Genetic Differentiation and Relationship among Castanopsis chinensis, C. qiongbeiensis, and C. glabrifolia (Fagaceae) as Revealed by Nuclear SSR Markers
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tong, H.; Deng, H.; Han, Z. Genetic differentiation and genetic structure of mixed-ploidy Camellia hainanica populations. PeerJ 2023, 11, e14756. [Google Scholar] [CrossRef]
- Wei, X.Y.; Wang, T.; Zhou, J.; Sun, W.Y.; Jin, D.M.; Xiang, J.Y.; Shao, J.W.; Yan, Y.H. Simplified genomic data revealing the decline of Aleuritopteris grevilleoides population accompanied by the uplift of dry-hot valley in Yunnan, China. Plants 2023, 12, 1579. [Google Scholar] [CrossRef]
- Antonelli, A.; Kissling, W.D.; Flantua, S.G.A.; Bermúdez, M.A.; Mulch, A.; Muellner-Riehl, A.N.; Kreft, H.; Linder, H.P.; Badgley, C.; Fjeldså, J.; et al. Geological and climatic influences on mountain biodiversity. Nature Geosci. 2018, 11, 718–725. [Google Scholar] [CrossRef]
- Sanín, M.J.; Mejía-Franco, F.G.; Paris, M.; Valencia-Montoya, W.A.; Salamin, N.; Kessler, M.; Olivares, I.; Jaramillo, J.S.; Cardona, A. Geogenomics of montane palms points to Miocene–Pliocene Andean segmentation related to strike-slip tectonics. J. Biogeogr. 2022, 49, 1711–1725. [Google Scholar] [CrossRef]
- Chen, Y.; Ren, L.; Lou, Y.; Tang, L.; Yang, J.; Su, L. Effects of climate change on climate suitability of green orange planting in Hainan Island, China. Agriculture 2022, 12, 349. [Google Scholar] [CrossRef]
- Wu, L.; Xu, H.; Jian, S.; Gong, X.; Feng, X. Geographic factors and climatic fluctuation drive the genetic structure and demographic history of Cycas taiwaniana (Cycadaceae), an endemic endangered species to Hainan Island in China. Ecol. Evol. 2022, 12, e9508. [Google Scholar] [CrossRef]
- Zhu, Z.; Harris, A.; Nizamani, M.M.; Thornhill, A.H.; Scherson, R.A.; Wang, H. Spatial phylogenetics of the native woody plant species in Hainan, China. Ecol. Evol. 2021, 11, 2100–2109. [Google Scholar] [CrossRef]
- Huo, X.; Yang, Z.; Xie, Y.; Yang, Y. Tempo and mode of floristic exchanges between Hainan Island and mainland Asia: A case study of the Persea group (Lauraceae). Forests 2022, 13, 1722. [Google Scholar] [CrossRef]
- Liu, Y.Y.; Jin, W.T.; Wei, X.X.; Wang, X.Q. Phylotranscriptomics reveals the evolutionary history of subtropical East Asian white pines: Further insights into gymnosperm diversification. Mol. Phylogenet. Evol. 2022, 168, 107403. [Google Scholar] [CrossRef]
- Liu, Y.; Pham, H.T.; He, Z.; Wei, C. Phylogeography of the cicada Platypleura hilpa in subtropical and tropical East Asia based on mitochondrial and nuclear genes and microsatellite markers. Int. J. Biol. Macromol. 2020, 151, 529–544. [Google Scholar] [CrossRef]
- Jiang, X.L.; Gardner, E.M.; Meng, H.H.; Deng, M.; Xu, G.B. Land bridges in the Pleistocene contributed to flora assembly on the continental islands of South China: Insights from the evolutionary history of Quercus championii. Mol. Phylogenet. Evol. 2019, 132, 36–45. [Google Scholar] [CrossRef] [PubMed]
- Pinheiro, F.; Veiga, G.S.; Chaves, C.J.N.; Da Costa Cacossi, T.; Da Silva, C.P. Reproductive barriers and genetic differentiation between continental and island populations of Epidendrum fulgens (Orchidaceae). Plant Syst. Evol. 2021, 307, 36. [Google Scholar] [CrossRef]
- Chen, X.M.; Yu, B.P. A review of the genus of Castanopsis in Guangdong and Hainan. J. South. China Agric. Univ. 1991, 12, 87–95. [Google Scholar]
- Huang, C.J.; Chang, Y.T.; Bruce, B. Fagaceae. In Flora of China; Wu, Z.Y., Raven, P.H., Hong, D.Y., Eds.; Science Press and Missouri Botanical Garden Press: Beijing, China, 1999; pp. 315–333. ISBN 7030075730. [Google Scholar]
- Wang, Z.; Wu, X.; Sun, B.; Yin, S.; Quan, C.; Shi, G. First fossil record of Castanopsis (Fagaceae) from the middle Miocene Fotan Group of Fujian, southeastern China. Rev. Palaeobot. Palyno. 2022, 305, 104729. [Google Scholar] [CrossRef]
- Ashton, P.; Zhu, H. The tropical-subtropical evergreen forest transition in East Asia: An exploration. Plant Diversity 2020, 42, 255–280. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.F.; Lin, P.; Huang, Y.L.; He, R.J.; Yang, B.Y.; Liu, Z.B. Isolation of two new phenolic glycosides from Castanopsis chinensis Hance by combined multistep CC and HSCCC separation and evaluation of their antioxidant activity. Molecules 2023, 28, 3331. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Huang, J.G.; Li, J.; Liang, H.; Yu, B.; Ma, Q.; Jiang, S.; Lu, X.; Fu, S.; Ye, Q.; et al. Nitrogen addition to the canopy of Castanopsis chinensis (Sprengel) Hance promoted xylem formation in a subtropical forest in China. Ann. Forest Sci. 2020, 77, 56. [Google Scholar] [CrossRef]
- Chen, L.; Zhang, Z.G.; Hu, Y.; Li, X.W.; Li, J.Q. A new species and one new name in Castanopsis (Fagaceae) from Hainan, China. Novo 2011, 21, 317–321. [Google Scholar] [CrossRef]
- Zhijian, Y.; Chunlei, X.; Hua, P. Validation of four names of Castanopsis (Fagaceae) from Hainan, southern China. Bangl. J. Plant Taxon. 1970, 18, 77–79. [Google Scholar] [CrossRef]
- Fu, D.D.; Wang, J.; Liu, Y.F.; Huang, H.W. Isolation of Microsatellite Markers for Castanopsis fargesii (Fagaceae). J. Trop. Subtrop. Bot. 2010, 18, 541–554. [Google Scholar] [CrossRef]
- Chen, L.; Li, X.W.; Li, J.Q. Taxonomic notes on Castanopsis (Fagaceae, Castaneoideae) from China. Phytotaxa 2013, 146, 50–60. [Google Scholar] [CrossRef]
- Chen, S.; Chen, R.; Zeng, X.; Chen, X.; Qin, X.; Zhang, Z.; Sun, Y. Genetic diversity, population structure, and conservation units of Castanopsis sclerophylla (Fagaceae). Forests 2022, 13, 1239. [Google Scholar] [CrossRef]
- Chen, X.; Feng, Y.; Chen, S.; Yang, K.; Wen, X.; Sun, Y. Species delimitation and genetic relationship of Castanopsis hainanensis and Castanopsis wenchangensis (Fagaceae). Plants 2023, 12, 3544. [Google Scholar] [CrossRef] [PubMed]
- Duryea, M.C.; Zamudio, K.R.; Brasileiro, C.A. Vicariance and marine migration in continental island populations of a frog endemic to the Atlantic Coastal forest. Heredity 2015, 115, 225–234. [Google Scholar] [CrossRef] [PubMed]
- Setsuko, S.; Sugai, K.; Tamaki, I.; Takayama, K.; Kato, H. Contrasting genetic diversity between Planchonella obovata sensu lato (Sapotaceae) on old continental and young oceanic Island populations in Japan. PLoS ONE 2022, 17, e0273871. [Google Scholar] [CrossRef] [PubMed]
- Götz, J.; Rajora, O.P.; Gailing, O. Genetic structure of natural northern range-margin mainland, peninsular, and island populations of northern red oak (Quercus rubra L.). Front. Ecol. Evol. 2022, 10, 907414. [Google Scholar] [CrossRef]
- Cao, Y.N.; Zhu, S.S.; Chen, J.; Comes, H.P.; Wang, I.J.; Chen, L.Y.; Sakaguchi, S.; Ying-Xiong, Q. Genomic insights into historical population dynamics, local adaptation, and climate change vulnerability of the East Asian Tertiary relict Euptelea (Eupteleaceae). Evol. Appl. 2020, 13, 2038–2055. [Google Scholar] [CrossRef] [PubMed]
- Qi, H.; Sun, X.; Wang, C.; Chen, X.; Yan, W.; Chen, J.; Xia, T.; Ye, H.; Yu, J.; Dai, J.; et al. Geographic isolation causes low genetic diversity and significant pedigree differentiation in populations of Camellia drupifera, a woody oil plant native to China. Ind. Crop. Prod. 2023, 192, 116026. [Google Scholar] [CrossRef]
- Wang, Z.; Lian, J.; Huang, G.; Ye, W.; Cao, H.; Wang, Z. Genetic groups in the common plant species Castanopsis chinensis and their associations with topographic habitats. Oikos 2012, 121, 2044–2051. [Google Scholar] [CrossRef]
- Wang, Z.F.; Lian, J.Y.; Ye, W.H.; Cao, H.L.; Wang, Z.M. The spatial genetic pattern of Castanopsis chinensis in a large forest plot with complex topography. Forest Ecol. Manag. 2014, 318, 318–325. [Google Scholar] [CrossRef]
- Princepe, D.; Czarnobai, S.; Pradella, T.M.; Caetano, R.A.; Marquitti, F.M.D.; Aguiar, M.A.M.de; Araujo, S.B.L. Diversity patterns and speciation processes in a two-island system with continuous migration. Evolution 2022, 76, 2260–2271. [Google Scholar] [CrossRef]
- Wang, N.; Liang, B.; Wang, J.; Yeh, C.F.; Liu, Y.; Liu, Y.; Liang, W.; Yao, C.T.; Li, S.H. Incipient speciation with gene flow on a continental island: Species delimitation of the Hainan Hwamei (Leucodioptron canorum owstoni, Passeriformes, Aves). Mol. Phylogenet. Evol. 2016, 102, 62–73. [Google Scholar] [CrossRef] [PubMed]
- Natsuki, M.; Kentaro, U.; Ryutaro, M.; Etsuko, M.; Takahashi, A.; Koichiro, T.; Yoshihiko, T.; Teshima, K.M.; Hidenori, T.; Junko, K. Inferring the demographic history of Japanese cedar, Cryptomeria japonica, using amplicon sequencing. Heredity 2019, 123, 371–383. [Google Scholar] [CrossRef] [PubMed]
- Jiang, K.; Tong, X.; Ding, Y.; Wang, Z.; Miao, L.; Xiao, Y.; Huang, W.; Hu, Y.; Chen, X. Shifting roles of the East China Sea in the phylogeography of red nanmu in East Asia. J. Biogeogr. 2021, 48, 2486–2501. [Google Scholar] [CrossRef]
- Geng, Q.; Wang, Z.; Tao, J.; Kimura, M.K.; Liu, H.; Hogetsu, T.; Lian, C. Ocean currents drove genetic structure of seven dominant mangrove species along the coastlines of southern China. Front. Genet. 2021, 12, 615911. [Google Scholar] [CrossRef]
- Yang, Y.; Wang, Y.; Wu, Y.; Liu, Y.; Liu, C.; Jiang, Z.; Mu, X. Population genetics of zig-zag eel (Mastacembelus armatus) uncover gene flow between an isolated island and the mainland China. Front. Mar. Sci. 2023, 10, 1100949. [Google Scholar] [CrossRef]
- Voris, H.K. Maps of Pleistocene sea levels in Southeast Asia: Shorelines, river systems and time durations. J. Biogeogr. 2000, 27, 1153–1167. [Google Scholar] [CrossRef]
- Takeuchi, Y.; Diway, B. Long pollen dispersal prevents biparental inbreeding depression in seeds in a natural population of the tropical tree Shorea laxa. Forest Ecol. Manag. 2021, 489, 119063. [Google Scholar] [CrossRef]
- Backs, J.R.; Ashley, M.V. Evolutionary history and gene flow of an endemic island oak: Quercus Pacifica. Am. J. Bot. 2016, 103, 2115–2125. [Google Scholar] [CrossRef] [PubMed]
- Fu, G.A. New species of the genus Castanopsis from Hainan. Guihaia 2001, 21, 95–98. [Google Scholar]
- Wright, S. Variability within and among natural populations. In Evolution and the Genetics of Populations; University of Chicago Press: Chicago, IL, USA, 1984; Volume 4, pp. 79–103. ISBN 9780226910413. [Google Scholar]
- Riley, L.; McGlaughlin, M.E.; Helenurm, K. Narrow water barriers prevent multiple colonizations and limit gene flow among California Channel Island wild buckwheats (Eriogonum: Polygonaceae). Bot. J. Linn. Soc. 2016, 181, 246–268. [Google Scholar] [CrossRef]
- Ge, X.; Hung, K.; Ko, Y.; Hsu, T.; Gong, X.; Chiang, T.; Chiang, Y. Genetic divergence and biogeographical patterns in Amentotaxus argotaenia species complex. Plant Mol. Biol. Rep. 2015, 33, 264–280. [Google Scholar] [CrossRef]
- Jian, J.; Yuan, Y.; Vilatersana, R.; Li, L.; Wang, Y.; Zhang, W.; Song, Z.; Kong, H.; Peter Comes, H.; Yang, J. Phylogenomic and population genomic analyses reveal the spatial–temporal dynamics of diversification of the Nigella arvensis complex (Ranunculaceae) in the Aegean archipelago. Mol. Phylogenet. Evol. 2023, 188, 107908. [Google Scholar] [CrossRef]
- Ye, L.J.; Wang, J.; Sun, P.; Dong, S.P.; Zhang, Z.Y. The transferability of nuclear microsatellite markers in Four Castanopsis Species to Castanopsis tibetana (Fagaceae). Plant Divers. 2014, 36, 443–448. [Google Scholar] [CrossRef]
- Huang, G.M.; Hong, L.; Ye, W.H.; Shen, H.; Cao, H.L.; Xiao, W. Isolation and characterization of polymorphic microsatellite loci in Castanopsis chinensis Hance (Fagaceae). Conserv. Genet. 2009, 10, 1069–1071. [Google Scholar] [CrossRef]
- Ueno, S.; Aoki, K.; Tsumura, Y. Generation of expressed sequence tags and development of microsatellite markers for Castanopsis sieboldii var. sieboldii (Fagaceae). Ann. For. Sci. 2009, 66, 509. [Google Scholar] [CrossRef]
- Holland, M.M.; Parson, W. GeneMarker® HID: A reliable software tool for the analysis of forensic STR data: GENEMARKER® HID. J. Forensic Sci. 2011, 56, 29–35. [Google Scholar] [CrossRef] [PubMed]
- Goudet, J. FSTAT (Version 2.9.3): A Program to Estimate and Test Gene Diversities and Fixation Indices. 2001. Available online: https://www2.unil.ch/popgen/softwares/ (accessed on 6 September 2022).
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic Analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
- Clark, L.V.; Jasieniuk, M. POLYSAT: An R package for polyploid microsatellite analysis. Mol. Ecol. Resour. 2011, 11, 562–566. [Google Scholar] [CrossRef]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef]
- Earl, D.A.; vonHoldt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
- Jakobsson, M.; Rosenberg, N.A. CLUMPP: A cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 2007, 23, 1801–1806. [Google Scholar] [CrossRef]
- Rosenberg, N.A. DISTRUCT: A program for the graphical display of population structure. Mol. Ecol. Notes 2004, 4, 137–138. [Google Scholar] [CrossRef]
- Excoffier, L.; Laval, G.; Schneider, S. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol. Bioinform. Online 2007, 1, 47–50. [Google Scholar] [CrossRef] [PubMed]
- Beerli, P. Comparison of bayesian and maximum-likelihood inference of population genetic parameters. Bioinformatics 2006, 22, 341–345. [Google Scholar] [CrossRef]
- Beerli, P.; Palczewski, M. Unified framework to evaluate panmixia and migration direction among multiple sampling locations. Genetics 2010, 185, 313–326. [Google Scholar] [CrossRef]
Locus | A | HO | HE | HS | HT | FST | FIS | RST | GST |
---|---|---|---|---|---|---|---|---|---|
CC-75 | 9 | 0.571 | 0.669 | 0.608 | 0.673 | 0.119 | 0.040 | 0.214 | 0.102 |
CS20 | 20 | 0.747 | 0.875 | 0.800 | 0.872 | 0.081 | 0.077 | 0.476 | 0.087 |
CS24 | 6 | 0.354 | 0.445 | 0.365 | 0.436 | 0.165 | 0.060 | 0.224 | 0.171 |
CC39198 | 6 | 0.068 | 0.197 | 0.090 | 0.168 | 0.553 | 0.253 | 0.830 | 0.479 |
CC34976 | 19 | 0.789 | 0.884 | 0.792 | 0.883 | 0.106 | 0.011 | 0.394 | 0.109 |
CC30089 | 7 | 0.591 | 0.705 | 0.516 | 0.703 | 0.253 | −0.102 | 0.178 | 0.277 |
CC39174 | 15 | 0.630 | 0.750 | 0.664 | 0.759 | 0.129 | 0.045 | 0.130 | 0.131 |
CC3722 | 13 | 0.718 | 0.786 | 0.701 | 0.787 | 0.124 | −0.031 | 0.159 | 0.114 |
Cch15 | 8 | 0.500 | 0.560 | 0.526 | 0.589 | 0.076 | 0.041 | 0.052 | 0.113 |
CC41684 | 3 | 0.081 | 0.078 | 0.080 | 0.079 | 0.005 | −0.038 | −0.009 | −0.003 |
Ccu62F15 | 10 | 0.682 | 0.785 | 0.685 | 0.792 | 0.101 | 0.042 | 0.204 | 0.143 |
CC4950 | 17 | 0.779 | 0.858 | 0.777 | 0.857 | 0.074 | 0.027 | 0.029 | 0.100 |
CcC02022 | 16 | 0.805 | 0.872 | 0.783 | 0.875 | 0.091 | −0.008 | 0.103 | 0.111 |
CC4562 | 6 | 0.661 | 0.749 | 0.682 | 0.749 | 0.099 | 0.028 | 0.048 | 0.095 |
CC13029 | 10 | 0.769 | 0.754 | 0.693 | 0.760 | 0.069 | −0.089 | 0.099 | 0.094 |
mean | 11 | 0.583 | 0.665 | 0.584 | 0.665 | 0.136 | 0.024 | 0.209 | 0.142 |
Species | Population | Sample Size | A | AR | H | HO | HE | FIS |
---|---|---|---|---|---|---|---|---|
C. chinensis | DHS | 26 | 5.067 | 3.317 | 0.647 | 0.592 | 0.633 | 0.057 |
CWX | 23 | 5.533 | 3.205 | 0.567 | 0.538 | 0.554 | 0.026 | |
YFX | 4 | 2.867 | 2.867 | 0.556 | 0.517 | 0.481 | 0.017 | |
YSX | 16 | 4.467 | 3.108 | 0.583 | 0.537 | 0.563 | 0.068 | |
mean | 4.483 | 3.124 | 0.588 | 0.546 | 0.558 | 0.042 | ||
C. glabrifolia | DQ | 20 | 5.000 | 3.070 | 0.536 | 0.526 | 0.522 | 0.025 |
DS | 24 | 5.333 | 3.192 | 0.562 | 0.531 | 0.550 | 0.051 | |
XXS | 26 | 5.933 | 3.294 | 0.576 | 0.574 | 0.565 | −0.004 | |
XS | 4 | 3.000 | 3.000 | 0.586 | 0.633 | 0.519 | −0.032 | |
ZD | 20 | 5.333 | 3.082 | 0.524 | 0.507 | 0.511 | 0.034 | |
YL | 20 | 5.933 | 3.509 | 0.612 | 0.627 | 0.597 | −0.041 | |
BLM | 6 | 3.467 | 2.903 | 0.493 | 0.500 | 0.453 | −0.017 | |
CB | 19 | 5.667 | 3.516 | 0.622 | 0.642 | 0.606 | −0.024 | |
mean | 4.958 | 3.196 | 0.564 | 0.567 | 0.540 | −0.001 | ||
C. qiongbeiensis | CF | 24 | 6.667 | 3.550 | 0.622 | 0.644 | 0.610 | −0.038 |
BC | 18 | 5.600 | 3.503 | 0.625 | 0.611 | 0.607 | 0.006 | |
BCS | 25 | 6.333 | 3.525 | 0.630 | 0.617 | 0.617 | 0.006 | |
LFT | 16 | 4.867 | 3.050 | 0.555 | 0.617 | 0.539 | −0.12 | |
BT | 17 | 5.267 | 3.376 | 0.622 | 0.635 | 0.604 | −0.021 | |
mean | 5.747 | 3.401 | 0.611 | 0.625 | 0.595 | −0.033 |
Source of Variation | Sum of Squares | Variance Components | Percentage Variation | Fixation Indices (p < 0.000) |
---|---|---|---|---|
among species | 191.068 | 0.391 | 7.610 | FCT: 0.076 |
among populations within species | 225.866 | 0.335 | 6.510 | FSC: 0.071 |
within populations | 2641.659 | 4.410 | 85.880 | FST: 0.141 |
Species | Population Code | Population Location | Sample Size | Longitude (°E) | Latitude (°N) |
---|---|---|---|---|---|
C. chinensis | DHS | Dinghushan | 26 | 112°33′8.78″ | 23°9′51.63″ |
CWX | Cangwuxian | 23 | 111°31′58.72″ | 23°46′10.14″ | |
YFX | Yongfuxian | 4 | 110°9′20.4″ | 24°55′3.47″ | |
YSX | Yangshuoxian | 16 | 110°17′37.91″ | 24°49′45.12″ | |
C. glabrifolia | XXS | Xiaoxishan | 26 | 110°56′30.90″ | 19°49′52.81″ |
XS | Xinshi | 4 | 110°57′48.24″ | 19°48′10.94″ | |
CB | Changbi | 19 | 110°56′23.54″ | 19°47′32.68″ | |
YL | Yalang | 20 | 110°57′58.68″ | 19°47′22.20″ | |
BLM | Baolongmei | 6 | 110°57′50.43″ | 19°46′51.98″ | |
DS | Dashan | 24 | 110°57′47.37″ | 19°46′38.02″ | |
DQ | Dongqun | 20 | 110°57′40.40″ | 19°45′45.84″ | |
ZD | Zhudui | 20 | 110°56′57.93″ | 19°44′39.71″ | |
C. qiongbeiensis | LFT | Longfeitou | 16 | 110°50′59.25″ | 19°47′53.27″ |
CF | Changfa | 24 | 110°52′28.12″ | 19°49′30.59″ | |
BCS | Baocaishan | 25 | 110°52′55.52″ | 19°48′34.70″ | |
BC | Baicai | 18 | 110°53′36.32″ | 19°48′15.19″ | |
BT | Bangtou | 17 | 110°53′5.85″ | 19°45′18.08″ |
Locus | Repetitive Unit | Primer Sequence (5→3′) | Fragment Length | Reference |
---|---|---|---|---|
CC-75 | (GA)6 | F: <TAMRA>AACACCAGAGCTTGAGAGCG | 110–138 | treegenesdb.org |
R: CCTTGACATTGTCGATGGTG | ||||
CC-39198 | (AG)11 | F: <6-FAM>GGTTGTTGTCGTTGTCGTTG | 205–215 | treegenesdb.org |
R: TCTGTCTCCGTTCACCCTCT | ||||
CC-34976 | (GA)7 | F:<ROX>GTGGTGGATTTTGGGTATGG | 253–291 | treegenesdb.org |
R:TCCCAAACCTTGTCACCTTC | ||||
CC-30089 | (TGT)6 | F: <HEX>ACTTGGTTCTCCGAAGCTCA | 115–133 | treegenesdb.org |
R:ACCGCTACTTCTTCAGCCCT | ||||
CC-39174 | (GA)6 | F:<6-FAM>GGAGGAGGGATCATGTGAGA | 219–249 | treegenesdb.org |
R:TCCCAGAAATCCAAATCCCT | ||||
CC-3722 | (AG)10 | F:<TAMRA>AGAGATGGGTTGGGAAGGTT | 130–160 | treegenesdb.org |
R:GGCCTCTCTGGTTTGTGTGT | ||||
CC-41684 | (ACC)6 | F: <ROX>ATCCTCCAAGCAATCCTCCT | 288–294 | treegenesdb.org |
R: TCAAGTGTGTGCGAGTGACA | ||||
CC-4950 | (GT)5 | F:<6-FAM>GCGATACCTCCAGACATGGT | 246–284 | treegenesdb.org |
R:CAGCTTGAAGAAATCTGGGC | ||||
CC-4562 | (TCG)7 | F:<TAMRA>CGTATAGGGTGGAAACGGAA | 144–159 | treegenesdb.org |
R:GGACAAGCAAATCACGGAAT | ||||
CC-13029 | (TC)8 | F:<HEX>CACACCTCGTTGTTTGTGCT | 125–143 | treegenesdb.org |
R:CGAGGAGAAGATAGGAAAAGC | ||||
CS20 | (AG)13 | F:<ROX>AATTTCACATCCCAACTCTGCGA | 246–290 | [46] |
R:TGGAGGGAGTAGTGGACGATCAA | ||||
CS24 | (CAA)6 | F:<TAMRA>ATCACCGGAGAAAACCCTAACGA | 118–133 | [46] |
R:AATGTTTCGGACCAATTCGAGGT | ||||
Cch15 | (CT)11 | F:<6-FAM>CCCATAACGTCTGACCCCTA | 229–251 | [47] |
R:CCAAAAGGGCTTCATAACCA | ||||
Ccu62F15 | (TC)17 | F:<TAMRA>TTGCATCCTCAGCTTTCTCA | 132–156 | [47] |
R: GCCCTCTCCTAACACCAATAATAC | ||||
CcC02022 | (TC)12 | F:<ROX>TTCACTTGTTTTTCCCGACCAGA | 342–372 | [48] |
R:CCGCTAAAATGGTGTTGCAGAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, Y.; Yang, K.; Wen, X.; Sun, Y. Genetic Differentiation and Relationship among Castanopsis chinensis, C. qiongbeiensis, and C. glabrifolia (Fagaceae) as Revealed by Nuclear SSR Markers. Plants 2024, 13, 1486. https://doi.org/10.3390/plants13111486
Wu Y, Yang K, Wen X, Sun Y. Genetic Differentiation and Relationship among Castanopsis chinensis, C. qiongbeiensis, and C. glabrifolia (Fagaceae) as Revealed by Nuclear SSR Markers. Plants. 2024; 13(11):1486. https://doi.org/10.3390/plants13111486
Chicago/Turabian StyleWu, Yang, Kai Yang, Xiangying Wen, and Ye Sun. 2024. "Genetic Differentiation and Relationship among Castanopsis chinensis, C. qiongbeiensis, and C. glabrifolia (Fagaceae) as Revealed by Nuclear SSR Markers" Plants 13, no. 11: 1486. https://doi.org/10.3390/plants13111486
APA StyleWu, Y., Yang, K., Wen, X., & Sun, Y. (2024). Genetic Differentiation and Relationship among Castanopsis chinensis, C. qiongbeiensis, and C. glabrifolia (Fagaceae) as Revealed by Nuclear SSR Markers. Plants, 13(11), 1486. https://doi.org/10.3390/plants13111486