Next Article in Journal
Phenotype, Biomass, Carbon and Nitrogen Assimilation, and Antioxidant Response of Rapeseed under Salt Stress
Next Article in Special Issue
Updated Taxonomy of Iris scariosa (Iridaceae) Inferred from Morphological and Chloroplast DNA Sequence Data with Remarks on Classification of Iris subg. Iris
Previous Article in Journal
Comparative Transcriptome Analysis Revealed Candidate Gene Modules Involved in Salt Stress Response in Sweet Basil and Overexpression of ObWRKY16 and ObPAL2 Enhanced Salt Tolerance of Transgenic Arabidopsis
Previous Article in Special Issue
A Multiplex PCR System of Novel Microsatellite Loci for Population Genetic Application in Walnuts
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Differentiation and Relationship among Castanopsis chinensis, C. qiongbeiensis, and C. glabrifolia (Fagaceae) as Revealed by Nuclear SSR Markers

1
Guangdong Key Laboratory for Innovative Development and Utilization of Forest Plant Germplasm, College of Forestry and Landscape Architecture, South China Agricultural University, Guangzhou 510642, China
2
South China Botanical Garden, Chinese Academy of Sciences, Guangzhou 510650, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Plants 2024, 13(11), 1486; https://doi.org/10.3390/plants13111486
Submission received: 19 April 2024 / Revised: 17 May 2024 / Accepted: 22 May 2024 / Published: 28 May 2024

Abstract

Castanopsis chinensis (Spreng.) Hance is widespread in the subtropical forests of China. Castanopsis qiongbeiensis G.A. Fu and Castanopsis glabrifolia J. Q. Li & Li Chen are limited to the coastal beaches of Wenchang county in the northeast of Hainan Island, and have similar morphological characteristics to C. chinensis. It is supposed that C. qiongbeiensis and C. glabrifolia are closely related to C. chinensis. In the present study, the genetic differentiation, gene flow, and genetic relationship of C. chinensis, C. qiongbeiensis, and C. glabrifolia were investigated by using 15 nuclear microsatellite markers; a total of 308 individuals from 17 populations were sampled in the three species. The allelic variation of nuclear microsatellites revealed moderate but significant genetic differentiation (FCT = 0.076) among C. chinensis, C. qiongbeiensis, and C. glabrifolia, and genetic differentiation between C. chinensis and C. glabrifolia was larger than that between C. chinensis and C. qiongbeiensis. Demographic simulations revealed unidirectional gene flow from C. chinensis to C. glabrifolia and C. qiongbeiensis, which highlight dispersal from mainland to island. The isolation effect of Qiongzhou Strait increased the genetic differentiation of species on both sides of the strait; however, the differentiation was diminished by gene flow that occurred during the historical period when Hainan Island was connected to mainland China. Our results supported the argument that C. glabrifolia should be considered an independent species and argued that C. qiongbeiensis should be regarded as an incipient species and independent conservation unit.

1. Introduction

Genetic diversity and population structure are important components of biodiversity conservation, which underlie the evolutionary potential of species and are crucial for the survival and environmental adaptability of populations [1]. Understanding genetic structure and population differentiation has been a key goal of conservation genetics, which is important for efficiently conserving and utilizing genetic diversity of germplasm resources. Geographical events and climate changes play a critical role in determining the historical distribution of species and reshaping the spatio-temporal pattern of population genetic variation [2,3,4], which could be further explored by investigating the genetic differentiation and relationship between the continent and island species.
Hainan Island is a continental island in southern China. It has tropical monsoon climate characteristics due to its geographic location [5]. The complex topography and favorable hydrothermal conditions have fundamentally shaped the abundant floristic diversity, which has always been a hot topic in ecological and evolutionary biology research [6,7]. Around the Eocene, Hainan Island slowly split from the adjacent Asian mainland, eventually becoming separated from the mainland by the formation of the Qiongzhou Strait [8]. Many studies have suggested that the fluctuation of sea level due to the Quaternary climatic changes led to periodic formation and inundation of a mainland bridge, which caused Hainan Island to be connected to the mainland multiple times [9,10] and enabled exchange of fauna and flora between the mainland and islands. It is argued that some species on Hainan Island arrived via dispersal or originated via dispersal-isolation-divergence during the Miocene and the Pleistocene [6,8,11]. The geographical isolation and subsequent multiple connections between the mainland and Hainan Island had a huge impact on the biota of Hainan Island, thus profoundly affecting the genetic differentiation of populations between mainland and Hainan Island. This provides a great opportunity to explore species diversification and phylogeographical pattern between island and mainland [12].
Castanopsis is the third largest genus of Fagaceae, with about 120 species, that are important timber trees and the main component of subtropical evergreen broad-leaved forests and tropical monsoon rainforests [13,14,15,16]. The nuts of most Castanopsis species are edible and contain copious amounts of water-soluble tannin; as such, they have important industrial value. Castanopsis chinensis (Spreng.) Hance is widespread in Guangdong, Guangxi, Guizhou, and Yunnan province of China, and shows high morphological variation [17,18]. Castanopsis glabrifolia J. Q. Li & Li Chen and Castanopsis qiongbeiensis G. A. Fu are limited to the coastal beaches of Wenchang county in the northeast of Hainan Island. Despite similar morphological characteristics among the three species, both the leaf size and the diameter of the cupules of C. glabrifolia and C. qiongbeiensis are generally smaller than that of C. chinensis. C. glabrifolia was published first as a geographical variety of C. chinensis, but it was treated as an independent species later [13,19]. C. qiongbeiensis was published first as an independent species of Hainan Island; however, it was later believed to belong to C. chinensis [20,21,22]. These taxonomic controversies are mainly due to a lack of comprehensive understanding of morphological variation in C. chinensis. Thus, it is supposed that the relationship among C. chinensis, C. glabrifolia, and C. qiongbeiensis could be clarified based on investigation of their genetic differentiation.
In recent years, it has become common to use DNA variation data to study population structure and genetic differentiation. Simple sequence repeat (SSR) is a commonly used molecular marker and has been widely used to investigate genetic diversity, for example in assessing the population structure and conservation units of Castanopsis sclerophylla [23] and species delimitation between Castanopsis hainanensis and Castanopsis wenchangensis [24]. Thus far, the genetic differentiation and relationship among C. chinensis, C. glabrifolia, and C. qiongbeiensis have not been evaluated. In this study, the genetic differentiation and gene flow among C. chinensis, C. glabrifolia, and C. qiongbeiensis were investigated by using nuclear SSRs and sampling roughly across the species’ native range in order to obtain a comprehensive understanding of their genetic relationship and the diversification process.

2. Results

Seven out of twenty-two loci significantly deviated from HWE (p < 0.01) and were excluded from further analysis. The results of genetic diversity analysis of 15 nSSRs are summarized in Table 1. The number of alleles observed (A) changed from 3 to 20. The observed heterozygosity (HO) and expected heterozygosity (HE) ranged from 0.068 to 0.805 and 0.078 to 0.884, with mean value of 0.583 and 0.665, respectively. The within population gene diversity (HS) and total gene diversity (HT) varied from 0.080 to 0.800 and 0.079 to 0.883. The overall level of genetic differentiation among populations was moderate; the average values of FST, RST, and GST was 0.136, 0.209, and 0.142, respectively. At the population level, the number of alleles observed (A) and allele richness (AR) ranged from 2.867 to 6.667 and 2.867 to 3.550 (Table 2). The gene diversity (H) was from 0.493 to 0.647. The observed heterozygosity (HO) and expected heterozygosity (HE) varied from 0.500 to 0.644 and 0.453 to 0633. The level of genetic diversity was highest in the C. qiongbeiensis (A = 5.747, AR = 3.401, H = 0.611, HO = 0.625, HE = 0.595). The level of genetic diversity in C. chinensis (A = 4.483, AR = 3.124, H = 0.588, HO = 0.546, HE = 0.558) was similar to that in C. glabrifolia (A = 4.958, AR = 3.196, H = 0.564, HO = 0.567, HE = 0.540).
The result of PCoA analysis is shown in Figure 1. The first and second principal coordinates of PCoA plot accounted for 8.41% and 6.71% of the total variation, respectively. Although there were some degree of overlap, C. chinensis, C. glabrifolia, and C. qiongbeiensis were discriminated generally along the first coordinate axis, and C. glabrifolia separated from C. qiongbeiensis along the second coordinate axis. In addition, population DHS of C. chinensis differentiated from the other three populations along the second coordinate axis.
The optimal K value obtained in the genetic structure analysis was 4. All populations of C. glabrifolia and C. qiongbeiensis made up one gene pool, respectively (Figure 2). C. chinensis was divided into two clusters: population DHS alone constituted one group and the other three populations (CWX, YFX, YSX) composed another. Genetic admixture was shown in some populations, particularly in CB, indicating high level of gene flow between C. glabrifolia and C. qiongbeiensis. A suboptimal K = 3 was selected in the genetic structure analysis. In this situation, three populations of C. chinensis (CWX, YFX, YSX) were clustered together with C. qiongbeiensis. The AMOVA analysis showed that most of the genetic variation was attributed to differences within population (Table 3). There was significant genetic differentiation among C. glabrifolia, C. qiongbeiensis, and C. chinensis (FCT = 0.076).
Migration model 2 obtained the highest support. In this scenario (Figure 3), appreciable unidirectional gene flow was detected from C. chinensis to C. glabrifolia (Nm = 0.6449) and from C. chinensis to C. qiongbeiensis (Nm = 0.6443), which suggested plant dispersal from the mainland to Hainan Island. Asymmetric gene flow happened between C. glabrifolia and C. qiongbeiensis. The level of gene flow from C. glabrifolia to C. qiongbeiensis was 1.1983, while the gene flow in the opposite direction was 0.8507. The effective population size was large in C. glabrifolia (Θ = 1.2010) and C. qiongbeiensis (Θ = 0.9159), but small in C. chinensis (Θ = 0.5404).

3. Discussion

The novelty of the present work is to evaluate genetic diversity and genetic differentiation among three Castanopsis species on Hainan Island and mainland China based on a same set of SSR markers. Genetic diversity has a significant impact on the survival and adaptation potential of species. The genetic diversity of plant populations on islands is usually lower than that on continents [25]. Limited gene flow, natural selection, and possible historical bottleneck effects may lead to a lower levels of genetic diversity in island populations [26,27]. However, our study revealed that C. glabrifolia on Hainan Island possessed higher genetic diversity than C. chinensis in mainland China (Table 2). This is mainly because Hainan Island is a continental island and C. glabrifolia might have been on Hainan Island before separating from the mainland. The result is consistent with other studies, where island origin and age have significant effects on the genetic diversity of island plant species [26,28]. Some plant species even originated in Hainan Island and then expanded their range to mainland China, such as Camellia drupifera [29]. Of course, the genetic diversity of C. chinensis revealed in this study may be influenced by the limited number of molecular markers and sampling. In other studies, this species has been revealed to harbor rich genetic diversity [30,31]. Our results also revealed frequent gene exchange between C. glabrifolia and C. qiongbeiensis, which might increase and maintain their genetic diversity. High level of the genetic diversity of C. glabrifolia would facilitate it to adapt the special island environment.
Geographical isolation and dispersal are important factors affecting plant genetic diversity and population structure. Inferring the relative importance of geographic isolation and gene flow in population differentiation can help understand the evolutionary history of island biodiversity [32]. The discontinuous distribution of plants caused by geographical isolation would restrict gene exchange among populations, increase genetic differentiation among populations, and lead to local adaptation [28,33,34,35]. The Qiongzhou Strait is a natural geographical barrier for plant populations between Hainan Island and mainland China. The role of strait isolation in population and species differentiation has been shown in previous studies [9,36]. Historical changes in sea level caused by climate fluctuation have repeatedly led to the connection of Hainan Island to mainland China [37,38], which provided opportunities for gene exchange between C. chinensis and C. glabrifolia as well as between C. chinensis and C. qiongbeiensis, since these three species have close genetic relationships.
The best demographic model showed unidirectional gene flow from C. chinensis to C. glabrifolia as well as from C. chinensis to C. qiongbeiensis (Figure 3), suggesting pollen- or seed-mediated dispersal from mainland to island. Long distance pollen-mediated gene flow is common in plants [39]. The flowering time of C. chinensis is from May to July; however, pollens from C. chinensis seem unlikely to have spread from mainland China to Hainan Island due to prevailing southeast monsoon during this period [14]. Therefore, long distance seed dispersal seems more likely to have contributed to the gene flow from mainland China to Hainan Island, just like the spread of oak acorns [40]. In contrast, the gene flow between C. glabrifolia and C. qiongbeiensis is bidirectional and more frequent, mainly because they occur sympatrically on Hainan Island. These results highlighted the isolation effect of the Qiongzhou Strait, which has played an important role in promoting genetic differentiation among the three Castanopsis species between Hainan Island and mainland China. Similar results were found in a recent study, which suggests that species of the Persea group (Lauraceae) on Hainan Island originated via a dispersal-isolation-divergence pattern [8].
Researchers have held different views about the taxonomy and genetic relationship of C. chinensis, C. glabrifolia, and C. qiongbeiensis. C. glabrifolia was originally published as a variety of C. chinensis (C. chinensis var. hainanica) [13]. However, Chen [19] believed that there were significant morphological differences between C. chinensis var. hainanica and C. chinensis, thus upgrading it from a variety (C. chinensis var. hainanica) to an independent species (C. glabrifolia). In this study, genetic structure analysis clearly showed that C. glabrifolia and C. chinensis were independent gene pools, thus supporting Chen’s view that C. glabrifolia is an independent species. C. qiongbeiensis was originally published as an independent species [41], but it was later considered as the same species of C. chinensis [22]. In this study, genetic structure analysis showed that C. qiongbeiensis was also an independent gene pool. However, it shared a gene pool with the Guangxi populations (CWX, YFX and YSX) of C. chinensis when ancestral group number (K) was defined as 3 (Figure 2), which suggested that C. qiongbeiensis had closer genetic relationship to C. chinensis, thus should be regarded as an incipient species and independent conservation unit.
C. chinensis, C. glabrifolia, and C. qiongbeiensis may have initially lived on a continuous landmass and had only minor differentiation. During the Pleistocene, tectonic events and climate changes made the Qiongzhou Strait a geographic barrier between mainland China and Hainan Island [8]. The isolation effect of the Qiongzhou Strait increased the genetic differentiation of species on both sides of the strait. Our results showed that there was significant genetic differentiation among C. chinensis, C. glabrifolia, and C. qiongbeiensis (Table 3, FCT = 0.076, p < 0.000). However, according to Wright’s criteria [42], the differentiation index indicated a moderate degree of differentiation when it was between 0.05 and 0.15. The differentiation between C. chinensis in mainland China and C. glabrifolia and C. qiongbeiensis on Hainan Island may be diminished by gene flow that occurred during the historical period when Hainan Island was connected to mainland China. The repeated emergence of the land bridge between mainland China and Hainan Island provided opportunities for the plant to disperse from mainland China to Hainan Island (Nm = 0.6443–0.6449). The result was consistent with the study of Quercus pacifica [41] and Eriogonum arborescens [43] in California Channel Islands, where historical gene flow attenuated the population differentiation caused by strait isolation. On the contrary, the genetic differentiation would be high if the historical gene flow was very low (Nm = 0.000–0.004), for example, Amentotaxus argotaenia on Taiwan island [44] and Nigella species in eastern Aegean [45].

4. Materials and Methods

We collected 69 samples from 4 natural populations of C. chinensis in Guangdong and Guangxi Provinces, 239 samples from 8 populations of C. glabrifolia, and 5 populations of C. qiongbeiensis in Hainan Island (Figure 4, Table 4). Fresh leaves were collected in the field and immediately dried with silica gel. The sampled trees were kept at least 20 m apart to avoid collecting closely related individuals due to seed reproduction.
Genomic DNA was extracted from the silica gel-dried leaves using the Tiangen Plant Genomic DNA Extraction Kit (DP320) according to the instructions of the manufacturer. A total of 15 primer pairs of nuclear SSRs (Table 5) were screened from those originally reported in Castanopsis and Castanea species [46,47,48]. Quadruple fluorescent polymerase chain reaction (PCR) was amplified using the Type-it microsatellite PCR kit (QIAGEN, Hilden, Germany). PCR was performed in a mixture including 20 ng of genomic DNA, 1× PCR Master Mix, 1× Q -Solution, and 10 μM of each primer. The forward primer was labeled with different fluorescent dyes (TAMRA, HEX, 6-FAM, and ROX). The PCR program was set as follows: 95 °C for 5 min, followed by 28 cycles of 95 °C for 30 s, 57 °C for 90 s, and 72 °C for 30 s, and a final extension at 60 °C for 30 min. The PCR products were separated by capillary electrophoresis with the ABI-3730XL fluorescence sequencer (Applied Biosystems, Foster City, CA, USA), using LIZ500 as the internal standard. Alleles were scored using Genemarker2.2.0 [49].
Deviation from Hardy–Weinberg equilibrium (HWE) was tested with 1000 permutations using FSTAT v 2.9.3 [50]. SSRs that deviated from HWE were excluded from further analysis. FSTAT v 2.9.3 [50] and GeneALEx v 6.5 [51] were used to analyze genetic diversity parameters including number of alleles observed (A), allele richness (AR), gene diversity (H), expected heterozygosity (HE), observed heterozygosity (HO), within population gene diversity (HS), total gene diversity (HT), genetic differentiation among populations under an infinite allele model (FST), proportion of the total genetic diversity attributable to population differentiation (GST), genetic differentiation among populations under a stepwise mutation model (RST), and inbreeding coefficient (FIS).
R package “polysat” [52] was used to conduct Principal Coordinates Analysis (PCoA). Structure v 2.3.4 [53] was used to perform population genetic structure analysis. The K value was set from 1 to 17, and each was independently repeated 20 times. The length of the burn-in period was set to 1,000,000, and MCMC replications after the burn-in were set to 1,000,000. The optimal K value was selected according to the Evanno method using Structure Harvester [54]. The coefficient for cluster membership of each individual was averaged across the 20 independent runs using Clumpp v 1.1.2 [55], and the results were graphically displayed using Distruct v 1.1 [56]. Analysis of molecular variance (AMOVA) was performed using Arlequin v 3.5 [57] to determine the proportion of genetic variation partitioned within populations, among populations, and among species.
Migrate-n v 4.4 [58] was used to estimate the effective population size (Θ) and migration rate (M). Formula Nm = Θ × M/x was used to calculate gene flow (Nm), where x is the fixed coefficient (x = 1 for mitochondrial genes, x = 4 for nuclear genes). Four migration models were defined by considering the possible gene flow among species (Figure 5), including (1) bidirectional gene flow among three species, (2) unidirectional gene flow from the mainland to Hainan Island and bidirectional gene flow within Hainan Island, (3) unidirectional gene flow from Hainan Island to the mainland and bidirectional gene flow within Hainan Island, and (4) bidirectional gene flow within Hainan Island but no gene flow between the mainland and Hainan Island. Migrate-n was implemented with the Bayesian inference strategy. Three independent runs were performed for each model using four parallel chains with static heating (temperature 1.0 1.5 3.0 1,000,000.0). The number of recorded steps in chain and burn-in was set to 10,000, and 100,000, respectively. The best model was selected by comparing the marginal likelihoods using thermodynamic integration in Migrate-n [59].

5. Conclusions

In this study, we examined the genetic differentiation and relationships among C. chinensis, C. qiongbeiensis, and C. glabrifolia. C. qiongbeiensis and C. glabrifolia were endemic on Hainan Island and had similar morphological characteristics to C. chinensis in mainland China. We revealed moderate but significant genetic differentiation among C. chinensis, C. glabrifolia, and C. qiongbeiensis; genetic differentiation between C. chinensis and C. glabrifolia was larger than that between C. chinensis and C. qiongbeiensis. Our results supported the argument that C. glabrifolia should be considered an independent species and argued that C. qiongbeiensis should be regarded as an incipient species and independent conservation unit.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants13111486/s1.

Author Contributions

Conceptualization, X.W. and Y.S.; methodology, Y.W., K.Y. and Y.S.; software, Y.W., K.Y. and Y.S.; validation, Y.W., K.Y. and Y.S.; formal analysis, Y.W., K.Y. and Y.S.; investigation, K.Y. and Y.S.; resources, K.Y. and Y.S.; data curation, Y.W. and K.Y.; writing—original draft preparation, Y.W.; writing—review and editing, Y.W., K.Y., X.W. and Y.S.; visualization, Y.W. and Y.S.; supervision, X.W. and Y.S.; project administration, Y.S.; funding acquisition, Y.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Special Fund for Talents of South China Agricultural University.

Data Availability Statement

The data presented in this study are available as Supplementary Materials.

Acknowledgments

We would like to thank Yi Feng for help in sample collections.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Tong, H.; Deng, H.; Han, Z. Genetic differentiation and genetic structure of mixed-ploidy Camellia hainanica populations. PeerJ 2023, 11, e14756. [Google Scholar] [CrossRef] [Scilit]
  2. Wei, X.Y.; Wang, T.; Zhou, J.; Sun, W.Y.; Jin, D.M.; Xiang, J.Y.; Shao, J.W.; Yan, Y.H. Simplified genomic data revealing the decline of Aleuritopteris grevilleoides population accompanied by the uplift of dry-hot valley in Yunnan, China. Plants 2023, 12, 1579. [Google Scholar] [CrossRef] [Scilit]
  3. Antonelli, A.; Kissling, W.D.; Flantua, S.G.A.; Bermúdez, M.A.; Mulch, A.; Muellner-Riehl, A.N.; Kreft, H.; Linder, H.P.; Badgley, C.; Fjeldså, J.; et al. Geological and climatic influences on mountain biodiversity. Nature Geosci. 2018, 11, 718–725. [Google Scholar] [CrossRef] [Scilit]
  4. Sanín, M.J.; Mejía-Franco, F.G.; Paris, M.; Valencia-Montoya, W.A.; Salamin, N.; Kessler, M.; Olivares, I.; Jaramillo, J.S.; Cardona, A. Geogenomics of montane palms points to Miocene–Pliocene Andean segmentation related to strike-slip tectonics. J. Biogeogr. 2022, 49, 1711–1725. [Google Scholar] [CrossRef] [Scilit]
  5. Chen, Y.; Ren, L.; Lou, Y.; Tang, L.; Yang, J.; Su, L. Effects of climate change on climate suitability of green orange planting in Hainan Island, China. Agriculture 2022, 12, 349. [Google Scholar] [CrossRef] [Scilit]
  6. Wu, L.; Xu, H.; Jian, S.; Gong, X.; Feng, X. Geographic factors and climatic fluctuation drive the genetic structure and demographic history of Cycas taiwaniana (Cycadaceae), an endemic endangered species to Hainan Island in China. Ecol. Evol. 2022, 12, e9508. [Google Scholar] [CrossRef] [Scilit]
  7. Zhu, Z.; Harris, A.; Nizamani, M.M.; Thornhill, A.H.; Scherson, R.A.; Wang, H. Spatial phylogenetics of the native woody plant species in Hainan, China. Ecol. Evol. 2021, 11, 2100–2109. [Google Scholar] [CrossRef] [Scilit]
  8. Huo, X.; Yang, Z.; Xie, Y.; Yang, Y. Tempo and mode of floristic exchanges between Hainan Island and mainland Asia: A case study of the Persea group (Lauraceae). Forests 2022, 13, 1722. [Google Scholar] [CrossRef] [Scilit]
  9. Liu, Y.Y.; Jin, W.T.; Wei, X.X.; Wang, X.Q. Phylotranscriptomics reveals the evolutionary history of subtropical East Asian white pines: Further insights into gymnosperm diversification. Mol. Phylogenet. Evol. 2022, 168, 107403. [Google Scholar] [CrossRef] [Scilit]
  10. Liu, Y.; Pham, H.T.; He, Z.; Wei, C. Phylogeography of the cicada Platypleura hilpa in subtropical and tropical East Asia based on mitochondrial and nuclear genes and microsatellite markers. Int. J. Biol. Macromol. 2020, 151, 529–544. [Google Scholar] [CrossRef] [Scilit]
  11. Jiang, X.L.; Gardner, E.M.; Meng, H.H.; Deng, M.; Xu, G.B. Land bridges in the Pleistocene contributed to flora assembly on the continental islands of South China: Insights from the evolutionary history of Quercus championii. Mol. Phylogenet. Evol. 2019, 132, 36–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Pinheiro, F.; Veiga, G.S.; Chaves, C.J.N.; Da Costa Cacossi, T.; Da Silva, C.P. Reproductive barriers and genetic differentiation between continental and island populations of Epidendrum fulgens (Orchidaceae). Plant Syst. Evol. 2021, 307, 36. [Google Scholar] [CrossRef] [Scilit]
  13. Chen, X.M.; Yu, B.P. A review of the genus of Castanopsis in Guangdong and Hainan. J. South. China Agric. Univ. 1991, 12, 87–95. [Google Scholar]
  14. Huang, C.J.; Chang, Y.T.; Bruce, B. Fagaceae. In Flora of China; Wu, Z.Y., Raven, P.H., Hong, D.Y., Eds.; Science Press and Missouri Botanical Garden Press: Beijing, China, 1999; pp. 315–333. ISBN 7030075730. [Google Scholar]
  15. Wang, Z.; Wu, X.; Sun, B.; Yin, S.; Quan, C.; Shi, G. First fossil record of Castanopsis (Fagaceae) from the middle Miocene Fotan Group of Fujian, southeastern China. Rev. Palaeobot. Palyno. 2022, 305, 104729. [Google Scholar] [CrossRef] [Scilit]
  16. Ashton, P.; Zhu, H. The tropical-subtropical evergreen forest transition in East Asia: An exploration. Plant Diversity 2020, 42, 255–280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Wang, Y.F.; Lin, P.; Huang, Y.L.; He, R.J.; Yang, B.Y.; Liu, Z.B. Isolation of two new phenolic glycosides from Castanopsis chinensis Hance by combined multistep CC and HSCCC separation and evaluation of their antioxidant activity. Molecules 2023, 28, 3331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Guo, X.; Huang, J.G.; Li, J.; Liang, H.; Yu, B.; Ma, Q.; Jiang, S.; Lu, X.; Fu, S.; Ye, Q.; et al. Nitrogen addition to the canopy of Castanopsis chinensis (Sprengel) Hance promoted xylem formation in a subtropical forest in China. Ann. Forest Sci. 2020, 77, 56. [Google Scholar] [CrossRef] [Scilit]
  19. Chen, L.; Zhang, Z.G.; Hu, Y.; Li, X.W.; Li, J.Q. A new species and one new name in Castanopsis (Fagaceae) from Hainan, China. Novo 2011, 21, 317–321. [Google Scholar] [CrossRef] [Scilit]
  20. Zhijian, Y.; Chunlei, X.; Hua, P. Validation of four names of Castanopsis (Fagaceae) from Hainan, southern China. Bangl. J. Plant Taxon. 1970, 18, 77–79. [Google Scholar] [CrossRef] [Scilit]
  21. Fu, D.D.; Wang, J.; Liu, Y.F.; Huang, H.W. Isolation of Microsatellite Markers for Castanopsis fargesii (Fagaceae). J. Trop. Subtrop. Bot. 2010, 18, 541–554. [Google Scholar] [CrossRef]
  22. Chen, L.; Li, X.W.; Li, J.Q. Taxonomic notes on Castanopsis (Fagaceae, Castaneoideae) from China. Phytotaxa 2013, 146, 50–60. [Google Scholar] [CrossRef] [Scilit]
  23. Chen, S.; Chen, R.; Zeng, X.; Chen, X.; Qin, X.; Zhang, Z.; Sun, Y. Genetic diversity, population structure, and conservation units of Castanopsis sclerophylla (Fagaceae). Forests 2022, 13, 1239. [Google Scholar] [CrossRef] [Scilit]
  24. Chen, X.; Feng, Y.; Chen, S.; Yang, K.; Wen, X.; Sun, Y. Species delimitation and genetic relationship of Castanopsis hainanensis and Castanopsis wenchangensis (Fagaceae). Plants 2023, 12, 3544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Duryea, M.C.; Zamudio, K.R.; Brasileiro, C.A. Vicariance and marine migration in continental island populations of a frog endemic to the Atlantic Coastal forest. Heredity 2015, 115, 225–234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Setsuko, S.; Sugai, K.; Tamaki, I.; Takayama, K.; Kato, H. Contrasting genetic diversity between Planchonella obovata sensu lato (Sapotaceae) on old continental and young oceanic Island populations in Japan. PLoS ONE 2022, 17, e0273871. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Götz, J.; Rajora, O.P.; Gailing, O. Genetic structure of natural northern range-margin mainland, peninsular, and island populations of northern red oak (Quercus rubra L.). Front. Ecol. Evol. 2022, 10, 907414. [Google Scholar] [CrossRef] [Scilit]
  28. Cao, Y.N.; Zhu, S.S.; Chen, J.; Comes, H.P.; Wang, I.J.; Chen, L.Y.; Sakaguchi, S.; Ying-Xiong, Q. Genomic insights into historical population dynamics, local adaptation, and climate change vulnerability of the East Asian Tertiary relict Euptelea (Eupteleaceae). Evol. Appl. 2020, 13, 2038–2055. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Qi, H.; Sun, X.; Wang, C.; Chen, X.; Yan, W.; Chen, J.; Xia, T.; Ye, H.; Yu, J.; Dai, J.; et al. Geographic isolation causes low genetic diversity and significant pedigree differentiation in populations of Camellia drupifera, a woody oil plant native to China. Ind. Crop. Prod. 2023, 192, 116026. [Google Scholar] [CrossRef] [Scilit]
  30. Wang, Z.; Lian, J.; Huang, G.; Ye, W.; Cao, H.; Wang, Z. Genetic groups in the common plant species Castanopsis chinensis and their associations with topographic habitats. Oikos 2012, 121, 2044–2051. [Google Scholar] [CrossRef] [Scilit]
  31. Wang, Z.F.; Lian, J.Y.; Ye, W.H.; Cao, H.L.; Wang, Z.M. The spatial genetic pattern of Castanopsis chinensis in a large forest plot with complex topography. Forest Ecol. Manag. 2014, 318, 318–325. [Google Scholar] [CrossRef] [Scilit]
  32. Princepe, D.; Czarnobai, S.; Pradella, T.M.; Caetano, R.A.; Marquitti, F.M.D.; Aguiar, M.A.M.de; Araujo, S.B.L. Diversity patterns and speciation processes in a two-island system with continuous migration. Evolution 2022, 76, 2260–2271. [Google Scholar] [CrossRef] [Scilit]
  33. Wang, N.; Liang, B.; Wang, J.; Yeh, C.F.; Liu, Y.; Liu, Y.; Liang, W.; Yao, C.T.; Li, S.H. Incipient speciation with gene flow on a continental island: Species delimitation of the Hainan Hwamei (Leucodioptron canorum owstoni, Passeriformes, Aves). Mol. Phylogenet. Evol. 2016, 102, 62–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Natsuki, M.; Kentaro, U.; Ryutaro, M.; Etsuko, M.; Takahashi, A.; Koichiro, T.; Yoshihiko, T.; Teshima, K.M.; Hidenori, T.; Junko, K. Inferring the demographic history of Japanese cedar, Cryptomeria japonica, using amplicon sequencing. Heredity 2019, 123, 371–383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Jiang, K.; Tong, X.; Ding, Y.; Wang, Z.; Miao, L.; Xiao, Y.; Huang, W.; Hu, Y.; Chen, X. Shifting roles of the East China Sea in the phylogeography of red nanmu in East Asia. J. Biogeogr. 2021, 48, 2486–2501. [Google Scholar] [CrossRef] [Scilit]
  36. Geng, Q.; Wang, Z.; Tao, J.; Kimura, M.K.; Liu, H.; Hogetsu, T.; Lian, C. Ocean currents drove genetic structure of seven dominant mangrove species along the coastlines of southern China. Front. Genet. 2021, 12, 615911. [Google Scholar] [CrossRef] [Scilit]
  37. Yang, Y.; Wang, Y.; Wu, Y.; Liu, Y.; Liu, C.; Jiang, Z.; Mu, X. Population genetics of zig-zag eel (Mastacembelus armatus) uncover gene flow between an isolated island and the mainland China. Front. Mar. Sci. 2023, 10, 1100949. [Google Scholar] [CrossRef] [Scilit]
  38. Voris, H.K. Maps of Pleistocene sea levels in Southeast Asia: Shorelines, river systems and time durations. J. Biogeogr. 2000, 27, 1153–1167. [Google Scholar] [CrossRef] [Scilit]
  39. Takeuchi, Y.; Diway, B. Long pollen dispersal prevents biparental inbreeding depression in seeds in a natural population of the tropical tree Shorea laxa. Forest Ecol. Manag. 2021, 489, 119063. [Google Scholar] [CrossRef] [Scilit]
  40. Backs, J.R.; Ashley, M.V. Evolutionary history and gene flow of an endemic island oak: Quercus Pacifica. Am. J. Bot. 2016, 103, 2115–2125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Fu, G.A. New species of the genus Castanopsis from Hainan. Guihaia 2001, 21, 95–98. [Google Scholar]
  42. Wright, S. Variability within and among natural populations. In Evolution and the Genetics of Populations; University of Chicago Press: Chicago, IL, USA, 1984; Volume 4, pp. 79–103. ISBN 9780226910413. [Google Scholar]
  43. Riley, L.; McGlaughlin, M.E.; Helenurm, K. Narrow water barriers prevent multiple colonizations and limit gene flow among California Channel Island wild buckwheats (Eriogonum: Polygonaceae). Bot. J. Linn. Soc. 2016, 181, 246–268. [Google Scholar] [CrossRef] [Scilit]
  44. Ge, X.; Hung, K.; Ko, Y.; Hsu, T.; Gong, X.; Chiang, T.; Chiang, Y. Genetic divergence and biogeographical patterns in Amentotaxus argotaenia species complex. Plant Mol. Biol. Rep. 2015, 33, 264–280. [Google Scholar] [CrossRef] [Scilit]
  45. Jian, J.; Yuan, Y.; Vilatersana, R.; Li, L.; Wang, Y.; Zhang, W.; Song, Z.; Kong, H.; Peter Comes, H.; Yang, J. Phylogenomic and population genomic analyses reveal the spatial–temporal dynamics of diversification of the Nigella arvensis complex (Ranunculaceae) in the Aegean archipelago. Mol. Phylogenet. Evol. 2023, 188, 107908. [Google Scholar] [CrossRef] [Scilit]
  46. Ye, L.J.; Wang, J.; Sun, P.; Dong, S.P.; Zhang, Z.Y. The transferability of nuclear microsatellite markers in Four Castanopsis Species to Castanopsis tibetana (Fagaceae). Plant Divers. 2014, 36, 443–448. [Google Scholar] [CrossRef]
  47. Huang, G.M.; Hong, L.; Ye, W.H.; Shen, H.; Cao, H.L.; Xiao, W. Isolation and characterization of polymorphic microsatellite loci in Castanopsis chinensis Hance (Fagaceae). Conserv. Genet. 2009, 10, 1069–1071. [Google Scholar] [CrossRef] [Scilit]
  48. Ueno, S.; Aoki, K.; Tsumura, Y. Generation of expressed sequence tags and development of microsatellite markers for Castanopsis sieboldii var. sieboldii (Fagaceae). Ann. For. Sci. 2009, 66, 509. [Google Scholar] [CrossRef] [Scilit]
  49. Holland, M.M.; Parson, W. GeneMarker® HID: A reliable software tool for the analysis of forensic STR data: GENEMARKER® HID. J. Forensic Sci. 2011, 56, 29–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Goudet, J. FSTAT (Version 2.9.3): A Program to Estimate and Test Gene Diversities and Fixation Indices. 2001. Available online: https://www2.unil.ch/popgen/softwares/ (accessed on 6 September 2022).
  51. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic Analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Scilit]
  52. Clark, L.V.; Jasieniuk, M. POLYSAT: An R package for polyploid microsatellite analysis. Mol. Ecol. Resour. 2011, 11, 562–566. [Google Scholar] [CrossRef] [Scilit]
  53. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Scilit]
  54. Earl, D.A.; vonHoldt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef] [Scilit]
  55. Jakobsson, M.; Rosenberg, N.A. CLUMPP: A cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 2007, 23, 1801–1806. [Google Scholar] [CrossRef] [Scilit]
  56. Rosenberg, N.A. DISTRUCT: A program for the graphical display of population structure. Mol. Ecol. Notes 2004, 4, 137–138. [Google Scholar] [CrossRef] [Scilit]
  57. Excoffier, L.; Laval, G.; Schneider, S. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol. Bioinform. Online 2007, 1, 47–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Beerli, P. Comparison of bayesian and maximum-likelihood inference of population genetic parameters. Bioinformatics 2006, 22, 341–345. [Google Scholar] [CrossRef] [Scilit]
  59. Beerli, P.; Palczewski, M. Unified framework to evaluate panmixia and migration direction among multiple sampling locations. Genetics 2010, 185, 313–326. [Google Scholar] [CrossRef] [Scilit]
Figure 1. PCoA analysis for all samples of the three Castanopsis species based on 15 nuclear SSRs. C. chinensis (CWX, YFX, YSX): individuals of C. chinensis from populations CWX, YFX, and YSX in Guangxi Province. C. chinensis (DHS): individuals of C. chinensis from population DHS in Guangdong Province.
Figure 1. PCoA analysis for all samples of the three Castanopsis species based on 15 nuclear SSRs. C. chinensis (CWX, YFX, YSX): individuals of C. chinensis from populations CWX, YFX, and YSX in Guangxi Province. C. chinensis (DHS): individuals of C. chinensis from population DHS in Guangdong Province.
Plants 13 01486 g001
Figure 2. Bayesian clustering plot for all samples of the three Castanopsis species when K = 3 and K = 4. Each vertical bar represents a single individual, and different colors represent the population structure. Population codes are the same as in Table 4.
Figure 2. Bayesian clustering plot for all samples of the three Castanopsis species when K = 3 and K = 4. Each vertical bar represents a single individual, and different colors represent the population structure. Population codes are the same as in Table 4.
Plants 13 01486 g002
Figure 3. The best demographic model obtained in the present study. Θ: Effective population size; Nm: Historical gene flow; The arrow indicated the direction of gene flow, the thickness of the arrow indicated the magnitude of gene flow, and the values in parentheses indicates 95% confidence interval.
Figure 3. The best demographic model obtained in the present study. Θ: Effective population size; Nm: Historical gene flow; The arrow indicated the direction of gene flow, the thickness of the arrow indicated the magnitude of gene flow, and the values in parentheses indicates 95% confidence interval.
Plants 13 01486 g003
Figure 4. Populations of the three Castanopsis species sampled in the present study. The population code was the same as in Table 4.
Figure 4. Populations of the three Castanopsis species sampled in the present study. The population code was the same as in Table 4.
Plants 13 01486 g004
Figure 5. The four migration models tested in the present study. Model 2 got the highest support. Arrows represent the direction of gene flow.
Figure 5. The four migration models tested in the present study. Model 2 got the highest support. Arrows represent the direction of gene flow.
Plants 13 01486 g005
Table 1. Characteristics of the 15 nuclear SSRs in all samples of the three Castanopsis species.
Table 1. Characteristics of the 15 nuclear SSRs in all samples of the three Castanopsis species.
LocusAHOHEHSHTFSTFISRSTGST
CC-7590.5710.6690.6080.6730.1190.0400.2140.102
CS20200.7470.8750.8000.8720.0810.0770.4760.087
CS2460.3540.4450.3650.4360.1650.0600.2240.171
CC3919860.0680.1970.0900.1680.5530.2530.8300.479
CC34976190.7890.8840.7920.8830.1060.0110.3940.109
CC3008970.5910.7050.5160.7030.253−0.1020.1780.277
CC39174150.6300.7500.6640.7590.1290.0450.1300.131
CC3722130.7180.7860.7010.7870.124−0.0310.1590.114
Cch1580.5000.5600.5260.5890.0760.0410.0520.113
CC4168430.0810.0780.0800.0790.005−0.038−0.009−0.003
Ccu62F15100.6820.7850.6850.7920.1010.0420.2040.143
CC4950170.7790.8580.7770.8570.0740.0270.0290.100
CcC02022160.8050.8720.7830.8750.091−0.0080.1030.111
CC456260.6610.7490.6820.7490.0990.0280.0480.095
CC13029100.7690.7540.6930.7600.069−0.0890.0990.094
mean110.5830.6650.5840.6650.1360.0240.2090.142
A: alleles observed; HO: observed heterozygosity; HE: expected heterozygosity; HS: gene diversity within populations; HT: gene diversity in the total population; FST: genetic differentiation among populations; FIS: inbreeding index; GST: the proportion of total genetic diversity that occurred among the population; RST: genetic differentiation among populations under a stepwise mutation model.
Table 2. Genetic diversity parameters in 17 populations of the three Castanopsis species.
Table 2. Genetic diversity parameters in 17 populations of the three Castanopsis species.
SpeciesPopulationSample SizeAARHHOHEFIS
C. chinensisDHS265.0673.3170.6470.5920.6330.057
CWX235.5333.2050.5670.5380.5540.026
YFX42.8672.8670.5560.5170.4810.017
YSX164.4673.1080.5830.5370.5630.068
mean 4.4833.1240.5880.5460.5580.042
C. glabrifoliaDQ205.0003.0700.5360.5260.5220.025
DS245.3333.1920.5620.5310.5500.051
XXS265.9333.2940.5760.5740.565−0.004
XS43.0003.0000.5860.6330.519−0.032
ZD205.3333.0820.5240.5070.5110.034
YL205.9333.5090.6120.6270.597−0.041
BLM63.4672.9030.4930.5000.453−0.017
CB195.6673.5160.6220.6420.606−0.024
mean 4.9583.1960.5640.5670.540−0.001
C. qiongbeiensisCF246.6673.5500.6220.6440.610−0.038
BC185.6003.5030.6250.6110.6070.006
BCS256.3333.5250.6300.6170.6170.006
LFT164.8673.0500.5550.6170.539−0.12
BT175.2673.3760.6220.6350.604−0.021
mean 5.7473.4010.6110.6250.595−0.033
A: alleles observed; AR: allele richness; H: gene diversity; HO: observed heterozygosity; HE: expected heterozygosity; FIS: inbreeding index.
Table 3. The AMOVA results for all samples of the three Castanopsis species.
Table 3. The AMOVA results for all samples of the three Castanopsis species.
Source of VariationSum of SquaresVariance ComponentsPercentage VariationFixation Indices
(p < 0.000)
among species191.0680.3917.610FCT: 0.076
among populations within species225.8660.3356.510FSC: 0.071
within populations2641.6594.41085.880FST: 0.141
Table 4. Sampling location and size of 17 populations of the three Castanopsis species.
Table 4. Sampling location and size of 17 populations of the three Castanopsis species.
SpeciesPopulation CodePopulation LocationSample SizeLongitude (°E)Latitude (°N)
C. chinensisDHSDinghushan26112°33′8.78″23°9′51.63″
CWXCangwuxian23111°31′58.72″23°46′10.14″
YFXYongfuxian4110°9′20.4″24°55′3.47″
YSXYangshuoxian16110°17′37.91″24°49′45.12″
C. glabrifoliaXXSXiaoxishan 26110°56′30.90″19°49′52.81″
XSXinshi4110°57′48.24″19°48′10.94″
CBChangbi19110°56′23.54″19°47′32.68″
YLYalang20110°57′58.68″19°47′22.20″
BLMBaolongmei6110°57′50.43″19°46′51.98″
DSDashan24110°57′47.37″19°46′38.02″
DQDongqun20110°57′40.40″19°45′45.84″
ZDZhudui20110°56′57.93″19°44′39.71″
C. qiongbeiensisLFTLongfeitou16110°50′59.25″19°47′53.27″
CFChangfa24110°52′28.12″19°49′30.59″
BCSBaocaishan25110°52′55.52″19°48′34.70″
BCBaicai18110°53′36.32″19°48′15.19″
BTBangtou17110°53′5.85″19°45′18.08″
Table 5. The 15 primer pairs of nuclear SSRs used in this study.
Table 5. The 15 primer pairs of nuclear SSRs used in this study.
LocusRepetitive UnitPrimer Sequence (5→3′)Fragment LengthReference
CC-75 (GA)6F: <TAMRA>AACACCAGAGCTTGAGAGCG110–138treegenesdb.org
R: CCTTGACATTGTCGATGGTG
CC-39198(AG)11F: <6-FAM>GGTTGTTGTCGTTGTCGTTG205–215treegenesdb.org
R: TCTGTCTCCGTTCACCCTCT
CC-34976(GA)7F:<ROX>GTGGTGGATTTTGGGTATGG253–291treegenesdb.org
R:TCCCAAACCTTGTCACCTTC
CC-30089(TGT)6F: <HEX>ACTTGGTTCTCCGAAGCTCA115–133treegenesdb.org
R:ACCGCTACTTCTTCAGCCCT
CC-39174(GA)6F:<6-FAM>GGAGGAGGGATCATGTGAGA219–249treegenesdb.org
R:TCCCAGAAATCCAAATCCCT
CC-3722(AG)10F:<TAMRA>AGAGATGGGTTGGGAAGGTT130–160treegenesdb.org
R:GGCCTCTCTGGTTTGTGTGT
CC-41684(ACC)6F: <ROX>ATCCTCCAAGCAATCCTCCT288–294treegenesdb.org
R: TCAAGTGTGTGCGAGTGACA
CC-4950(GT)5F:<6-FAM>GCGATACCTCCAGACATGGT246–284treegenesdb.org
R:CAGCTTGAAGAAATCTGGGC
CC-4562(TCG)7F:<TAMRA>CGTATAGGGTGGAAACGGAA144–159treegenesdb.org
R:GGACAAGCAAATCACGGAAT
CC-13029(TC)8F:<HEX>CACACCTCGTTGTTTGTGCT125–143treegenesdb.org
R:CGAGGAGAAGATAGGAAAAGC
CS20 (AG)13F:<ROX>AATTTCACATCCCAACTCTGCGA246–290[46]
R:TGGAGGGAGTAGTGGACGATCAA
CS24(CAA)6F:<TAMRA>ATCACCGGAGAAAACCCTAACGA118–133[46]
R:AATGTTTCGGACCAATTCGAGGT
Cch15(CT)11F:<6-FAM>CCCATAACGTCTGACCCCTA229–251[47]
R:CCAAAAGGGCTTCATAACCA
Ccu62F15(TC)17F:<TAMRA>TTGCATCCTCAGCTTTCTCA132–156[47]
R: GCCCTCTCCTAACACCAATAATAC
CcC02022(TC)12F:<ROX>TTCACTTGTTTTTCCCGACCAGA342–372[48]
R:CCGCTAAAATGGTGTTGCAGAAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wu, Y.; Yang, K.; Wen, X.; Sun, Y. Genetic Differentiation and Relationship among Castanopsis chinensis, C. qiongbeiensis, and C. glabrifolia (Fagaceae) as Revealed by Nuclear SSR Markers. Plants 2024, 13, 1486. https://doi.org/10.3390/plants13111486

AMA Style

Wu Y, Yang K, Wen X, Sun Y. Genetic Differentiation and Relationship among Castanopsis chinensis, C. qiongbeiensis, and C. glabrifolia (Fagaceae) as Revealed by Nuclear SSR Markers. Plants. 2024; 13(11):1486. https://doi.org/10.3390/plants13111486

Chicago/Turabian Style

Wu, Yang, Kai Yang, Xiangying Wen, and Ye Sun. 2024. "Genetic Differentiation and Relationship among Castanopsis chinensis, C. qiongbeiensis, and C. glabrifolia (Fagaceae) as Revealed by Nuclear SSR Markers" Plants 13, no. 11: 1486. https://doi.org/10.3390/plants13111486

APA Style

Wu, Y., Yang, K., Wen, X., & Sun, Y. (2024). Genetic Differentiation and Relationship among Castanopsis chinensis, C. qiongbeiensis, and C. glabrifolia (Fagaceae) as Revealed by Nuclear SSR Markers. Plants, 13(11), 1486. https://doi.org/10.3390/plants13111486

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop