species’ proteins to some extent at the C-terminal end. However, the N-terminal end remained relatively conserved (Figure 2). Notably, the highest amino acid sequence homology was observed with Pyrus × bretschneideri.

3.3. Phylogenetic Tree Evolutionary Analysis of the Apple MhbZIP23 Protein

A phylogenetic tree analysis of bZIP23 proteins from different species was performed by MEGAX software according to the neighbor-joining method (Figure 3). The results show that M. halliana (XP_008377738.2) clustered with Pyrus × bretschneideri (XP_009355669.2) belong to the same subgroup. It is shown that MhbZIP23 of M. halliana is the closest relative to Pyrus × bretschneideri, which predicts that it has similar biological functions.

3.4. Analysis of Cis-Acting Elements of MhbZIP23 Promoter

Cis-acting elements within the 2000 bp promoter region upstream of the gene play a crucial role in regulating gene expression. Examination of these components illuminates the regulatory mechanism of the MhbZIP23 gene in apples, highlighting four primary categories: elements responsive to stress, elements responsive to hormones, elements responsive to plant development, and elements responsive to light (Figure 4). Stress response elements mainly include defense and stress responsiveness; hormone response elements mainly include ABRE elements, gibberellin response elements, etc.; plant development response mainly includes zein metabolism regulation; and light response elements include light responsiveness. These components suggest that the MhbZIP23 gene may respond to the induction of different stresses such as saline–alkali, drought, and hormones.

3.5. Response of MhbZIP23 to Saline–Alkali Stress in M. halliana Seedlings

To investigate the gene expression pattern in M. halliana under saline–alkali stress at various time points, relative expression levels were determined using PCR fluorescence quantification. Figure 5 illustrates that the expression of MhbZIP23 consistently increased compared to the control (0 h), peaking at 24 h with a 10.27-fold higher expression level than the control. These results suggest that MhbZIP23 is responsive to saline–alkali stress.

3.6. Cloning of MhbZIP23 Gene

Total RNA of M. halliana leaves was extracted, and a 792 bp MhbZIP23 target gene was obtained by qRT-PCR amplification (Figure 6). After purification and recovery of the target fragment, it was ligated with the pRI101 expression vector. Sequencing results showed that it was consistent with the base sequence of the MhbZIP23 (XM_008379516) gene as compared to NCBI.

3.7. Screening and Identification of Transgenic Arabidopsis

The expression level of MhbZIP23 in transgenic Arabidopsis was detected by qRT-PCR. Compared with wild-type plants, the expression level of MhbZIP23 was higher in transgenic Arabidopsis, indicating that MhbZIP23 was overexpressed in Arabidopsis lines (Figure 7).

3.8. Morphological Characteristics and Physiological Indicators of MhbZIP23 Transgenic Arabidopsis under Saline–Alkali Stress

To further examine the role of M. halliana MhbZIP23 in response to saline–alkali stress (using a nutrient mix with 100 mM 1:1 NaCl:NaHCO3), we carried out saline–alkali tolerance assessments on WT and three transgenic Arabidopsis plants (OE-5, 6, and 8) with normal growth patterns. The findings from the experiments (Figure 8 and Figure 9) revealed that the transgenic Arabidopsis plants expressing MhbZIP23 demonstrated enhanced resistance to saline–alkali stress when compared to WT plants. While there were no significant distinctions observed between OE lines and WT seedlings under regular conditions, both OE lines and WT seedlings exhibited leaf yellowing and wilting when exposed to saline–alkali stress in containers. Nonetheless, the OE lines displayed improved traits and higher levels of chlorophyll content in contrast to WT plants.
Moreover, different physiological parameters of the vegetation shifted when exposed to saline–alkali stress. While the root length of transgenic plants matches that of the WT under typical growing circumstances, it notably increases under saline–alkali stress in OE plants compared to the WT. DAB and NBT staining were performed on Arabidopsis plants, with darker blue and yellowish-brown shades indicating increased levels of O2− and H2O2, respectively. There was no noticeable distinction between the OE strain and the WT under typical conditions. Nonetheless, when faced with saline–alkali stress, the leaf staining hue of the OE strain was significantly paler than that of the WT. This implies that the transgenic OE strain successfully lowered O2− and H2O2 levels. Under saline–alkali stress, the OE line displayed reduced MDA content and REC in comparison to the WT. Conversely, significant increases were observed in the activities of SOD and POD, along with proline content, in the OE line over the WT. SOD and POD were elevated by 19.14–31.53% under saline–alkali stress in the transgenic lines compared to the WT. These observations suggest that the overexpression of the MhbZIP23 gene enhances the antioxidant enzyme system’s performance in Arabidopsis. As a result, plant cells exhibit an improved ability to eliminate ROS, thereby decreasing the accumulation of O2− and H2O2. This ultimately enhances the plant’s tolerance to saline–alkali conditions.

4. Discussion

Saline–alkali stress is a critical abiotic factor that adversely impacts plant growth and development [35]. To cope with this challenging growing environment, plants have developed a variety of defense mechanisms for saline–alkali tolerance. These mechanisms involve stress-induced genes that encode numerous regulatory proteins, including protein kinases and transcription factors [36]. Transcription factors attach to the promoters of particular genomes responsive to stress to either trigger or hinder their expression, playing a critical part in the signal network for plant responses to saline–alkali stress [37]. Hence, uncovering genes that control plant resistance at a molecular level to enhance their resilience against saline–alkali stress holds significant research merit and promising practical implications [20].
The bZIP transcription factors are prevalent in eukaryotes [38] and have a crucial function in plant communication [39], a favorable reaction to environmental stresses like salt–alkaline pressure [40], stimulation of ABA [41], and other biochemical routes [42,43]. One instance is the broad triggering of VvbZIP23 by environmental stresses such as drought, salt–alkali, and cold, aiding in the regulation of various stress reactions in Vitis vinifera [44]. MdbZIP48, MdbZIP54 strongly responded to ABA and significantly increased the transcriptome level after plants were sprayed with ABA [45]. Moreover, the overexpression of bZIP23 in rice regulates ABA biosynthesis and signaling, thereby improving drought and saline–alkali stress tolerance [46,47]. Thus, there is a broad influential role for bZIP transcription factors in plant abiotic stresses and their regulatory mechanisms [48]. The response mechanism of the M. halliana MhbZIP23 transcription factor to saline–alkali stress is not yet fully understood in existing studies. Therefore, to explore its functional attributes under saline–alkali stress, we screened and cloned MhbZIP23 (MD05G1121500) utilizing transcriptome data and qRT-PCR [49].
The results of the basic physicochemical properties of MhbZIP23 indicated that MhbZIP23 is a more stable acidic hydrophilic protein with the highest amino acid sequence homology to Pyrus × bretschneideri, which is inferred to be the closest relative [50]. We found the presence of several elements in the promoter region of the MhbZIP23 gene, such as defense, stress responsiveness, and ABRE elements, suggesting that the MhbZIP23 gene is capable of being activated to mediate ABA signaling, ultimately regulating saline–alkali tolerance [51,52].
During the experiment, MhbZIP23 transgenic Arabidopsis plants were acquired, and their phenotypes were examined when exposed to saline–alkali conditions. Various parameters were assessed to gauge the effects of the stress. The transgenic Arabidopsis plants exhibited enhanced root elongation, increased vigor in growth, and elevated chlorophyll levels when subjected to saline–alkali stress. This indicates that the transgenic plants display improved resistance to saline–alkali conditions [23]. Additionally, Arabidopsis was stained with DAB and NBT to visually observe the accumulation of ROS in leaves [53]. The staining outcomes indicated no notable distinction in leaf hue between WT and transgenic OE plants in typical growth conditions. However, when subjected to saline–alkali stress, the color of WT plants was notably darker compared to the OE lines. These findings imply that the MhbZIP23 gene may play a beneficial role in regulating saline–alkali stress responses in plants.
Plants experience a significant increase in ROS production when exposed to saline–alkali stress, triggering the production of antioxidant enzymes (POD, SOD, and CAT) to combat ROS buildup and shield the plant from oxidative injury [54]. The current study observed heightened levels of antioxidant enzyme activities: SOD and POD were elevated by 19.14–31.53% under saline–alkali stress in the transgenic plants compared to the WT. This indicates that transgenic plants enhance their antioxidant capacity by scavenging ROS, minimizing membrane destruction [55], and boosting antioxidant enzyme activities [56]. These outcomes are in line with the findings of Fang S (2021), who indicated that overexpression of MsGSTU8 in transgenic tobacco resulted in decreased ROS accumulation and malondialdehyde levels, increased SOD, POD, and CAT activities, and improved resilience to saline–alkali stress [54,57]. MDA content and relative conductivity content were elevated in all plants under saline–alkali stress, but the OE plants were significantly lower than the WT [58], and the MDA activity could indirectly respond to the severity of the free radical attack [59], suggesting that all plants were damaged under saline–alkali stress, but obviously the transgenic plants were damaged less. Proline plays vital roles in enhancing plant resistance to various abiotic stresses [60]. The proline content in both the WT and genetically modified plants showed a significant increase when subjected to saline–alkali stress. However, the proline levels in the transgenic plants were considerably higher compared to those in the WT plants. This indicates that the genetically modified plants have the ability to efficiently modulate the levels of osmotic regulatory compounds, thereby mitigating oxidative harm to the plants [61]. These findings align with Wang Y’s (2018) research, which demonstrated that MsWRKY11 overexpression led to increased proline levels, reduced ROS levels, and enhanced salt tolerance in soybean [62]. In this research, transgenic Arabidopsis exhibited a lesser extent of membrane damage when exposed to saline–alkali stress compared to WT Arabidopsis. This observation is supported by the decreased levels of electrolyte leakage and ROS and MDA accumulation, according to reference [56]. The findings suggest a strong association between the enhanced capability of the reactive oxygen species scavenging system and the increased saline–alkali resistance in plants overexpressing MhbZIP23. MhbZIP23 augments saline–alkali resistance by activating the ROS scavenging mechanisms, thereby improving saline–alkali tolerance in Arabidopsis. This research shows the potential involvement of the MhbZIP23 gene in regulating plant growth and development. Since growth and development processes are controlled by various pathways and signaling molecules, further examination of the role of the MhbZIP23 gene in M. halliana growth and development can be conducted by cultivating the deletion mutant.

5. Conclusions

The MhbZIP23 gene has been shown to positively respond to saline–alkali stress and enhance resistance in Arabidopsis thaliana. It plays a role in promoting chlorophyll synthesis, increasing antioxidant enzyme activity, and reducing membrane damage under saline–alkali stress conditions. Initial findings suggest that MhbZIP23 enhances saline–alkali tolerance in Arabidopsis thaliana by scavenging reactive oxygen species, laying the groundwork for further exploration of its other functions.

Author Contributions

W.L. and Y.W. designed the research; X.W. and P.L. performed the experiments; Z.Z. and P.L. performed the data analysis and interpretation; X.W. and W.L. prepared the figures and tables; W.L. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National College Student Innovation and Entrepreneurship Training Programme (202312039).

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare that there are no conflicts of interest.

References

  1. Schofield, R.V.; Kirkby, M.J. Application of salinization indicators and initial development of potential global soil salinization scenario under climatic change. Glob. Biogeochem. Cycles 2003, 17, 17. [Google Scholar] [CrossRef]
  2. Lu, X.; Min, W.; Shi, Y.; Tian, L.; Li, P.; Ma, T.; Zhang, Y.; Luo, C. Exogenous melatonin alleviates alkaline stress by removing reactive oxygen species and promoting antioxidant defence in rice seedlings. Front. Plant Sci. 2022, 13, 849553. [Google Scholar] [CrossRef]
  3. Flowers, T.J.; Colmer, T.D. Salinity tolerance in halophytes. New Phytol. 2008, 1, 945–963. [Google Scholar] [CrossRef] [PubMed]
  4. Ye, T.; Wang, Y.; Feng, Y.Q.; Chan, Z. Physiological and metabolomic responses of bermudagrass (Cynodon dactylon) to alkali stress. Physiol. Plant. 2021, 171, 22–33. [Google Scholar] [CrossRef] [PubMed]
  5. Kang, C.; Zhai, H.; He, S.; Zhao, N.; Liu, Q. A novel sweetpotato bZIP transcription factor gene, IbbZIP1, is involved in salt and drought tolerance in transgenic Arabidopsis. Plant Cell Rep. 2019, 38, 1373–1382. [Google Scholar] [CrossRef] [PubMed]
  6. Song, L.; Huang, S.S.C.; Wise, A. A transcription factor hierarchy defines an environmental stress response network. Science 2016, 354, 1550. [Google Scholar] [CrossRef]
  7. Zhu, J.K. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 2002, 53, 247–273. [Google Scholar] [CrossRef] [PubMed]
  8. Wang, Q.; Guo, C.; Li, Z.; Sun, J.; Wang, D.; Xu, L.; Li, X.; Guo, Y. Identification and analysis of bZIP family genes in potato and their potential roles in stress responses. Front. Plant Sci. 2021, 12, 637343. [Google Scholar] [CrossRef] [PubMed]
  9. Nolis, I.K.; McKay, D.J.; Mantouvalou, E.; Lomvardas, S.; Merika, M.; Thanos, D. Transcription factors mediate long-range enhancer–promoter interactions. Proc. Natl. Acad. Sci. USA 2009, 106, 20222–20227. [Google Scholar] [CrossRef]
  10. Liu, H.; Tang, X.; Zhang, N.; Li, S.; Si, H. Role of bZIP transcription factors in plant salt stress. Int. J. Mol. Sci. 2023, 24, 7893. [Google Scholar] [CrossRef]
  11. Caregnato, F.F.; Koller, C.E.; MacFarlane, G.R.; Moreira, J.C. The glutathione antioxidant system as a biomarker suite for the assessment of heavy metal exposure and effect in the grey mangrove, Avicennia marina (Forsk.) Vierh. Mar. Pollut. Bull. 2008, 56, 1119–1127. [Google Scholar] [CrossRef] [PubMed]
  12. Zhang, L.; Zhang, L.; Xia, C.; Zhao, G.; Liu, J.; Jia, J.; Kong, X. A novel wheat bZIP transcription factor, TabZIP60, confers multiple abiotic stress tolerances in transgenic Arabidopsis. Physiol. Plant. 2015, 153, 538–554. [Google Scholar] [CrossRef] [PubMed]
  13. Kim, J.S.; Yamaguchi-Shinozaki, K.; Shinozaki, K. ER-anchored transcription factors bZIP17 and bZIP28 regulate root elongation. Plant Physiol. 2018, 176, 2221–2230. [Google Scholar] [CrossRef] [PubMed]
  14. Xiang, Y.; Tang, N.; Du, H.; Ye, H.; Xiong, L. Characterization of OsbZIP23 as a key player of the basic leucine zipper transcription factor family for conferring abscisic acid sensitivity and salinity and drought tolerance in rice. Plant Physiol. 2008, 148, 1938–1952. [Google Scholar] [CrossRef] [PubMed]
  15. Choi, H.I.; Hong, J.H.; Ha, J.O.; Kang, J.Y.; Kim, S.Y. ABFs, a family of ABA-responsive element binding factors. J. Biol. Chem. 2000, 275, 1723–1730. [Google Scholar] [CrossRef] [PubMed]
  16. Joo, H.; Baek, W.; Lim, C.W.; Lee, S.C. Post-translational modifications of bZIP transcription factors in abscisic acid signaling and drought responses. Curr. Genom. 2021, 22, 4–15. [Google Scholar] [CrossRef]
  17. Assunção, A.G.; Herrero, E.; Lin, Y.F.; Huettel, B.; Talukdar, S.; Smaczniak, C.; Immink, R.G.; Van Eldik, M.; Fiers, M.; Schat, H.; et al. Arabidopsis thaliana transcription factors bZIP19 and bZIP23 regulate the adaptation to zinc deficiency. Proc. Natl. Acad. Sci. USA 2010, 107, 10296–10301. [Google Scholar] [CrossRef]
  18. Kim, J.H.; Kwon, S.I.; Sheob Shin, I.; Cho, K.H.; Heo, S.; Kim, H.R. The Apple Rootstock Transgenic M.26 (Malus pumila) with Enhanced Rooting Ability. Korean J. Breed. Sci. 2009, 41, 4. [Google Scholar]
  19. Zhu, Y.F.; Wu, Y.X.; Hu, Y.; Jia, X.M.; Zhao, T.; Cheng, L.; Wang, Y.X. Tolerance of two apple rootstocks to short-term salt stress: Focus on chlorophyll degradation, photosynthesis, hormone and leaf ultrastructures. Acta Physiol. Plant. 2019, 41, 1–4. [Google Scholar] [CrossRef]
  20. Xiao, F.; Zhou, H. Plant salt response: Perception, signaling, and tolerance. Front. Plant Sci. 2023, 13, 1053699. [Google Scholar] [CrossRef]
  21. Wang, X.; Zhang, Z.X.; Wang, W.X.; Li, S.T.; Li, J.L.; Wang, Y.X. Functional identification of CCR1 gene in apple (Malus halliana) demonstrates that it enhances saline-alkali stress tolerance. Chem. Biol. Technol. Agric. 2024, 11, 45. [Google Scholar] [CrossRef]
  22. Wang, W.X.; Zhang, R.; Zhang, Z.X.; Wang, S.C.; Cheng, J.; Wang, Y.X. Identification of ANS from Malus halliana reveal flavonoid metabolic pathway involved in response to saline–alkali stress. Plant Growth Regul. 2023, 99, 323–336. [Google Scholar] [CrossRef]
  23. Hu, Y.; Zhu, Y.F.; Guo, A.X.; Jia, X.M.; Cheng, L.; Zhao, T.; Wang, Y.X. Transcriptome analysis in Malus halliana roots in response to iron deficiency reveals insight into sugar regulation. Mol. Genet. Genom. 2018, 293, 1523–1534. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, X.; Du, L.; Wang, W.; Zhang, Z.; Wu, Y.; Wang, Y. Functional identification of ZDS gene in apple (Malus halliana) and demonstration of it’s role in improving saline–alkali stress tolerance. Physiol. Mol. Biol. Plants 2023, 29, 799–813. [Google Scholar] [CrossRef] [PubMed]
  25. Ahmad, B.; Zhang, S.; Yao, J.; Rahman, M.U.; Hanif, M.; Zhu, Y.; Wang, X. Genomic organization of the B3-domain transcription factor family in grapevine (Vitis vinifera L.) and expression during seed development in seedless and seeded cultivars. Int. J. Mol. Sci. 2019, 20, 4553. [Google Scholar] [CrossRef]
  26. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef]
  27. Lu, S.; Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Geer, R.C.; Gonzales, N.R.; Gwadz, M.; Hurwitz, D.I.; Marchler, G.H.; Song, J.S.; et al. CDD/SPARCLE: The conserved domain database in 2020. Nucleic Acids Res. 2020, 48, D265–D268. [Google Scholar] [CrossRef] [PubMed]
  28. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef] [PubMed]
  29. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  30. Zhang, Z.; Cheng, J.; Wang, S.; Gao, Y.; Xian, X.; Li, C.; Wang, Y. Molecular cloning and functional characterization of MhHEC2-like genes in Malus halliana reveals it enhances Fe (iron) deficiency tolerance. Funct. Integr. Genom. 2022, 22, 1283–1295. [Google Scholar] [CrossRef]
  31. Hu, D.G.; Sun, M.H.; Sun, C.H.; Liu, X.; Zhang, Q.Y.; Zhao, J.; Hao, Y.J. Conserved vacuolar H+-ATPase subunit B1 improves salt stress tolerance in apple calli and tomato plants. Sci. Hortic. 2015, 197, 107–116. [Google Scholar] [CrossRef]
  32. Cheng, L.; Zhao, T.; Wu, Y.X.; Wang, H.; Zhang, Z.X.; Zhang, D.; Wang, S.C.; Wang, Y.X. Identification of AP2/ERF genes in apple (Malus × domestica) and demonstration that MdERF017 enhances iron deficiency tolerance. Plant Cell Tissue Organ Cult. PCTOC 2020, 143, 465–482. [Google Scholar] [CrossRef]
  33. Ferreira Júnior, D.C.; Gaion, L.A.; Sousa Júnior, G.S.; Santos, D.M.; Carvalho, R.F. Drought-induced proline synthesis depends on root-to-shoot communication mediated by light perception. Acta Physiol. Plant. 2018, 40, 15. [Google Scholar] [CrossRef]
  34. Bajji, M.; Kinet, J.M.; Lutts, S. The use of the electrolyte leakage method for assessing cell membrane stability as a water stress tolerance test in durum wheat. Plant Growth Regul. 2002, 36, 61–70. [Google Scholar] [CrossRef]
  35. Ma, S.; Lv, L.; Meng, C.; Zhou, C.; Fu, J.; Shen, X.; Zhang, C.; Li, Y. Genome-wide analysis of abscisic acid biosynthesis, catabolism, and signaling in Sorghum bicolor under saline-alkali stress. Biomolecules 2019, 9, 823. [Google Scholar] [CrossRef] [PubMed]
  36. Sornaraj, P.; Luang, S.; Lopato, S.; Hrmova, M. Basic leucine zipper (bZIP) transcription factors involved in abiotic stresses: A molecular model of a wheat bZIP factor and implications of its structure in function. Biochim. Et Biophys. Acta 2016, 1860, 46–56. [Google Scholar] [CrossRef]
  37. Wang, Y.; Zhang, Y.; Zhou, R.; Dossa, K.; Yu, J.; Li, D.; Liu, A.; Mmadi, M.A.; Zhang, X.; You, J. Identification and characterization of the bZIP transcription factor family and its expression in response to abiotic stresses in sesame. PLoS ONE 2018, 13, e0200850. [Google Scholar] [CrossRef] [PubMed]
  38. Jindrich, K.; Degnan, B.M. The diversification of the basic leucine zipper family in eukaryotes correlates with the evolution of multicellularity. BMC Evol. Biol. 2016, 16, 28. [Google Scholar] [CrossRef] [PubMed]
  39. Jakoby, M.; Weisshaar, B.; Dröge-Laser, W.; Vicente-Carbajosa, J.; Tiedemann, J.; Kroj, T.; Parcy, F. bZIP transcription factors in Arabidopsis. Trends Plant Sci. 2002, 7, 106–111. [Google Scholar] [CrossRef]
  40. Zhu, M.; Meng, X.; Cai, J.; Li, G.; Dong, T.; Li, Z. Basic leucine zipper transcription factor SlbZIP1 mediates salt and drought stress tolerance in tomato. BMC Plant Biol. 2018, 18, 83. [Google Scholar] [CrossRef]
  41. Yoshida, T.; Fujita, Y.; Maruyama, K.; Mogami, J.; Todaka, D.; Shinozaki, K.; Yamaguchi-Shinozaki, K.A. Four A rabidopsis AREB/ABF transcription factors function predominantly in gene expression downstream of SnRK2 kinases in abscisic acid signalling in response to osmotic stress. Plant Cell Environ. 2015, 38, 35–49. [Google Scholar] [CrossRef]
  42. Lee, S.J.; Kang, J.Y.; Park, H.J.; Kim, M.D.; Bae, M.S.; Choi, H.I.; Kim, S.Y. DREB2C interacts with ABF2, a bZIP protein regulating abscisic acid-responsive gene expression, and its overexpression affects abscisic acid sensitivity. Plant Physiol. 2010, 153, 716–727. [Google Scholar] [CrossRef] [PubMed]
  43. Garg, A.; Kirchler, T.; Fillinger, S.; Wanke, F.; Stadelhofer, B.; Stahl, M.; Chaban, C. Targeted manipulation of bZIP53 DNA-binding properties influences Arabidopsis metabolism and growth. J. Exp. Bot. 2019, 70, 5659–5671. [Google Scholar] [CrossRef] [PubMed]
  44. Tak, H.; Mhatre, M. Cloning and molecular characterization of a putative bZIP transcription factor VvbZIP23 from Vitis vinifera. Protoplasma 2013, 250, 333–345. [Google Scholar] [CrossRef] [PubMed]
  45. Zhao, J.; Guo, R.; Guo, C.; Hou, H.; Wang, X.; Gao, H. Evolutionary and expression analyses of the apple basic leucine zipper transcription factor family. Front. Plant Sci. 2016, 7, 376. [Google Scholar] [CrossRef] [PubMed]
  46. Zong, W.; Tang, N.; Yang, J.; Peng, L.; Ma, S.; Xu, Y.; Li, G.; Xiong, L. Feedback regulation of ABA signaling and biosynthesis by a bZIP transcription factor targets drought-resistance-related genes. Plant Physiol. 2016, 171, 2810–2825. [Google Scholar] [CrossRef] [PubMed]
  47. Park, S.H.; Jeong, J.S.; Lee, K.H.; Kim, Y.S.; Do Choi, Y.; Kim, J.K. OsbZIP23 and OsbZIP45, members of the rice basic leucine zipper transcription factor family, are involved in drought tolerance. Plant Biotechnol. Rep. 2015, 9, 89–96. [Google Scholar] [CrossRef]
  48. Dröge-Laser, W.; Snoek, B.L.; Snel, B.; Weiste, C. The Arabidopsis bZIP transcription factor family—An update. Curr. Opin. Plant Biol. 2018, 45, 36–49. [Google Scholar] [CrossRef] [PubMed]
  49. Wang, S.; Zhang, R.; Zhang, Z.; Zhao, T.; Zhang, D.; Sofkova, S.; Wu, Y.; Wang, Y. Genome-wide analysis of the bZIP gene lineage in apple and functional analysis of MhABF in Malus halliana. Planta 2021, 254, 78. [Google Scholar] [CrossRef]
  50. Nei, M. Phylogenetic analysis in molecular evolutionary genetics. Annu. Rev. Genet. 1996, 30, 371–403. [Google Scholar] [CrossRef]
  51. Hossain, M.A.; Cho, J.I.; Han, M.; Ahn, C.H.; Jeon, J.S.; An, G.; Park, P.B. The ABRE-binding bZIP transcription factor OsABF2 is a positive regulator of abiotic stress and ABA signaling in rice. J. Plant Physiol. 2010, 167, 1512–1520. [Google Scholar] [CrossRef] [PubMed]
  52. Hartmann, L.; Pedrotti, L.; Weiste, C.; Fekete, A.; Schierstaedt, J.; Göttler, J.; Kempa, S.; Krischke, M.; Dietrich, K.; Mueller, M.J.; et al. Crosstalk between two bZIP signaling pathways orchestrates salt-induced metabolic reprogramming in Arabidopsis roots. Plant Cell 2015, 27, 2244–2260. [Google Scholar] [CrossRef]
  53. Zhang, Z.; Zhang, X.; Hu, Z.; Wang, S.; Zhang, J.; Wang, X.; Wang, Q.; Zhang, B. Lack of K-dependent oxidative stress in cotton roots following coronatine-induced ROS accumulation. PLoS ONE 2015, 10, e0126476. [Google Scholar] [CrossRef] [PubMed]
  54. Du, B.; Zhao, W.; An, Y.; Li, Y.; Zhang, X.; Song, L.; Guo, C. Overexpression of an alfalfa glutathione S-transferase gene improved the saline-alkali tolerance of transgenic tobacco. Biol. Open 2019, 8, bio043505. [Google Scholar] [CrossRef]
  55. Asada, K. Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiol. 2006, 141, 391–396. [Google Scholar] [CrossRef]
  56. Sperdouli, I.; Moustakas, M. Interaction of proline, sugars, and anthocyanins during photosynthetic acclimation of Arabidopsis thaliana to drought stress. J. Plant Physiol. 2012, 169, 577–585. [Google Scholar] [CrossRef]
  57. Fang, S.; Hou, X.; Liang, X. Response mechanisms of plants under saline-alkali stress. Front. Plant Sci. 2021, 12, 667458. [Google Scholar] [CrossRef] [PubMed]
  58. Yan, Y.Q.; Wang, W.J.; Zhu, H.; Shi, X.C.; Liu, X.L.; Zu, Y.G. Effects of salt-alkali stress on osmoregulation substance and active oxygen metabolism of Qingshan poplar (Populus pseudo-cathayana x P. deltoides). Ying Yong Sheng Tai Xue Bao = J. Appl. Ecol. 2009, 20, 2085–2091. [Google Scholar]
  59. Li, Y.; Han, L.; Wang, B.; Zhang, J.; Nie, J. Dynamic degradation of penconazole and its effect on antioxidant enzyme activity and malondialdehyde content in apple fruit. Sci. Hortic. 2022, 300, 111053. [Google Scholar] [CrossRef]
  60. Sharma, A.; Wang, J.; Xu, D.; Tao, S.; Chong, S.; Yan, D.; Li, Z.; Yuan, H.; Zheng, B. Melatonin regulates the functional components of photosynthesis, antioxidant system, gene expression, and metabolic pathways to induce drought resistance in grafted Carya cathayensis plants. Sci. Total Environ. 2020, 713, 136675. [Google Scholar] [CrossRef]
  61. Dong, H.; Wu, C.; Luo, C.; Wei, M.; Qu, S.; Wang, S. Overexpression of MdCPK1a gene, a calcium dependent protein kinase in apple, increase tobacco cold tolerance via scavenging ROS accumulation. PLoS ONE 2020, 15, e0242139. [Google Scholar] [CrossRef]
  62. Wang, Y.; Jiang, L.; Chen, J.; Tao, L.; An, Y.; Cai, H.; Guo, C. Overexpression of the alfalfa WRKY11 gene enhances salt tolerance in soybean. PLoS ONE 2018, 13, e0192382. [Google Scholar] [CrossRef]
Plants 13 01803 g001
Figure 1. Basic physicochemical properties of apple MhbZIP23 transcription factor: (A) domain; (B) chromosomal localization; (C) intron–exon; (D) conservative motif.
Figure 1. Basic physicochemical properties of apple MhbZIP23 transcription factor: (A) domain; (B) chromosomal localization; (C) intron–exon; (D) conservative motif.
Plants 13 01803 g001
Plants 13 01803 g002
Figure 2. Protein sequence analysis of MhbZIP23 gene and the protein of other species.
Figure 2. Protein sequence analysis of MhbZIP23 gene and the protein of other species.
Plants 13 01803 g002
Plants 13 01803 g003
Figure 3. Phylogenetic analysis of MhbZIP23 protein from M. halliana and other species.
Figure 3. Phylogenetic analysis of MhbZIP23 protein from M. halliana and other species.
Plants 13 01803 g003
Plants 13 01803 g004
Figure 4. Analysis of MhbZIP23 promoter cis-acting elements.
Figure 4. Analysis of MhbZIP23 promoter cis-acting elements.
Plants 13 01803 g004
Plants 13 01803 g005
Figure 5. Expression levels of the MhbZIP23 gene in M. halliana seedlings were measured under saline–alkali stress at 0, 6, 12, 24, 48, and 72 h. Note: Different letters above the bars indicate significant differences (p < 0.05) as assessed by one-way ANOVA and the LSD test (p < 0.05).
Figure 5. Expression levels of the MhbZIP23 gene in M. halliana seedlings were measured under saline–alkali stress at 0, 6, 12, 24, 48, and 72 h. Note: Different letters above the bars indicate significant differences (p < 0.05) as assessed by one-way ANOVA and the LSD test (p < 0.05).
Plants 13 01803 g005
Plants 13 01803 g006
Figure 6. MhbZIP23 gene amplification bands. (a) PCR product electrophoresis of cloned MhbZIP23. (b) PCR product electrophoresis of pRI101-MhbZIP23.
Figure 6. MhbZIP23 gene amplification bands. (a) PCR product electrophoresis of cloned MhbZIP23. (b) PCR product electrophoresis of pRI101-MhbZIP23.
Plants 13 01803 g006
Plants 13 01803 g007
Figure 7. Identification of transgenic materials. Note: The values are the means ± standard errors, n = 3. Different lowercase letters indicate significant differences at the 0.05 level (p < 0.05).
Figure 7. Identification of transgenic materials. Note: The values are the means ± standard errors, n = 3. Different lowercase letters indicate significant differences at the 0.05 level (p < 0.05).
Plants 13 01803 g007
Plants 13 01803 g008
Figure 8. Phenotype, root length, NBT, and DAB staining of MhbZIP23-OE and WT Arabidopsis under normal conditions (CK) and saline–alkali stress (T): (a) phenotypes; (b) phenotypes of root length; (c) root length; (d) NBT staining; (e) DAB staining. Note: The values are the means ± standard errors, n = 3. Different lowercase letters indicate significant differences at the 0.05 level (p < 0.05).
Figure 8. Phenotype, root length, NBT, and DAB staining of MhbZIP23-OE and WT Arabidopsis under normal conditions (CK) and saline–alkali stress (T): (a) phenotypes; (b) phenotypes of root length; (c) root length; (d) NBT staining; (e) DAB staining. Note: The values are the means ± standard errors, n = 3. Different lowercase letters indicate significant differences at the 0.05 level (p < 0.05).
Plants 13 01803 g008
Plants 13 01803 g009
Figure 9. Physiological indices of MhbZIP23-OE and WT Arabidopsis under normal conditions (CK) and saline–alkali stress (T): (a) relative conductivity; (b) MDA content; (c) Pro content; (d) SOD activity; (e) POD activity; (f) chlorophyll content. Note: The values are the means ± standard errors, n = 3. Different lowercase letters indicate significant differences at the 0.05 level (p < 0.05).
Figure 9. Physiological indices of MhbZIP23-OE and WT Arabidopsis under normal conditions (CK) and saline–alkali stress (T): (a) relative conductivity; (b) MDA content; (c) Pro content; (d) SOD activity; (e) POD activity; (f) chlorophyll content. Note: The values are the means ± standard errors, n = 3. Different lowercase letters indicate significant differences at the 0.05 level (p < 0.05).
Plants 13 01803 g009
Table 1. Primers used in the experiment.
Table 1. Primers used in the experiment.
PrimerSequence (5′-3′)
MhbZIP23-FATGGACGACCAGGAGGTGT
MhbZIP23-RTCAGTTTGCTGCTGCGGC
TYCZ-bZIP23-SFCATATGCCCGTCGACCCCGGGATGGACGACCAGGAGGTGT
TYCZ-bZIP23-SRTCAGAATTCGGATCCGGTACCTCAGTTTGCTGCTGCGGC
MhbZIP23-GFP-FGGACAGGGTACCCGGGGATCCATGGACGACCAGGAGGTGT
MhbZIP23-GFP-RCACCATGGTACTAGTGTCGACGTTTGCTGCTGCGGCACG
Table 2. Basic information of MdbZIP23 gene in apples.
Table 2. Basic information of MdbZIP23 gene in apples.
Gene IDGene NameSize/aaMW/KDpIAliphatic IndexInstability IndexHydrophilicity
MD05G1121500MhbZIP2326328.486.1861.9835.77−0.617
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, W.; Li, P.; Wang, X.; Zhang, Z.; Wang, Y. Functional Identification of Malus halliana MhbZIP23 Gene Demonstrates That It Enhances Saline–Alkali Stress Tolerance in Arabidopsis thaliana. Plants 2024, 13, 1803. https://doi.org/10.3390/plants13131803

AMA Style

Liu W, Li P, Wang X, Zhang Z, Wang Y. Functional Identification of Malus halliana MhbZIP23 Gene Demonstrates That It Enhances Saline–Alkali Stress Tolerance in Arabidopsis thaliana. Plants. 2024; 13(13):1803. https://doi.org/10.3390/plants13131803

Chicago/Turabian Style

Liu, Wenqing, Peng Li, Xiu Wang, Zhongxing Zhang, and Yanxiu Wang. 2024. "Functional Identification of Malus halliana MhbZIP23 Gene Demonstrates That It Enhances Saline–Alkali Stress Tolerance in Arabidopsis thaliana" Plants 13, no. 13: 1803. https://doi.org/10.3390/plants13131803

APA Style

Liu, W., Li, P., Wang, X., Zhang, Z., & Wang, Y. (2024). Functional Identification of Malus halliana MhbZIP23 Gene Demonstrates That It Enhances Saline–Alkali Stress Tolerance in Arabidopsis thaliana. Plants, 13(13), 1803. https://doi.org/10.3390/plants13131803

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop