Next Article in Journal
Cytological and Molecular Characterization of a New Ogura Cytoplasmic Male Sterility Restorer of Brassica napus L.
Next Article in Special Issue
Effects of Soil Conditioner (Volcanic Ash) on Yield Quality and Rhizosphere Soil Characteristics of Melon
Previous Article in Journal
Effects of Substrate Composition on the Growth Traits of Grafted Seedling in Macadamia (Macadamia integrifolia) Nuts
Previous Article in Special Issue
Updated Gene Prediction of the Cucumber (9930) Genome through Manual Annotation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of the Cation/Proton Antiporter (CPA) Gene Family and Functional Analysis of AtrNHX8 under Salt Stress

1
Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Authors to whom correspondence should be addressed.
Plants 2024, 13(12), 1701; https://doi.org/10.3390/plants13121701
Submission received: 7 May 2024 / Revised: 30 May 2024 / Accepted: 1 June 2024 / Published: 19 June 2024
(This article belongs to the Special Issue The Growth and Development of Vegetable Crops)

Abstract

:
Amaranthus tricolor is an important vegetable, and its quality is affected by salt stress. Cation/proton antiporters (CPA) contribute to plant development and tolerance to salt stress. In this study, 35 CPA genes were identified from a genome database for A. tricolor, including 9 NHX, 5 KEA, and 21 CPA2 genes. Furthermore, in A. tricolor, the expression levels of most AtrNHX genes were higher at a low salinity level (50 or 100 mM NaCl) than in the control or 200 mM NaCl treatment. Levels of most AtrNHX genes were elevated in the stem. Moreover, AtrNHX8 was homologous to AtNHX4, which is involved in the regulation of sodium homeostasis and salt stress response. After AtrNHX8 overexpression in Arabidopsis thaliana, seed germination was better, and the flowering time was earlier than that of wild-type plants. Additionally, the overexpression of AtrNHX8 in A. thaliana improved salt tolerance. These results reveal the roles of AtrNHX genes under salt stress and provide valuable information on this gene family in amaranth.

1. Introduction

Amaranthus tricolor L. is an important vegetable containing betalains, carotenoids, alkaloids, and chlorophylls. It exerts anti-oxidative, anti-cancer, anti-viral, anti-parasitic, and radical-scavenging effects and may be useful for treating certain oxidative stress-related disorders [1,2,3]. It can be cultivated in diverse environmental conditions because it is highly resistant to environmental stresses [4,5,6,7], such as salinity, temperature, and drought stress.
Salt-affected cultivated lands account for a large proportion of global farmland, with more than one-third of irrigated land exhibiting some degree of salinization [8]. Salt stress has become one of the most serious abiotic stresses because it can impair soil fertility and crop growth and development substantially [9], affecting crop yield and quality as well as agricultural sustainability [10,11]. When plants are exposed to salt stress, they must constantly adjust their cellular ion contents to maintain K+ and Na+ homeostasis [12]. The homeostasis of cations and pH by exchanging Na+, K+, or Li+ for H+ is regulated by monovalent cation–proton antiporters (CPAs) in the process of salt stress [13]. CPAs can be classified into two categories: The CPA1 family (including Na+/H+ NHX antiporters) and the CPA2 family (including Cation/H+ (CHX) and K+ efflux antiporters (KEA)). The NHX type is a particularly important CPA1 exchanger involved in Na+ transport and therefore salinity tolerance [9].
The NHX gene family includes eight members (AtNHX1–8) in Arabidopsis [14]. AtNHX1–4, AtNHX5–6, and AtNHX7–8 can be separated into the vacuole (Vac) subfamily, plasma membrane (PM) subfamily, and endosome nucleolus (Endo) subfamily, respectively, according to their subcellular localization [15,16,17]. NHX genes may play an important role in the salt stress response and salt tolerance [9]. Under salt stress, NHXs may prevent Na+ in the vacuoles of most tissues from entering the cytosol [18]. They regulate pH and Na+ homeostasis in the cell to reduce the toxic concentration of Na+ in the cytosol [19]. Studies have reported the responses of various NHX genes to salt stress, such as CmoNHX1 [9] and GbNHX2 [20]. BvNHX5 may interact with CBL and CIPK to enhance salt tolerance in Beta vulgaris [21]. PgNHXs could play significant roles in the response to salt stress in Punica granatum [22]. The LeNHX gene shows increased expression in tomato under salt stress [23]. The overexpression of AtNHX1 in Arabidopsis could confer salt tolerance under NaCl stress. The overexpression of OsNHX1 in rice promotes root growth and water uptake under low salt stress [24]. Upon treatment with 300 mM NaCl, the transcript levels of AtNHX4 increased initially and then decreased gradually [25].
In the study, we screened and identified members of the AtrCPA gene family from the Amaranthus tricolor genome database. AtrCPAs were comprehensively characterized. The NHX type is a particularly important CPA1 exchanger; accordingly, the expression levels of AtrNHX genes were evaluated under salt stress by qRT-PCR. Finally, the effects of the overexpression of AtrNHX8 were evaluated in Arabidopsis thaliana under salt stress. The results reveal the roles of AtrNHX genes in the response to salt stress and provide a valuable reference to further explore the functions of NHX genes in amaranth.

2. Results

2.1. Identification of Cation–Proton Antiporter Gene Family Members and Analyses of Physicochemical Properties

In total, 35 CPA genes were screened from the Amaranthus genome database [26], including 9 NHXs, 5 KEAs, and 21 CPA2s. All of the genes were renamed according to the order of gene sequence IDs (Table 1). The molecular weight ranged from 25.08 kDa (AtrCPA2-7) to 135.36 kDa (AtrKEA3). The theoretical isoelectric point ranged from 4.58 (AtrCPA2-17) to 9.47 (AtrCPA2-20). All AtrNHX proteins were hydrophobic according to the grand average of hydropathy (GRAVY) value. Only AtrKEA3 and AtrKEA5 had a signal peptide. Thirty-four CPAs had typical transmembrane helix regions, other than AtrKEA2 (Supplementary Figure S1). The prediction of subcellular localization patterns showed that AtrNHX proteins may be localized in the plasma membrane or vacuole. The detailed physical and chemical properties are shown in Table 1.

2.2. Motif Composition, Conserved Domains, and Gene Structure

Thirty-five AtrCPA members were divided into three subfamilies, and most AtrCPA members in the same subfamily had similar motif compositions and domains, suggesting that these proteins have similar functions (Figure 1A–C). Motif 8 was found in all three subfamilies; its conservation suggests that it may be useful for the identification of CPA-type proteins in A. tricolor. Each subfamily had unique conserved moftis. Motifs 3, 4, 6, 10, 11, and 15 were conserved in NHX-type proteins. Motifs 8, 12, and14 were conserved in the KEA subfamily. Motifs 1, 2, 9, and 12 were conserved in CPA2-type proteins as well. The numbers and lengths of exons and introns differed among the three subfamilies of AtrCPAs (Figure 1D). The gene structures of AtrNHXs and AtrKEAs were relatively complex, while the structure was relatively simple in the AtrCPA2 subfamily.

2.3. Promoter Element Analysis

Putative promoter sequences of AtrCPAs were searched against PlantCARE to identify potential cis-acting regulatory elements, with a focus on hormone- and stress-related cis-acting elements (Figure 2). A total of 41 kinds of cis-acting elements were identified, suggesting that the expression of AtrCPAs is regulated by various mechanisms. Additionally, 162 cis-acting elements were related to hormones, including abscisic acid (ABA), auxin (IAA), gibberellin (GA), salicylic acid (SA), and methyl jasmonate (MeJA), and 501 cis-acting elements and binding sites were related to stress, including low temperature, drought, wound, and anaerobic conditions. Among these elements, the contents of antioxidant- and defense-related elements were high.

2.4. Chromosomal Localization and Synteny Analysis of AtrCPAs

Based on the location data from the Amaranthus tricolor genome database, 35 AtrCPAs were mapped to 17 chromosomes, with an uneven distribution (Figure 3). Chr1, Chr 2, Chr 5, Chr 7, and Chr 11 each contained three AtrCPA members.
Nine segmental duplication events involving ten AtrCPA genes were filtered out. No tandem duplication event was found in the AtrCPA genes (Figure 4A). To further study the origin and divergence of AtrCPA genes, duplication events were evaluated by comparisons between Amaranthus tricolor and Arabidopsis. A total of 12 collinear CPA gene pairs between Arabidopsis and Amaranthus tricolor were identified (Figure 4B). Only AtrNHX5, AtrNHX6, AtrNHX9, AtrKEA5, AtrCPA2-4, AtrCPA2-9, and AtrCPA2-16 had homologues in Arabidopsis, suggesting that other genes arose after the divergence of Arabidopsis.

2.5. Protein Interaction Analysis

To predict which proteins interact with CPAs, we used the STRING database to construct interaction networks involving Arabidopsis CPA proteins (Figure 5A–C). In the NHX subfamily, the NHX7 and NHX8 proteins showed a strong interaction with other NHX proteins in A. thaliana (Figure 5A). In the KEA subfamily (Figure 5B), the KEA2 and KEA3 proteins were predicted to interact closely with other KEA proteins in A. thaliana. In the CPA2 subfamily (Figure 5C), the CPA-2 and NHX8 proteins were predicted to interact closely with other KEA, CPA2, and NHXs in A. thaliana.

2.6. Phylogenetic Analysis of NHXs

Because NHX genes may play an important role in the salt stress response and salt tolerance [9], we focused on this sub-family. NHX proteins with full-length sequences from Arabidopsis thaliana and Oryza sativa were used to construct a phylogenetic tree based on AtrNHX proteins (Figure 6). The NHX proteins were divided into three clades, clades I, II, and III, with strong support (Bootstrap = 100%). AtrNHX1 was closely related to AtNHX7 and AtNHX8 in Arabidopsis, assigned to clade I; AtrNHX2 and AtrNHX3 were closely related to AtNHX5 and AtNHX6 in Arabidopsis, assigned to clade II; and other AtrNHXs were assigned to clade III, indicating that these genes share similar functions. In particular, AtrNHX8 was closely related to AtNHX4, which is involved in the regulation of sodium homeostasis and salt stress response.

2.7. qRT-PCR Analysis of AtrNHXs under Salt Stress

The relative expression patterns of AtrNHX genes were analyzed (Figure 7). At a low salinity level (50 mM NaCl), the expression levels of AtrNHX genes were higher than those in the control or 200 mM NaCl groups, other than AtrNHX1 and AtrNHX2, suggesting that a low salinity level is favorable for amranth growth. The expression levels of AtrNHX2, AtrNHX4, AtrNHX6, and AtrNHX8 were higher under 100 mM NaCl than in the control. These results indicated that the genes play a key role in tolerance to moderate salt stress in A. tricolor.

2.8. Analysis of AtrNHX Gene Expression in Different Tissues of Amaranth

A qRT-PCR analysis of NHX genes in different tissues of amaranth indicated that the relative expression levels of AtrNHX9 in leaves were higher than those in the roots. AtrNHX2, AtrNHX3, AtrNHX4, AtrNHX5, AtrNHX7, and AtrNHX9 levels in the stem were higher than those in the root. AtrNHX6 and AtrNHX8 showed high expression in the root (Figure 8). These results showed that AtrNHXs play different roles in different tissues of A. tricolor.

2.9. Overexpression of AtrNHX8 Enhances Salt Tolerance in Arabidopsis

The seed germination rate of 35S::AtrNHX8 was significantly higher than that of the wild type (WT) under 150 mM NaCl treatment. Furthermore, seed germination in 35S::AtrNHX8 was significantly earlier compared with that of WT under NaCl treatment (Figure 9). Germination was nearly complete in 35S::AtrNHX8 and WT after 2 days and 6 days, respectively.
To analyze the salt response in adult plants, 15-day-old seedlings in pots were irrigated with 150 mM NaCl solutions or water as a control. The phenotypic effects of salt treatment for 7 days are shown in Figure 10. The plant height and leaf size under salt stress in WT and 35S::AtrNHX8 lines were shorter and smaller compared with those under non-salt stress. There were fewer leaves with salt stress than without salt (Figure 10A,B). The contents of chlorophyll a, chlorophyll b, and total chlorophyll in WT Arabidopsis thaliana under salt stress were significantly (p ≤ 0.05) lower than those without salt stress. However, the opposite results were obtained for 35S::AtrNHX8 plants. Furthermore, the chlorophyll content in 35S::AtrNHX8 plants was significantly (p ≤ 0.05) higher than that in the WT (Figure 10C). The carotenoid content in 35S::AtrNHX8 plants was significantly (p ≤ 0.05) higher than that in the WT under salt stress (Figure 10D).
AtrNHX8 gene expression levels in Arabidopsis thaliana leaves were analyzed. The expression of the AtrNHX8 gene was significantly higher in WT Arabidopsis and 35S::AtrNHX8 transformed plants under salt stress than under non-salt stress (Figure 10E).

2.10. AtrNHX8 Could Promote Flowering in Arabidopsis thaliana

Under salt stress, 35S::AtrNHX8 lines at the 10-leaf period began to flower after 9 days. However, WT plants at the 21-leaf period began to flower after 18 days. Without salt stress, 35S::AtrNHX8 lines at the 10-leaf period began to flower after 9 days of treatment. WT plants at the 16-leaf period began to flower after 13 days of treatment (Figure 11). The results indicated that AtrNHX8 could promote flowering in Arabidopsis thaliana.

3. Discussion

CPAs can be divided into two categories: The CPA1 family, which includes Na+/H+ NHX antiporters, and the CPA2 family, which includes CHXs and KEAs. They play key roles in abiotic stress tolerance, especially in responses to salt stress [27]. The CPA family has been characterized in several plant species, such as Arabidopsis thaliana [28], Oryza sativa [29], Brassica napus [30], and Raphanus sativus [31]. In the present study, 35 CPA genes were identified in the genome of A. tricolor, including 9 NHX genes, 5 KEA genes, and 21 CPA2 genes. These CPA gene counts differed from those in other species, indicating that the CPA gene family underwent duplication events and expansions. A subcellular localization analysis of AtrCPA implied they play multiple functions in plants.
Gene functions can be predicted based on comparisons with previously characterized orthologues [32,33]. Gene evolution and potential functional differences were involved in the differences in conserved motifs. Additionally, a phylogenetic analysis showed that the nine members of the NHX family in A. tricolor could be divided into three subfamilies. AtrNHX9 was paired with AtNHX3 in subclade B1. Previous studies have shown that AtNHX3 plays a role in maintaining potassium ion homeostasis during germination and seedling growth in Arabidopsis [34]. AtrNHX8 was closely related to AtNHX4, which is involved in the regulation of sodium homeostasis and the salt stress response. These results verified that orthologous proteins have similar functions and that the NHX family genes are relatively conserved.
qRT-PCR analyses of AtrNHX gene family members under salt solution treatment revealed different gene expression trends. As the salt concentration increased, gene expression levels increased and then decreased, consistent with the results of previous studies [35]. Upon treatment with 300 mM NaCl, the transcript levels of AtNHX4 increased and then gradually decreased; quantitative real-time PCR analyses showed similar expression patterns [25]. However, the knock-out of AtNHX4 could enhance tolerance to salt stress, and Na+ contents under high NaCl stress were lower than those in WT plants [25]. AtrNHX2 and AtrNHX8 had the highest expression under 100 mM NaCl, and the remaining members were all expressed at 50 mM NaCl. There were differences in the responses of the AtrNHX genes under salt stress. A qRT-PCR analysis revealed that the family members were differentially expressed in various parts, with most family members expressed in the roots and stems, consistent with a previous study showing that NHX genes are highly expressed in the roots under salt stress, thereby enhancing salt tolerance [36]. The results of this study provide a basis for further exploration of the NHX gene family and provide a reference for analyses of the mechanism by which NHX genes contribute to the growth of amaranth, responses to abiotic stress, and development in amaranth.
In this study, salt stress inhibited seed germination in amaranth, while 35S::AtrNHX8 Arabidopsis plants showed an increased seed germination rate, earlier germination, and improved salt tolerance. A previous study has shown that salt stress delayed seed germination and reduced the germination rate in Medicago sativa, and the germination rate and germination potential of transformed plants were significantly higher than those of WT plants under salt stress conditions [11].
Both WT Arabidopsis and 35S::AtrNHX8 transformed plants were smaller and showed a lower leaf area and leaf number under the salt stress than in the non-salt stress treatment. Furthermore, the flowering time of the transformed plants was earlier than that of WT Arabidopsis. 35S::AtrNHX8-transformed plants showed higher chlorophyll contents under salt stress treatment than under non-salt stress. However, WT plants showed lower chlorophyll contents under salt stress conditions than under non-salt stress. Salt stress resulted in a decrease in the chlorophyll content in Typha domingensis Pers [37], consistent with our results.
NHX genes in the CPA (monovalent cationic reversal protein) family are widely distributed in bacteria, fungi, and higher plants and animals. The family is involved in the regulation of the cell cycle and proliferation, salt tolerance, vesicle trafficking, and growth [38]. Furthermore, NHX genes regulate flower coloration [39,40,41] and flower development [42]. The results of this study indicate that AtrNHX8 could promote flowering in Arabidopsis thaliana. Further studies are needed to determine the mechanism underlying the effects of AtrNHX8.

4. Materials and Methods

4.1. Identification of and Characterization NHX Gene Family Members in Amaranthus tricolor

Genome data for amaranth were downloaded from http://ftp.agis.org.cn:8888/~fanwei/Amaranthus_tricolor/ [26]. Gene screening was performed using a hidden Markov model. The NHX domain was downloaded from Pfam 36.0 (PF00999) (http://pfam.xfam.org/; accessed on 19 October 2021), and HMMER was used to identify all possible NHX genes in amaranth [43] with an e-value ≤ 5. Each candidate NHX gene was further confirmed using the Conserved Domain Database (CDD v3.21, http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Physical parameters of the deduced NHX proteins were investigated using ExPASy (http://web.expasy.org/protparam/).
Euk-mPLoc 2.0 (http://www.csbio.sjtu.edu.cn/bioinf/euk-multi-2/) was used to evaluate the subcellular localization of AtrCPAs. Trans-membrane domains were identified using the TMHMM Server v. 0.2.0 (http://www.cbs.dtu.dk/services/TMHMM/).

4.2. Gene Structure, Motif Composition, and Promoter Analyses

TBtools (v. 2.086, Guangzhou, China) [44] was used to analyze the exon–intron organization of AtrCPAs. Based on the amaranth genome, 2000 bp sequences upstream of the start codon (ATG) of AtrCPA genes were acquired. PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) [45] was used to predict cis-acting regulatory elements with default parameters. Conserved motifs of AtrNHX proteins were identified using the online MEME (Multiple Expectation Maximization for Motif Elicitation) (http://meme-suite.org/tools/meme (accessed on 29 October 2022). Parameter settings were set as follows: maximum number of motifs, 15; optimum motif width, ≥6 and ≤50.
To retrieve and display the repeatedly detected association networks, protein sequences were submitted to STRING (Search Tool for Recurring Instances of Neighboring Genes) v. 11.0 (https://cn.string-db.org/).

4.3. Chromosomal Localization and Synteny Analyses

The GFF3 file that contained location data for amaranth CPA genes was downloaded from the Amaranthus tricolor Genome Database [26]. The chromosomal location and results of the synteny analysis for NHX family genes were visualized using TBtools software (v. 2.086). The Arabidopsis thaliana genome was downloaded from TAIR for a synteny analysis with the amaranth genome.

4.4. Sequence Alignment and Phylogenetic Analysis of NHXs

A multiple sequence alignment of the full-length amino acid sequences of NHXs from Amaranthsus tricolor, Arabidopsis thaliana, and Oryza sativa was generated using MUSCLE (Multiple Protein Sequence Alignment) within MEGA (Molecular Evolutionary Genetics Analysis) v. 11 (https://www.megasoftware.net/). Subsequently, a phylogenetic tree was constructed using the neighbor-joining method (NJ) using MEGA11 (Version 11.0.8) with 1000 bootstrap replicates, the Jones–Taylor–Thornton (JTT) model, and pairwise deletion. The NHX protein sequences in Arabidopsis thaliana and Oryza sativa were downloaded from the Arabidopsis Information Resource (TAIR) database (http://www.arabidopsis.org/) and https://ricedata.cn, respectively.

4.5. Plant Material, Treatment, and qRT-PCR Analysis

Amaranth seeds of “Suxian No. 1” (supplied by the Suzhou Academy of Agricultural Sciences) were sown in culture pots in a chamber at 25 °C for 16/8 h (day/night). At the 3-leaf seedling stage, they were treated with different concentrations of NaCl (0, 50, 100, and 200 mM) in three biological replicates. The seedlings were grown in the same chamber at 25 °C and 16/8 h (D/N). The amaranth leaves were collected after 7 days of salt solution treatment. All samples were immediately frozen in liquid nitrogen and stored at −80 °C.
Total RNA was isolated from the collected samples using a kit (Yeasen, Shanghai, China) according to the manufacturer’s instructions. First-strand cDNA was synthesized from 1 μg of total RNA using Recombinant M-MLV Reverse Transcriptase (TransGen Biotech, Beijing, China). Quantitative real time-PCR (qRT-PCR) was performed in optical 96-well plates using the Roche LightCycler 480 instrument (Roche, Solna, Sweden). The reactions were carried out in a 20 μL volume containing 10 μL of SYBR Premix Ex Taq, 0.8 μL of specific primers, 2 μL of diluted cDNA, and 6.4 μL of ddH2O. The PCR conditions were as follows: 30 s at 95 °C, 45 cycles of 10 s at 95 °C, and 20 s at 59 °C, followed by 12 s at 72 °C. AtrEF1a [46] was used as the internal reference gene. The 2−ΔΔCt quantification method was used, and variation in expression was estimated from the three biological replicates. The primer pairs used for the qRT-PCR analysis of NHX genes are listed in Table 2.

4.6. Functional Analysis of AtrNHX8

The AtrNHX8 gene was amplified by PCR and ligated to the expression vector pCambia1301-35S-GUS. Then, the constructed recombinant vector pCambia1301-35S-AtrNHX8-GUS was transferred into Agrobacterium tumefaciens GV3101 by the freeze–thaw method [47]. In addition, transgenic A. thaliana plants were obtained by the floral dip method [48]. T2-generation transgenic plants were finally obtained through multi-generation selfing, GUS staining, and PCR. The primers used for vector construction and PCR detection are listed in Table 3.
To better understand the mechanism by which AtrNHX8 responded to salt stress, WT and T2 generation transgenic seeds from Arabidopsis were placed in Petri dishes with 3-layer filter paper, and 15 mL of 150 mM NaCl was added to each dish. Water was used as the control. In all cases, experiments were carried out in (at least) triplicate. The germination potential and final germination rate were determined at 3 days and 7 days.
The WT and T2 generation transgenic Arabidopsis seeds were sown in culture pots. Plants at the 6-leaf stage were treated with 150 mM salt solution. After 7 days of salt treatment, the leaves of WT and transgenic Arabidopsis thaliana were collected to extract RNA for qRT-PCR, following the previously described method. The primers for the AtNHX gene used for qRT-PCR are listed in Table 3. The chlorophyll and carotenoid contents were evaluated according to Liu [2].

4.7. Statistical Analyses

Data were analyzed using SPSS 17.0 software. Values of p < 0.05 were significant in comparisons between the treatments and controls. GraphPad Prism 6.01 was used to generate histograms. Figures were generated using TBtools.

5. Conclusions

Nine NHX genes were identified from a full-length transcriptome database for A. tricolor. AtrNHX8 was homologous to AtNHX4, which is involved in the regulation of sodium homeostasis and the salt stress response. AtrNHX8 overexpression in Arabidopsis thaliana resulted in better seed germination and earlier flowering times than those of the WT.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants13121701/s1, Figure S1: Analysis of transmembrane structure in Amaranthus tricolor.

Author Contributions

Conceptualization, S.L.; data analysis, Z.A., R.Y. and Y.L.; writing—original draft preparation, S.L. and Z.A.; writing—review and editing, S.L. and Z.L.; funding acquisition, S.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of Fujian Province, grant number 2023J01449; the Program of Science and Technology Innovation of the Fujian Agriculture and Forestry University, grant number KFb22024XA, KFB23039A; and the Rural Revitalization Service Team of Fujian Agriculture and Forestry University, grant number 11899170125. The APC was funded by the Rural Revitalization Service Team of Fujian Agriculture and Forestry University, grant number 11899170125.

Data Availability Statement

All datasets generated for this study are included in the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Sarker, U.; Oba, S. Augmentation of leaf color parameters, pigments, vitamins, phenolic acids, flavonoids and antioxidant activity in selected Amaranthus tricolor under salinity stress. Sci. Rep. 2018, 8, 12349. [Google Scholar] [CrossRef]
  2. Liu, S.; Zheng, X.; Pan, J.; Peng, L.; Cheng, C.; Wang, X.; Zhao, C.; Zhang, Z.; Lin, Y.; Xuhan, X. RNA-sequencing analysis reveals betalains metabolism in the leaf of Amaranthus tricolor L. PLoS ONE 2019, 14, e0216001. [Google Scholar] [CrossRef]
  3. Liu, S.; Wang, X.; Peng, L. Comparative transcriptomic analysis of the metabolism of betalains and flavonoids in red amaranth hypocotyl under blue light and dark conditions. Molecules 2023, 28, 5627. [Google Scholar] [CrossRef]
  4. Giordano, M.; Petropoulos, S.A.; Rouphael, Y. Response and defence mechanisms of vegetable crops against drought, heat and salinity stress. Agriculture 2021, 11, 463. [Google Scholar] [CrossRef]
  5. Vargas-Ortiz, E.; Ramírez-Tobias, H.M.; González-Escobar, J.L.; Gutierrez-Garcia, A.K.; Bojorquez-Velazquez, E.; Espitia-Rangel, E.; de la Rosa, A.P.B. Biomass, chlorophyll fluorescence, and osmoregulation traits let differentiation of wild and cultivated Amaranthus under water stress. J. Photochem. Photobiol. B Biol. 2021, 220, 112210. [Google Scholar] [CrossRef]
  6. Netshimbupfe, M.H.; Berner, J.; Gouws, C. The interactive effects of drought and heat stress on photosynthetic efficiency and biochemical defense mechanisms of Amaranthus species. Plant-Environ. Interact. 2022, 3, 212–225. [Google Scholar] [CrossRef]
  7. Sarker, U.; Oba, S. Drought stress effects on growth, ROS markers, compatible solutes, phenolics, flavonoids, and antioxidant activity in Amaranthus tricolor. Appl. Biochem. Biotechnol. 2018, 186, 999–1016. [Google Scholar] [CrossRef]
  8. Liang, W.; Ma, X.; Wan, P.; Liu, L. Plant salt-tolerance mechanism: A review. Biochem. Biophys. Res. Commun. 2018, 495, 286–291. [Google Scholar] [CrossRef]
  9. Shen, C.; Yuan, J.; Li, X.; Chen, R.; Li, D.; Wang, F.; Liu, X.; Li, X. Genome-wide identification of NHX (Na+/H+ antiporter) gene family in Cucurbita L. and functional analysis of CmoNHX1 under salt stress. Front. Plant Sci. 2023, 14, 1136810. [Google Scholar] [CrossRef]
  10. Hossain, M.N.; Sarker, U.; Raihan, M.S.; Al-Huqail, A.A.; Siddiqui, M.H.; Oba, S. Influence of salinity stress on color parameters, leaf pigmentation, polyphenol and flavonoid contents, and antioxidant activity of Amaranthus lividus leafy vegetables. Molecules 2022, 27, 1821. [Google Scholar] [CrossRef]
  11. Xie, J.; Li, Y.; Jiang, G.; Sun, H.; Liu, X.; Han, L. Seed color represents salt resistance of alfalfa seeds (Medicago sativa L.): Based on the analysis of germination characteristics, seedling growth and seed traits. Front. Plant Sci. 2023, 14, 1104948. [Google Scholar] [CrossRef]
  12. Bassil, E.; Blumwald, E. The ins and outs of intracellular ion homeostasis: NHX-type cation/H+ transporters. Curr. Opin. Plant Biol. 2014, 22, 1–6. [Google Scholar] [CrossRef]
  13. Bassil, E.; Coku, A.; Blumwald, E. Cellular ion homeostasis: Emerging roles of intracellular NHX Na+/H+ antiporters in plant growth and development. J. Exp. Bot. 2012, 63, 5727–5740. [Google Scholar] [CrossRef]
  14. Masrati, G.; Dwivedi, M.; Rimon, A.; Gluck-Margolin, Y.; Kessel, A.; Ashkenazy, H.; Mayrose, I.; Padan, E.; Ben-Tal, N. Broad phylogenetic analysis of cation/proton antiporters reveals transport determinants. Nat. Commun. 2018, 9, 4205. [Google Scholar] [CrossRef]
  15. Horie, T.; Hauser, F.; Schroeder, J.I. HKT transporter-mediated salinity resistance mechanisms in Arabidopsis and monocot crop plants. Trends Plant Sci. 2009, 14, 660–668. [Google Scholar] [CrossRef]
  16. Mondal, R.; Rimon, A.; Masrati, G.; Ben-Tal, N.; Friedler, A.; Padan, E. Towards molecular understanding of the pH dependence characterizing NhaA of which structural fold is shared by other transporters. J. Mol. Biol. 2021, 433, 167156. [Google Scholar] [CrossRef]
  17. Chanroj, S.; Wang, G.; Venema, K.; Zhang, M.W.; Delwiche, C.F.; Sze, H. Conserved and diversified gene families of monovalent cation/h(+) antiporters from algae to flowering plants. Front. Plant Sci. 2012, 3, 25. [Google Scholar] [CrossRef]
  18. Keisham, M.; Mukherjee, S.; Bhatla, S.C. Mechanisms of sodium transport in plants-progresses and challenges. Int. J. Mol. Sci. 2018, 19, 647. [Google Scholar] [CrossRef]
  19. Bassil, E.; Zhang, S.; Gong, H.; Tajima, H.; Blumwald, E. Cation specificity of vacuolar NHX-type cation/H+ antiporters. Plant Physiol. 2019, 179, 616–629. [Google Scholar] [CrossRef]
  20. Akram, U.; Song, Y.; Liang, C.; Abid, M.A.; Askari, M.; Myat, A.A.; Abbas, M.; Malik, W.; Ali, Z.; Guo, S.; et al. Genome-wide characterization and expression analysis of NHX gene family under salinity stress in Gossypium barbadense and its comparison with Gossypium hirsutum. Genes 2020, 11, 803. [Google Scholar] [CrossRef]
  21. Wu, G.Q.; Wang, J.L.; Li, S.J. Genome-wide identification of Na+/H+ antiporter (NHX) genes in sugar beet (Beta vulgaris L.) and their regulated expression under salt stress. Genes 2019, 10, 401. [Google Scholar] [CrossRef]
  22. Dong, J.; Liu, C.; Wang, Y.; Zhao, Y.; Ge, D.; Yuan, Z. Genome-wide identification of the NHX gene family in Punica granatum L. and their expressional patterns under salt stress. Agronomy 2021, 11, 264. [Google Scholar] [CrossRef]
  23. Gálvez, F.J.; Baghour, M.; Hao, G.; Cagnac, O.; Rodríguez-Rosales, M.P.; Venema, K. Expression of LeNHX isoforms in response to salt stress in salt sensitive and salt tolerant tomato species. Plant Physiol. Biochem. 2012, 51, 109–115. [Google Scholar] [CrossRef]
  24. Almeida, D.M.; Gregorio, G.B.; Oliveira, M.M.; Saibo, N.J. Five novel transcription factors as potential regulators of OsNHX1 gene expression in a salt tolerant rice genotype. Plant Mol. Biol. 2017, 93, 61–77. [Google Scholar] [CrossRef]
  25. Li, H.T.; Liu, H.; Gao, X.S.; Zhang, H. Knock-out of Arabidopsis AtNHX4 gene enhances tolerance to salt stress. Biochem. Biophys. Res. Commun. 2009, 382, 637–641. [Google Scholar] [CrossRef]
  26. Wang, H.; Xu, D.; Wang, S.; Wang, A.; Lei, L.; Jiang, F.; Yang, B.; Yuan, L.; Chen, R.; Zhang, Y. Chromosome-scale Amaranthus tricolor genome provides insights into the evolution of the genus Amaranthus and the mechanism of betalain biosynthesis. DNA Res. 2023, 30, dsac050. [Google Scholar] [CrossRef]
  27. Jia, Q.; Zheng, C.; Sun, S.; Amjad, H.; Liang, K.; Lin, W. The role of plant cation/proton antiporter gene family in salt tolerance. Biol. Plant. 2018, 62, 617–629. [Google Scholar] [CrossRef]
  28. Mäser, P.; Thomine, S.; Schroeder, J.I.; Ward, J.M.; Hirschi, K.; Sze, H.; Talke, I.N.; Amtmann, A.; Maathuis, F.J.M.; Sanders, D.; et al. Phylogenetic relationships within cation transporter families of Arabidopsis. Plant Physiol. 2001, 126, 1646–1667. [Google Scholar] [CrossRef]
  29. Zeng, Y.; Li, Q.; Wang, H.; Zhang, J.; Du, J.; Feng, H.; Blumwald, E.; Yu, L.; Xu, G. Two NHX-type transporters from Helianthus tuberosus improve the tolerance of rice to salinity and nutrient deficiency stress. Plant Biotechnol. J. 2018, 16, 310–321. [Google Scholar] [CrossRef]
  30. Yue, C.P.; Han, L.; Sun, S.S.; Chen, J.F.; Feng, Y.N.; Huang, J.Y.; Zhou, T.; Hua, Y.P. Genome-wide identification of the cation/proton antiporter (CPA) gene family and functional characterization of the key member BnaA05.NHX2 in allotetraploid rapeseed. Gene 2024, 894, 148025. [Google Scholar] [CrossRef]
  31. Wang, Y.; Ying, J.; Zhang, Y.; Xu, L.; Zhang, W.; Ni, M.; Zhu, Y.; Liu, L. Genome-wide identification and functional characterization of the cation proton antiporter (CPA) family related to salt stress response in radish (Raphanus sativus L.). Int. J. Mol. Sci. 2020, 21, 8262. [Google Scholar] [CrossRef]
  32. Chen, R.; Jeong, S.S. Functional prediction: Identification of protein orthologs and paralogs. Protein Sci. 2000, 9, 2344–2353. [Google Scholar] [CrossRef]
  33. Khaksar, G.; Sirikantaramas, S. Transcriptome-wide identification and expression profiling of the ERF gene family suggest roles as transcriptional activators and repressors of fruit ripening in durian. PLoS ONE 2021, 16, e0252367. [Google Scholar] [CrossRef]
  34. Liu, H.; Tang, R.; Zhang, Y.U.; Wang, C.; Lv, Q.; Gao, X.; Li, W.; Zhang, H. AtNHX3 is a vacuolar K+/H+ antiporter required for low-potassium tolerance in Arabidopsis thaliana. Plant Cell Environ. 2010, 33, 1989–1999. [Google Scholar] [CrossRef]
  35. Li, N.; Wang, X.; Ma, B.; Du, C.; Zheng, L.; Wang, Y. Expression of a Na+/H+ antiporter RtNHX1 from a recretohalophyte Reaumuria trigyna improved salt tolerance of transgenic Arabidopsis thaliana. J. Plant Physiol. 2017, 218, 109–120. [Google Scholar] [CrossRef]
  36. Krishnamurthy, P.; Vishal, B.; Khoo, K.; Rajappa, S.; Loh, C.S.; Kumar, P.P. Expression of AoNHX1 increases salt tolerance of rice and Arabidopsis, and bHLH transcription factors regulate AtNHX1 and AtNHX6 in Arabidopsis. Plant Cell Rep. 2019, 38, 1299–1315. [Google Scholar] [CrossRef]
  37. Akhter, N.; Aqeel, M.; Shahnaz, M.M.; Alnusairi, G.S.; Alghanem, S.M.; Kousar, A.; Hashem, M.; Kanwal, H.; Alamri, S.; Ilyas, A.; et al. Physiological homeostasis for ecological success of Typha (Typha domingensis Pers.) populations in saline soils. Physiol. Mol. Biol. Plants 2021, 27, 687–701. [Google Scholar] [CrossRef]
  38. Brett, C.L.; Donowitz, M.; Rao, R. Evolutionary origins of eukaryotic sodium/proton exchangers. Am. J. Physiol.-Cell Physiol. 2005, 288, C223–C239. [Google Scholar] [CrossRef]
  39. Ohnishi, M.; Fukada-Tanaka, S.; Hoshino, A.; Takada, J.; Inagaki, Y.; Iida, S. Characterization of a novel Na+/H+ antiporter gene InNHX2 and comparison of InNHX2 with InNHX1, which is responsible for blue flower coloration by increasing the vacuolar pH in the Japanese morning glory. Plant Cell Physiol. 2005, 46, 259–267. [Google Scholar] [CrossRef]
  40. Yamaguchi, T.; Fukada-Tanaka, S.; Inagaki, Y.; Saito, N.; Yonekura-Sakakibara, K.; Tanaka, Y.; Kusumi, T.; Iida, S. Genes encoding the vacuolar Na+/H+ exchanger and flower coloration. Plant Cell Physiol. 2001, 42, 451–461. [Google Scholar] [CrossRef]
  41. Xu, Q.; Xia, M.; He, G.; Zhang, Q.; Meng, Y.; Ming, F. New insights into the influence of NHX-type Cation/H+ antiporter on flower color in Phalaenopsis orchids. J. Plant Physiol. 2022, 279, 153857. [Google Scholar] [CrossRef]
  42. Bassil, E.; Tajima, H.; Liang, Y.C.; Ohto, M.A.; Ushijima, K.; Nakano, R.; Esumi, T.; Coku, A.; Belmonte, M.; Blumwald, E. The Arabidopsis Na+/H+ antiporters NHX1 and NHX2 control vacuolar pH and K+ homeostasis to regulate growth, flower development, and reproduction. Plant Cell 2011, 23, 3482–3497. [Google Scholar] [CrossRef]
  43. Chen, Z.Y.; Guo, X.J.; Chen, Z.X.; Chen, W.Y.; Liu, D.C.; Zheng, Y.L.; Liu, Y.X.; Wei, Y.M.; Wang, J.R. Genome-wide characterization of developmental stage-and tissue-specific transcription factors in wheat. BMC Genom. 2015, 16, 125. [Google Scholar] [CrossRef]
  44. Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef]
  45. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
  46. Fang, X.; Youfeng, Z.; Jialan, C.; Chunli, Z.; He, C.; Le, W.; Shengcai, L. Selection and validation of reference genes in all-red amaranth (Amaranthus tricolor L.) seedlings under different culture conditions. J. Hortic. Sci. Biotechnol. 2021, 96, 604–613. [Google Scholar] [CrossRef]
  47. Wise, A.A.; Liu, Z.; Binns, A.N. Three methods for the introduction of foreign DNA into Agrobacterium. Agrobact. Protoc. 2006, 343, 43–54. [Google Scholar]
  48. Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef]
Figure 1. Conserved motifs and gene structure of AtrCPAs. (A) Phylogeny analysis of AtrCPAs; (B) conserved motif distribution in AtrCPA proteins; (C) conserved domains of AtrCPA proteins; (D) exon–intron structure of AtrCPAs. TBtools v. 2.086 was used to present the chart.
Figure 1. Conserved motifs and gene structure of AtrCPAs. (A) Phylogeny analysis of AtrCPAs; (B) conserved motif distribution in AtrCPA proteins; (C) conserved domains of AtrCPA proteins; (D) exon–intron structure of AtrCPAs. TBtools v. 2.086 was used to present the chart.
Plants 13 01701 g001
Figure 2. Distribution cis-acting regulatory elements in the promoter regions of AtrCPAs. TBtools v. 2.086 was used to present the chart.
Figure 2. Distribution cis-acting regulatory elements in the promoter regions of AtrCPAs. TBtools v. 2.086 was used to present the chart.
Plants 13 01701 g002
Figure 3. Chromosomal distribution of 35 AtrCPA genes.
Figure 3. Chromosomal distribution of 35 AtrCPA genes.
Plants 13 01701 g003
Figure 4. Syntenic analyses of CPA genes. (A) Segmental duplication events of CPA genes in Amaranthus tricolor. (B) Duplication events of NHX genes in Amaranthus tricolor and Arabidopsis. Red lines indicate CPA duplication events. Gray lines represent all synteny blocks. TBtools v. 2.086 was used to present the chart.
Figure 4. Syntenic analyses of CPA genes. (A) Segmental duplication events of CPA genes in Amaranthus tricolor. (B) Duplication events of NHX genes in Amaranthus tricolor and Arabidopsis. Red lines indicate CPA duplication events. Gray lines represent all synteny blocks. TBtools v. 2.086 was used to present the chart.
Plants 13 01701 g004
Figure 5. Protein–protein interaction networks involving CPAs in Arabidopsis. (AC). Interaction networks of AtNHXs (A), AtKEAs (B), and AtCPA2 (C).
Figure 5. Protein–protein interaction networks involving CPAs in Arabidopsis. (AC). Interaction networks of AtNHXs (A), AtKEAs (B), and AtCPA2 (C).
Plants 13 01701 g005
Figure 6. Neighbor-joining phylogenetic tree of NHX proteins from Amaranth tricolor, Arabidopsis thaliana, and Oryza sativa. NHXs were divided into three major groups. The phylogenetic tree was constructed using MEGA X. The numbers at the nodes indicate bootstrap 1000.
Figure 6. Neighbor-joining phylogenetic tree of NHX proteins from Amaranth tricolor, Arabidopsis thaliana, and Oryza sativa. NHXs were divided into three major groups. The phylogenetic tree was constructed using MEGA X. The numbers at the nodes indicate bootstrap 1000.
Plants 13 01701 g006
Figure 7. qRT-PCR analysis of AtrNHX genes under salt stress. The data are presented as mean ± standard error and were subjected to analysis of variance (ANOVA). The means were compared using the ad hoc Tukey test (p < 0.05%). Lowercase letters represent significant differences at the 0.05 level.
Figure 7. qRT-PCR analysis of AtrNHX genes under salt stress. The data are presented as mean ± standard error and were subjected to analysis of variance (ANOVA). The means were compared using the ad hoc Tukey test (p < 0.05%). Lowercase letters represent significant differences at the 0.05 level.
Plants 13 01701 g007
Figure 8. Expression trends of AtrNHX genes in different tissues. The data are presented as mean ± standard error and were subjected to analysis of variance (ANOVA). The means were compared using the ad hoc Tukey test (p < 0.05%). Lowercase letters represent significant differences at the 0.05 level.
Figure 8. Expression trends of AtrNHX genes in different tissues. The data are presented as mean ± standard error and were subjected to analysis of variance (ANOVA). The means were compared using the ad hoc Tukey test (p < 0.05%). Lowercase letters represent significant differences at the 0.05 level.
Plants 13 01701 g008
Figure 9. Seed germination in Arabidopsis thaliana under salt stress.
Figure 9. Seed germination in Arabidopsis thaliana under salt stress.
Plants 13 01701 g009
Figure 10. Relative expression of GUS in Arabidopsis thaliana leaves under salt stress. (A1,A2) represent wild-type Arabidopsis before salt treatment, (A3,A4) represents wild-type Arabidopsis with 0 mM and 150 mM NaCl treatment for 7 days, respectively. (B1,B2) represent 35S::AtrNHX8 Arabidopsis before salt treatment, (B3,B4) represent 35S::AtrNHX8 Arabidopsis with 0 mM and 150 mM NaCl treatment for 7 days, respectively. (C,D) show the chlorophyll and carotenoid contents, respectively. (E) represents the relative expression of NHX8 in Arabidopsis thaliana leaves. The data are presented as mean ± standard error and were subjected to analysis of variance (ANOVA). The means were compared using the ad hoc Tukey test (p < 0.05%). Lowercase letters represent significant differences at the 0.05 level.
Figure 10. Relative expression of GUS in Arabidopsis thaliana leaves under salt stress. (A1,A2) represent wild-type Arabidopsis before salt treatment, (A3,A4) represents wild-type Arabidopsis with 0 mM and 150 mM NaCl treatment for 7 days, respectively. (B1,B2) represent 35S::AtrNHX8 Arabidopsis before salt treatment, (B3,B4) represent 35S::AtrNHX8 Arabidopsis with 0 mM and 150 mM NaCl treatment for 7 days, respectively. (C,D) show the chlorophyll and carotenoid contents, respectively. (E) represents the relative expression of NHX8 in Arabidopsis thaliana leaves. The data are presented as mean ± standard error and were subjected to analysis of variance (ANOVA). The means were compared using the ad hoc Tukey test (p < 0.05%). Lowercase letters represent significant differences at the 0.05 level.
Plants 13 01701 g010
Figure 11. Flowering diagram of wild-type and AtrNHX8 transgenic plants. (A1,A2) represent wild-type Arabidopsis thaliana and 35S::AtrNHX8 lines without salt treatment; (B1,B2) represent wild-type and 35S::AtrNHX8 lines with 150 mM NaCl. AtrNHX8 promoted flowering in Arabidopsis thaliana.
Figure 11. Flowering diagram of wild-type and AtrNHX8 transgenic plants. (A1,A2) represent wild-type Arabidopsis thaliana and 35S::AtrNHX8 lines without salt treatment; (B1,B2) represent wild-type and 35S::AtrNHX8 lines with 150 mM NaCl. AtrNHX8 promoted flowering in Arabidopsis thaliana.
Plants 13 01701 g011
Table 1. Identification and sequence analysis of the CPA gene family in amaranth.
Table 1. Identification and sequence analysis of the CPA gene family in amaranth.
Sequence IDGene NameNumber of Amino AcidsMolecular Weight/kDaTheoretical pIInstability IndexAliphatic IndexGrand Average of HydropathicityNumber of Predicted TMHsLocalization
g1127.t1AtrNHX11158128.236.9636.5398.320.05112Plasma Membrane
g3986.t1AtrNHX228331.855.5754.1797.490.1955Vacuole
g3987.t1AtrNHX324125.905.4643.79123.40.8345Vacuole
g6525.t1AtrNHX453659.056.0837.48114.940.51511Plasma Membrane
g6555.t1AtrNHX554460.347.7330.13107.50.5511Vacuole
g14299.t1AtrNHX654059.746.3132.79107.040.51712Vacuole
g14654.t1AtrNHX753859.166.5633.61113.980.53811Plasma Membrane
g21099.t1AtrNHX853559.647.0342.28109.10.53411Vacuole
g25914.t1AtrNHX958265.77833.13108.990.44711Vacuole
g3924.t1AtrKEA11217131.975.0244.9103.80.0210Nucleus
g7796.t1AtrKEA279586.195.2837.74114.920.3310Plasma Membrane
g11419.t1AtrKEA31250135.366.5740.14106.290.29910Chloroplast
g11543.t1AtrKEA443547.696.8239.54121.70.6378Plasma Membrane
g22883.t1AtrKEA558263.815.7228.64116.720.56810Plasma Membrane
g784.t1AtrCPA2-182690.056.0839.08114.250.34612Vacuole
g1479.t1AtrCPA2-267374.595.5735.87111.340.358Vacuole
g3652.t1AtrCPA2-380889.608.7140.42114.130.28712Vacuole
g4917.t1AtrCPA2-480286.247.5833.28110.390.38710Plasma Membrane
g5517.t1AtrCPA2-576285.318.9436.32102.170.17811Plasma Membrane
g6141.t1AtrCPA2-671177.637.2339.87105.40.38Plasma Membrane
g10210.t1AtrCPA2-722225.085.7523.57109.140.1941Nucleus
g10238.t1AtrCPA2-877085.949.2138.62102.480.22610Plasma Membrane
g10240.t1AtrCPA2-980689.348.9744.39115.090.349Plasma Membrane
g11973.t1AtrCPA2-1077485.267.8431.56109.560.35910Plasma Membrane
g13265.t1AtrCPA2-1127930.96736.97132.080.9076Plasma Membrane
g13271.t1AtrCPA2-1281190.626.4230.28111.370.40610Plasma Membrane
g15229.t1AtrCPA2-1378788.435.7936.95107.850.3119Plasma Membrane
g15998.t1AtrCPA2-1484292.277.638.75108.970.2639Plasma Membrane
g17069.t1AtrCPA2-1582790.985.945.8115.940.35512Plasma Membrane
g18403.t1AtrCPA2-1680086.728.5737.7109.310.38810Plasma Membrane
g19386.t1AtrCPA2-1742247.494.5837.88108.290.225Plasma Membrane
g22241.t1AtrCPA2-1877985.988.3327114.390.37110Plasma Membrane
g23418.t1AtrCPA2-1978989.829.0239.21111.720.28511Plasma Membrane
g25711.t1AtrCPA2-2028031.269.4727.61114.820.4746Plasma Membrane
g26069.t1AtrCPA2-2179187.758.1129.87104.840.27711Plasma Membrane
Table 2. Quantitative primer sequences for AtrNHX genes.
Table 2. Quantitative primer sequences for AtrNHX genes.
Gene NameForward Primer Sequences (5′-3′)Reverse Primer Sequences (5′-3′)
AtrNHX1TGTCATTGCCCAAGGTGTTTCTCTCCAGTCCAAACCAT
AtrNHX2CCAGGGCTGTGAATGTGTTCCAGGGCTGTGAATGTGTT
AtrNHX3CAGAAACAAGCATCAGGGAAAAGTGAGGCTATGAAGGTCC
AtrNHX4TCATTTACTTGCTGCCACCGCTGCGTCAATCCAATCTT
AtrNHX5GCTTTCGCAACACTGTCTTTCAACCATCACTAAACCGAGC
AtrNHX6ATGCTTGCCGAACTCTTCTCTCAATGTCTAATGCGTCC
AtrNHX7TGAGGAAGATTGGTTTGACGAGGTCGCATCATTCACTACTC
AtrNHX8GGGAAGGTGTTGTAAATGATGCTCCTGTCAGAACTCCGAGAATG
AtrNHX9CGTGTTTCCTTTATCCGCCATCGTAGCATTGACAGTATCC
AtrEF1aGGGATGCTGGTATGGTGAAACGGGTCATTTCTTCTTCTGAG
Table 3. PCR and qRT-PCR primer design for transgenic Arabidopsis thaliana.
Table 3. PCR and qRT-PCR primer design for transgenic Arabidopsis thaliana.
GeneForward Primer Sequences (5′-3′)Reverse Primer Sequences (5′-3′)Usage
AtrNHX8CGGGGTACCATGCGATGAAAGTGCCTTTACGCGTCGACCCTATTACTGAAGTAGTCTACVector construction
GUSACGTCCTGAAGAAACCCCAACCTCCCGGCAATAACATACGGCGTPCR
HygCTATTTCTTTGCCCTCGGACGAGGAATCGGTCAATACACTACATGGCPCR
AtNHX4CTTGACTGTGTTCTTCTGCGCAACGTCCCATTTCTCGATqRT-PCR
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, S.; An, Z.; Li, Y.; Yang, R.; Lai, Z. Genome-Wide Identification of the Cation/Proton Antiporter (CPA) Gene Family and Functional Analysis of AtrNHX8 under Salt Stress. Plants 2024, 13, 1701. https://doi.org/10.3390/plants13121701

AMA Style

Liu S, An Z, Li Y, Yang R, Lai Z. Genome-Wide Identification of the Cation/Proton Antiporter (CPA) Gene Family and Functional Analysis of AtrNHX8 under Salt Stress. Plants. 2024; 13(12):1701. https://doi.org/10.3390/plants13121701

Chicago/Turabian Style

Liu, Shengcai, Zixian An, Yixuan Li, Rongzhi Yang, and Zhongxiong Lai. 2024. "Genome-Wide Identification of the Cation/Proton Antiporter (CPA) Gene Family and Functional Analysis of AtrNHX8 under Salt Stress" Plants 13, no. 12: 1701. https://doi.org/10.3390/plants13121701

APA Style

Liu, S., An, Z., Li, Y., Yang, R., & Lai, Z. (2024). Genome-Wide Identification of the Cation/Proton Antiporter (CPA) Gene Family and Functional Analysis of AtrNHX8 under Salt Stress. Plants, 13(12), 1701. https://doi.org/10.3390/plants13121701

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop