Exploring Disease Resistance in Pepper (Capsicum spp.) Germplasm Collection Using Fluidigm SNP Genotyping
Abstract
1. Introduction
2. Results
2.1. Summary of Marker Screening Results According to Species
2.1.1. Bacterial Spot Resistance
No. | Species | Bs2 | Bs3-1 | Bs3-2 | ||||||
---|---|---|---|---|---|---|---|---|---|---|
R | H | S | R | H | S | R | H | S | ||
1 | C. annuum | 8 | 4 | 4496 | 2544 | 281 | 1627 | 2013 | 303 | 2182 |
2 | C. baccatum | 3 | 0 | 273 | 261 | 0 | 8 | 15 | 3 | 199 |
3 | C. chacoense | 10 | 1 | 0 | 9 | 0 | 0 | 0 | 1 | 10 |
4 | C. chinense | 1 | 0 | 280 | 191 | 1 | 16 | 5 | 2 | 272 |
5 | C. frutescens | 0 | 0 | 224 | 84 | 5 | 66 | 20 | 5 | 197 |
6 | C. galapagoense | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 0 | 0 |
7 | C. pubescens | 0 | 0 | 2 | 2 | 0 | 0 | 0 | 0 | 2 |
8 | Capsicum sp. | 0 | 0 | 326 | 152 | 21 | 135 | 112 | 23 | 186 |
Total | 22 | 5 | 5602 | 3244 | 308 | 1852 | 2166 | 337 | 3048 |
2.1.2. Anthracnose Resistance
No. | Species | CA09g12180 | CA09g19170 | CcR9 | ||||||
---|---|---|---|---|---|---|---|---|---|---|
R | H | S | R | H | S | R | H | S | ||
1 | C. annuum | 23 | 0 | 4488 | 24 | 0 | 4480 | 22 | 4 | 4485 |
2 | C. baccatum | 248 | 3 | 24 | 244 | 2 | 23 | 250 | 2 | 23 |
3 | C. chacoense | 10 | 1 | 0 | 11 | 0 | 0 | 10 | 1 | 0 |
4 | C. chinense | 3 | 2 | 277 | 3 | 2 | 270 | 3 | 2 | 276 |
5 | C. frutescens | 4 | 1 | 218 | 4 | 1 | 219 | 3 | 1 | 220 |
6 | C. galapagoense | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 1 |
7 | C. pubescens | 0 | 0 | 2 | 0 | 0 | 2 | 0 | 0 | 2 |
8 | Capsicum sp. | 9 | 1 | 315 | 9 | 0 | 315 | 9 | 0 | 314 |
Total | 297 | 8 | 5325 | 295 | 5 | 5310 | 297 | 10 | 5321 |
2.1.3. Powdery Mildew and Phytophtora Root Rot Resistance
No. | Species | Ltr4.1-40344 | Ltr4.2-56301 | Ltr4.2-585119 | M3-2 | M3-3 | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
R | H | S | R | H | S | R | H | S | R | H | S | R | H | S | ||
1 | C. annuum | 22 | 0 | 4419 | 21 | 1 | 4273 | 21 | 3 | 4469 | 264 | 52 | 4193 | 254 | 58 | 4175 |
2 | C. baccatum | 248 | 2 | 17 | 243 | 1 | 24 | 244 | 4 | 25 | 258 | 1 | 18 | 57 | 2 | 37 |
3 | C. chacoense | 11 | 0 | 0 | 11 | 0 | 0 | 10 | 1 | 0 | 10 | 1 | 0 | 11 | 0 | 0 |
4 | C. chinense | 5 | 2 | 261 | 3 | 0 | 275 | 3 | 2 | 277 | 260 | 4 | 17 | 259 | 2 | 17 |
5 | C. frutescens | 4 | 1 | 211 | 4 | 0 | 220 | 4 | 1 | 219 | 180 | 3 | 41 | 179 | 2 | 41 |
6 | C. galapagoense | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 0 | 0 |
7 | C. pubescens | 0 | 0 | 2 | 0 | 0 | 2 | 0 | 0 | 2 | 2 | 0 | 0 | 2 | 0 | 0 |
8 | Capsicum sp. | 9 | 0 | 310 | 9 | 0 | 307 | 9 | 0 | 316 | 58 | 5 | 261 | 54 | 5 | 260 |
Total | 299 | 5 | 5221 | 291 | 2 | 5102 | 291 | 11 | 5309 | 1033 | 66 | 4530 | 817 | 69 | 4530 |
2.1.4. Potyvirus Resistance
No. | Species | pvr1 | pvr2-123457 | pvr2-689 | Pvr4-20172-2 | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
R | H | S | R | H | S | R | H | S | R | H | S | ||
1 | C. annuum | 5 | 5 | 4499 | 779 | 249 | 3457 | 26 | 5 | 4464 | 3247 | 193 | 872 |
2 | C. baccatum | 3 | 0 | 274 | 7 | 0 | 270 | 1 | 0 | 274 | 268 | 1 | 4 |
3 | C. chacoense | 0 | 0 | 11 | 0 | 0 | 11 | 0 | 0 | 10 | 10 | 0 | 0 |
4 | C. chinense | 94 | 11 | 174 | 11 | 1 | 269 | 2 | 0 | 279 | 271 | 0 | 9 |
5 | C. frutescens | 11 | 0 | 212 | 23 | 10 | 190 | 5 | 2 | 214 | 195 | 1 | 25 |
6 | C. galapagoense | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 1 |
7 | C. pubescens | 0 | 0 | 2 | 0 | 0 | 2 | 0 | 0 | 2 | 2 | 0 | 0 |
8 | Capsicum sp. | 3 | 0 | 322 | 50 | 22 | 253 | 2 | 0 | 325 | 238 | 22 | 63 |
Total | 116 | 16 | 5495 | 870 | 282 | 4453 | 36 | 7 | 5569 | 4231 | 217 | 974 |
2.1.5. CMV, TTSWV, and TMV Resistances
No. | Species | Cmr1-2 | TSW1-4 | L1-3K | L4 | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
R | H | S | R | H | S | R | H | S | R | H | S | ||
1 | C. annuum | 1330 | 272 | 2905 | 6 | 3 | 4065 | 251 | 21 | 2978 | 0 | 1 | 4510 |
2 | C. baccatum | 15 | 2 | 256 | 2 | 0 | 163 | 3 | 0 | 150 | 0 | 0 | 277 |
3 | C. chacoense | 0 | 0 | 11 | 0 | 0 | 1 | 0 | 0 | 3 | 0 | 0 | 5 |
4 | C. chinense | 245 | 2 | 30 | 47 | 8 | 144 | 3 | 0 | 240 | 0 | 0 | 281 |
5 | C. frutescens | 129 | 0 | 88 | 4 | 0 | 129 | 4 | 0 | 200 | 0 | 0 | 224 |
6 | C. galapagoense | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 1 |
7 | C. pubescens | 2 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 2 | 0 | 0 | 2 |
8 | Capsicum sp. | 75 | 15 | 235 | 3 | 0 | 235 | 43 | 5 | 186 | 0 | 0 | 326 |
Total | 1797 | 291 | 3525 | 62 | 11 | 4740 | 304 | 26 | 3760 | 0 | 1 | 5626 |
2.2. Association of Markers
2.3. Selected Resistant Accession for Multiple Diseases
2.4. Fluidigm Data Compared to Disease Phenotype for CMV and TSWV Viruses
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Diseases
4.2. Primer Design for the Fluidigm SNP Type Assays
4.3. DNA Extraction
4.4. Specific Target Amplification
4.5. SNP-Type Assay
4.6. Scoring of SNPs
4.7. Disease Evaluation for CMV and TSWV
4.8. Statistical Analysis
Fluidigm Assay No. | SNP-Type Assay | Trait | Target Gene or QTL | Position | SNP (Phenotype y) | SNP (Color of Dye z) | Reference |
---|---|---|---|---|---|---|---|
FA1 | Bs2 | Bacterial spot resistance | Bs2 | Chr.9 | T(R):A(S) | A(R):T(G) | [9] |
FA2 | Bs3-1 | Bacterial spot resistance | Bs3 | Chr.2 | C(R):T(S) | C(R):T(G) | [18] |
FA3 | Bs3-2 | Bacterial spot resistance | Bs3 | Chr.2 | G(R):T(S) | G(R):T(G) | [18] |
FA4 | CcR9 | Anthracnose resistance | CcR9 | Chr.9 | C(R):A(S) | A(R):C(G) | [74,75] |
FA5 | CA09g12180 | Anthracnose resistance | CcR9 | Chr.9 | A(R):C(S) | A(R):C(G) | [74,75] |
FA6 | CA09g19170 | Anthracnose resistance | CcR9 | Chr.9 | C(R):T(S) | C(R):T(G) | [74,75] |
FA7 | Ltr4.1-40344 | Powdery mildew resistance | Ltr4.1 | Chr.4 | AAAAC(R):GAAAT(S) | AAAAC(R):GAAAT(G) | [76] |
FA8 | Ltr4.2-56301 | Powdery mildew resistance | Ltr4.2 | Chr.4 | A(R):C(S) | A(R):C(G) | [76] |
FA9 | Ltr4.2-585119 | Powdery mildew resistance | Ltr4.2 | Chr.4 | C(R):T(S) | C(R):T(G) | [76] |
FA10 | M3-2 | Phytophthora root rot resistance | Phyto.5.2 | Chr.5 | T(R):C(S) | C(R):T(G) | [5,20] |
FA11 | M3-3 | Phytophthora root rot resistance | Phyto.5.2 | Chr.5 | CAGA(R):GAGT(S) | CAGA(R):GAGT(G) | [5,20] |
FA12 | pvr1 | Potyvirus resistance | pvr1 | Chr.4 | A(pvr1):C(pvr1+) | A(R):C(G) | [21,63] |
FA13 | pvr2-123457 | Potyvirus resistance | pvr2 | Chr.4 | A(pvr2123457) T(pvr2not 123457) | T(R):A(G) | [21,63] |
FA14 | pvr2(689) | Potyvirus resistance | pvr2 | Chr.4 | A(pvr2-689):C(pvr2+689) | C(R):A(G) | [21,63] |
FA15 | Pvr4-20172-2 | Potyvirus resistance | Pvr4 | Chr.10 | C(R):G(S) | C(R):G(G) | [21,63] |
FA16 | Cmr1-2 | CMV resistance | Cmr1 | Chr.2 | T(R):G(S) | G(R):T(G) | [23] |
FA17 | TSW1-4 | TSWV | Tsw1 | Chr.11 | TAAACGGAC(R):CAGACGGACCAAAAAAAGGTACGGAC(S) | TAAACGGAC(R):CAGACGGACCAAAAAAAGGTACGGAC(G) | [22] |
FA18 | L1-3K | TMV resistance | L1 | Chr.11 | C(L1):T(not L1) | C(R):T(G) | [11,77] |
FA19 | L4 | TMV resistance | L4 | Chr.10 | A(L4):T(not L4) | A(R):T(G) | [11,77] |
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Lee, S.-H.; Lee, J.-B.; Kim, S.-M.; Choi, H.-S.; Park, J.-W.; Lee, J.-S.; Lee, K.-W.; Moon, J.-S. The Incidence and Distribution of Viral Diseases in Pepper by Cultivation Types. Res. Plant Dis. 2004, 10, 231–240. [Google Scholar] [CrossRef][Green Version]
- Carrizo García, C.; Barfuss, M.H.J.; Sehr, E.M.; Barboza, G.E.; Samuel, R.; Moscone, E.A.; Ehrendorfer, F. Phylogenetic Relationships, Diversification and Expansion of Chili Peppers (Capsicum, Solanaceae). Ann. Bot. 2016, 118, 35–51. [Google Scholar] [CrossRef]
- Pickersgill, B. Genetic Resources and Breeding of Capsicum spp. Euphytica 1997, 96, 129–133. [Google Scholar] [CrossRef]
- FAO. Food and Agriculture Organization of the United Nations Statistics Division 2021. Available online: https://www.fao.org/faostat/en/#data/QV/visualize (accessed on 10 February 2024).
- Liu, W.-Y.; Kang, J.-H.; Jeong, H.-S.; Choi, H.-J.; Yang, H.-B.; Kim, K.-T.; Choi, D.; Choi, G.J.; Jahn, M.; Kang, B.-C. Combined Use of Bulked Segregant Analysis and Microarrays Reveals SNP Markers Pinpointing a Major QTL for Resistance to Phytophthora Capsici in Pepper. Theor. Appl. Genet. 2014, 127, 2503–2513. [Google Scholar] [CrossRef]
- Mahasuk, P.; Struss, D.; Mongkolporn, O. QTLs for Resistance to Anthracnose Identified in Two Capsicum Sources. Mol. Breed. 2016, 36, 10. [Google Scholar] [CrossRef]
- Lefebvre, V.; Daubèze, A.-M.; Van Der Voort, J.R.; Peleman, J.; Bardin, M.; Palloix, A. QTLs for Resistance to Powdery Mildew in Pepper under Natural and Artificial Infections. Theor. Appl. Genet. 2003, 107, 661–666. [Google Scholar] [CrossRef]
- Mimura, Y.; Kageyama, T.; Minamiyama, Y.; Hirai, M. QTL Analysis for Resistance to Ralstonia Solanacearum in Capsicum Accession ‘LS2341’. J. Jpn. Soc. Hort. Sci. 2009, 78, 307–313. [Google Scholar] [CrossRef]
- Truong, H.T.H.; Kim, K.-T.; Kim, S.; Cho, M.-C.; Kim, H.-R.; Woo, J.-G. Development of Gene-Based Markers for the Bs2 Bacterial Spot Resistance Gene for Marker-Assisted Selection in Pepper (Capsicum spp.). Hortic. Environ. Biotechnol. 2011, 52, 65–73. [Google Scholar] [CrossRef]
- Eun, M.H.; Han, J.-H.; Yoon, J.B.; Lee, J. QTL Mapping of Resistance to the Cucumber Mosaic Virus P1 Strain in Pepper Using a Genotyping-by-Sequencing Analysis. Hortic. Environ. Biotechnol. 2016, 57, 589–597. [Google Scholar] [CrossRef]
- Yang, H.-B.; Liu, W.; Kang, W.-H.; Kim, J.-H.; Cho, H.J.; Yoo, J.-H.; Kang, B.-C. Development and Validation of L Allele-Specific Markers in Capsicum. Mol. Breed. 2012, 30, 819–829. [Google Scholar] [CrossRef]
- Kim, H.; Yoon, J.B.; Lee, J. Development of Fluidigm SNP Type GenotypingAssays for Marker-Assisted Breeding of Chili Pepper (Capsicum annuum L.). Hortic. Sci. Technol. 2017, 35, 465–479. [Google Scholar] [CrossRef]
- Kim, H.J.; Han, J.-H.; Kim, S.; Lee, H.R.; Shin, J.-S.; Kim, J.-H.; Cho, J.; Kim, Y.H.; Lee, H.J.; Kim, B.-D.; et al. Trichome Density of Main Stem Is Tightly Linked to PepMoV Resistance in Chili Pepper (Capsicum annuum L.). Theor. Appl. Genet. 2011, 122, 1051–1058. [Google Scholar] [CrossRef]
- Collard, B.C.Y.; Jahufer, M.Z.Z.; Brouwer, J.B.; Pang, E.C.K. An Introduction to Markers, Quantitative Trait Loci (QTL) Mapping and Marker-Assisted Selection for Crop Improvement: The Basic Concepts. Euphytica 2005, 142, 169–196. [Google Scholar] [CrossRef]
- Collard, B.C.Y.; Mackill, D.J. Marker-Assisted Selection: An Approach for Precision Plant Breeding in the Twenty-First Century. Phil. Trans. R. Soc. B 2008, 363, 557–572. [Google Scholar] [CrossRef]
- Xu, Y.; Crouch, J.H. Marker-Assisted Selection in Plant Breeding: From Publications to Practice. Crop Sci. 2008, 48, 391–407. [Google Scholar] [CrossRef]
- Tai, T.H.; Dahlbeck, D.; Clark, E.T.; Gajiwala, P.; Pasion, R.; Whalen, M.C.; Stall, R.E.; Staskawicz, B.J. Expression of the Bs2 Pepper Gene Confers Resistance to Bacterial Spot Disease in Tomato. Proc. Natl. Acad. Sci. USA 1999, 96, 14153–14158. [Google Scholar] [CrossRef]
- Römer, P.; Jordan, T.; Lahaye, T. Identification and Application of a DNA-based Marker That Is Diagnostic for the Pepper (Capsicum annuum) Bacterial Spot Resistance Gene Bs3. Plant Breed. 2010, 129, 737–740. [Google Scholar] [CrossRef]
- Quirin, E.A.; Ogundiwin, E.A.; Prince, J.P.; Mazourek, M.; Briggs, M.O.; Chlanda, T.S.; Kim, K.-T.; Falise, M.; Kang, B.-C.; Jahn, M.M. Development of Sequence Characterized Amplified Region (SCAR) Primers for the Detection of Phyto.5.2, a Major QTL for Resistance to Phytophthora capsici Leon. in Pepper. Theor. Appl. Genet. 2005, 110, 605–612. [Google Scholar] [CrossRef]
- Lee, W.-P.; Lee, J.-D.; Han, J.-H.; Kang, B.-C.; Yoon, J.-B. Validity Test for Molecular Markers Associated with Resistance to Phytophthora Root Rot in Chili Pepper (Capsicum annuum L.). Korean J. Hortic. Sci. 2012, 30, 64–72. [Google Scholar] [CrossRef][Green Version]
- Yeam, I.; Kang, B.-C.; Lindeman, W.; Frantz, J.D.; Faber, N.; Jahn, M.M. Allele-Specific CAPS Markers Based on Point Mutations in Resistance Alleles at the Pvr1 Locus Encoding eIF4E in Capsicum. Theor. Appl. Genet. 2005, 112, 178–186. [Google Scholar] [CrossRef]
- Kim, S.; Kang, W.; Huy, H.N.; Yeom, S.; An, J.; Kim, S.; Kang, M.; Kim, H.J.; Jo, Y.D.; Ha, Y.; et al. Divergent Evolution of Multiple Virus-resistance Genes from a Progenitor in Capsicum spp. New Phytol. 2017, 213, 886–899. [Google Scholar] [CrossRef]
- Kang, W.-H.; Hoang, N.H.; Yang, H.-B.; Kwon, J.-K.; Jo, S.-H.; Seo, J.-K.; Kim, K.-H.; Choi, D.; Kang, B.-C. Molecular Mapping and Characterization of a Single Dominant Gene Controlling CMV Resistance in Peppers (Capsicum annuum L.). Theor. Appl. Genet. 2010, 120, 1587–1596. [Google Scholar] [CrossRef] [PubMed]
- Varshney, R.K.; Nayak, S.N.; May, G.D.; Jackson, S.A. Next-Generation Sequencing Technologies and Their Implications for Crop Genetics and Breeding. Trends Biotechnol. 2009, 27, 522–530. [Google Scholar] [CrossRef]
- Kumar, S.; Banks, T.W.; Cloutier, S. SNP Discovery through Next-Generation Sequencing and Its Applications. Int. J. Plant Genom. 2012, 2012, 831460. [Google Scholar] [CrossRef]
- Poland, J.A.; Rife, T.W. Genotyping-by-Sequencing for Plant Breeding and Genetics. Plant Genome 2012, 5, 92–102. [Google Scholar] [CrossRef]
- Thomson, M.J. High-Throughput SNP Genotyping to Accelerate Crop Improvement. Plant Breed. Biotechnol. 2014, 2, 195–212. [Google Scholar] [CrossRef]
- Rafalski, A. Applications of Single Nucleotide Polymorphisms in Crop Genetics. Curr. Opin. Plant Biol. 2002, 5, 94–100. [Google Scholar] [CrossRef]
- Reuter, J.A.; Spacek, D.V.; Snyder, M.P. High-Throughput Sequencing Technologies. Mol. Cell 2015, 58, 586–597. [Google Scholar] [CrossRef]
- Slatko, B.E.; Gardner, A.F.; Ausubel, F.M. Overview of Next-Generation Sequencing Technologies. Curr. Protoc. Mol. Biol. 2018, 122, e59. [Google Scholar] [CrossRef]
- Wang, J.; Lin, M.; Crenshaw, A.; Hutchinson, A.; Hicks, B.; Yeager, M.; Berndt, S.; Huang, W.-Y.; Hayes, R.B.; Chanock, S.J.; et al. High-Throughput Single Nucleotide Polymorphism Genotyping Using Nanofluidic Dynamic Arrays. BMC Genom. 2009, 10, 561. [Google Scholar] [CrossRef]
- Kishor, D.S.; Song, W.-H.; Noh, Y.; Lee, G.P.; Park, Y.; Jung, J.-K.; Shim, E.-J.; Chung, S.-M. Development of SNP Markers and Validation Assays in Commercial Korean Melon Cultivars, Using Genotyping-by-Sequencing and Fluidigm Analyses. Sci. Hortic. 2020, 263, 109113. [Google Scholar] [CrossRef]
- Nguyen, N.N.; Kim, M.; Jung, J.-K.; Shim, E.-J.; Chung, S.-M.; Park, Y.; Lee, G.P.; Sim, S.-C. Genome-Wide SNP Discovery and Core Marker Sets for Assessment of Genetic Variations in Cultivated Pumpkin (Cucurbita spp.). Hortic. Res. 2020, 7, 121. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.; Jung, J.-K.; Shim, E.-J.; Chung, S.-M.; Park, Y.; Lee, G.P.; Sim, S.-C. Genome-Wide SNP Discovery and Core Marker Sets for DNA Barcoding and Variety Identification in Commercial Tomato Cultivars. Sci. Hortic. 2021, 276, 109734. [Google Scholar] [CrossRef]
- Park, G.; Choi, Y.; Jung, J.-K.; Shim, E.-J.; Kang, M.; Sim, S.-C.; Chung, S.-M.; Lee, G.P.; Park, Y. Genetic Diversity Assessment and Cultivar Identification of Cucumber (Cucumis sativus L.) Using the Fluidigm Single Nucleotide Polymorphism Assay. Plants 2021, 10, 395. [Google Scholar] [CrossRef]
- Hibberd, A.M. Different Phenotypes Associated with Incompatible Races and Resistance Genes in Bacterial Spot Disease of Pepper. Plant Dis. 1987, 71, 1075. [Google Scholar] [CrossRef]
- Stall, R.E.; Jones, J.B.; Minsavage, G.V. Durability of Resistance in Tomato and Pepper to Xanthomonads Causing Bacterial Spot. Annu. Rev. Phytopathol. 2009, 47, 265–284. [Google Scholar] [CrossRef] [PubMed]
- Thabuis, A.; Palloix, A.; Pflieger, S.; Daubèze, A.-M.; Caranta, C.; Lefebvre, V. Comparative Mapping of Phytophthora Resistance Loci in Pepper Germplasm: Evidence for Conserved Resistance Loci across Solanaceae and for a Large Genetic Diversity. Theor. Appl. Genet. 2003, 106, 1473–1485. [Google Scholar] [CrossRef] [PubMed]
- Silvar, C.; García-González, C.A. Screening Old Peppers (Capsicum spp.) for Disease Resistance and Pungency-Related Traits. Sci. Hortic. 2017, 218, 249–257. [Google Scholar] [CrossRef]
- Di Dato, F.; Parisi, M.; Cardi, T.; Tripodi, P. Genetic Diversity and Assessment of Markers Linked to Resistance and Pungency Genes in Capsicum Germplasm. Euphytica 2015, 204, 103–119. [Google Scholar] [CrossRef]
- Bosland, P.W.; Lindsey, D.L. A Seedling Screen for Phytophthora Root Rot of Pepper, Capsicum annuum. Plant Dis. 1991, 75, 1048. [Google Scholar] [CrossRef]
- Sarath Babu, B.; Pandravada, S.R.; Prasada Rao, R.D.V.J.; Anitha, K.; Chakrabarty, S.K.; Varaprasad, K.S. Global Sources of Pepper Genetic Resources against Arthropods, Nematodes and Pathogens. Crop Prot. 2011, 30, 389–400. [Google Scholar] [CrossRef]
- Cui, L.; Van Den Munckhof, M.C.; Bai, Y.; Voorrips, R.E. Resistance to Anthracnose Rot Disease in Capsicum. Agronomy 2023, 13, 1434. [Google Scholar] [CrossRef]
- Park, S.K.; Kim, S.H.; Park, H.G. Capsicum Germplasm Resistant to Pepper Anthracnose Differentially Interact with Colletotrichum Isolates. Hortic. Environ. Biotechnol. 2009, 50, 17–23. [Google Scholar]
- Ro, N.-Y.; Sebastin, R.; Hur, O.-S.; Cho, G.-T.; Geum, B.; Lee, Y.-J.; Kang, B.-C. Evaluation of Anthracnose Resistance in Pepper (Capsicum spp.) Genetic Resources. Horticulturae 2021, 7, 460. [Google Scholar] [CrossRef]
- Kim, S.H.; Yoon, J.B.; Do, J.W.; Park, H.G. A Major Recessive Gene Associated with Anthracnose Resistance to Colletotrichum Capsici in Chili Pepper (Capsicum annuum L.). Breed. Sci. 2008, 58, 137–141. [Google Scholar] [CrossRef]
- Mahasuk, P.; Khumpeng, N.; Wasee, S.; Taylor, P.W.J.; Mongkolporn, O. Inheritance of Resistance to Anthracnose (Colletotrichum capsici) at Seedling and Fruiting Stages in Chili Pepper (Capsicum spp.). Plant Breed. 2009, 128, 701–706. [Google Scholar] [CrossRef]
- Mahasuk, P.; Taylor, P.W.J.; Mongkolporn, O. Identification of Two New Genes Conferring Resistance to Colletotrichum acutatum in Capsicum baccatum. Phytopathology 2009, 99, 1100–1104. [Google Scholar] [CrossRef] [PubMed]
- Than, P.P.; Jeewon, R.; Hyde, K.D.; Pongsupasamit, S.; Mongkolporn, O.; Taylor, P.W.J. Characterization and Pathogenicity of Colletotrichum Species Associated with Anthracnose on Chilli (Capsicum spp.) in Thailand. Plant Pathol. 2008, 57, 562–572. [Google Scholar] [CrossRef]
- Anand, N.; Deshpande, A.A.; Sridhar, T.S. Resistance to Powdery Mildew in an Accession of Capsicum frutescens and Its Inheritance Pattern. Capsicum Newsl. 1987, 77–78. Available online: https://www.cabidigitallibrary.org/doi/full/10.5555/19891605191 (accessed on 26 March 2024).
- De Souza, V.L.; Café-Filho, A.C. Resistance to Leveillula taurica in the Genus Capsicum. Plant Pathol. 2003, 52, 613–619. [Google Scholar] [CrossRef]
- Deshpande, A.A.; Anand, N.; Pathak, C.S.; Sridhar, T.S. New Sources of Powdery Mildew Resistance in Capsicum Species. Capsicum Newsl. 1985, 4, 75–76. [Google Scholar]
- Pochard, E.; Palloix, A.; Daubèze, A.M. The Use of Androgenetic Autodiploid Lines for the Analysis of Complex Resistance Systems in the Pepper. In Proceedings of the VIth Meeting on Genetics and Breeding on Capsicum and Eggplant, Zaragoza, Spain, 21–24 October 1986; pp. 105–109. [Google Scholar]
- Ullasa, B.A. Reaction of Sweet Pepper Genotypes to Anthracnose, Cercospora Leaf Spot, and Powdery Mildew. Plant Dis. 1981, 65, 600. [Google Scholar] [CrossRef]
- Blat, S.F.; Costa, C.P.D.; Vencovsky, R.; Sala, F.C. Hot Pepper (Capsicum chinense, Jacq.) Inheritance of Reaction to Powdery Mildew. Sci. Agric. Piracicaba Braz. 2006, 63, 471–474. [Google Scholar] [CrossRef][Green Version]
- Manzur, J.P.; Fita, A.; Prohens, J.; Rodríguez-Burruezo, A. Successful Wide Hybridization and Introgression Breeding in a Diverse Set of Common Peppers (Capsicum annuum) Using Different Cultivated Ají (C. baccatum) Accessions as Donor Parents. PLoS ONE 2015, 10, e0144142. [Google Scholar] [CrossRef]
- Martins, K.C.; Pereira, T.N.S.; Souza, S.A.M.; Rodrigues, R.; Amaral Junior, A.T.D. Crossability and Evaluation of Incompatibility Barriers in Crosses between Capsicum Species. Crop Breed. Appl. Biotechnol. 2015, 15, 139–145. [Google Scholar] [CrossRef]
- Kang, B.-C.; Yeam, I.; Jahn, M.M. Genetics of Plant Virus Resistance. Annu. Rev. Phytopathol. 2005, 43, 581–621. [Google Scholar] [CrossRef]
- Kenyon, L.; Kumar, S.; Tsai, W.-S.; Hughes, J.A. Virus Diseases of Peppers (Capsicum spp.) and Their Control. In Advances in Virus Research; Elsevier: Amsterdam, The Netherlands, 2014; Volume 90, pp. 297–354. ISBN 978-0-12-801246-8. [Google Scholar]
- Gray, S.; Moyer, J. Resistance in Cucumis Melo to Watermelon Mosaic Virus That Reduces Disease Severity and Disease Incidence. Resist. Viral Dis. Veg. Genet. Breed. 1993, 196–216. Available online: https://www.cabidigitallibrary.org/doi/full/10.5555/19952304955 (accessed on 26 March 2024).
- Caranta, C.; Thabuis, A.; Palloix, A. Development of a CAPS Marker for the Pvr4 Locus: A Tool for Pyramiding Potyvirus Resistance Genes in Pepper. Genome 1999, 42, 1111–1116. [Google Scholar] [CrossRef]
- Rubio, M.; Caranta, C.; Palloix, A. Functional Markers for Selection of Potyvirus Resistance Alleles at the Pvr2-eIF4E Locus in Pepper Using Tetra-Primer ARMS–PCR. Genome 2008, 51, 767–771. [Google Scholar] [CrossRef]
- Choi, S.K.; Palukaitis, P.; Min, B.E.; Lee, M.Y.; Choi, J.K.; Ryu, K.H. Cucumber Mosaic Virus 2a Polymerase and 3a Movement Proteins Independently Affect Both Virus Movement and the Timing of Symptom Development in Zucchini Squash. J. Gen. Virol. 2005, 86, 1213–1222. [Google Scholar] [CrossRef]
- Caranta, C.; Palloix, A. Both Common and Specific Genetic Factors Are Involved in Polygenic Resistance of Pepper to Several Potyviruses. Theor. Appl. Genet. 1996, 92, 15–20. [Google Scholar] [CrossRef]
- Grube, R.C.; Zhang, Y.; Murphy, J.F.; Loaiza-Figueroa, F.; Lackney, V.K.; Provvidenti, R.; Jahn, M.K. New Source of Resistance to Cucumber mosaic Virus in Capsicum frutescens. Plant Dis. 2000, 84, 885–891. [Google Scholar] [CrossRef]
- Lapidot, M.; Paran, I.; Ben-Joseph, R.; Ben-Harush, S.; Pilowsky, M.; Cohen, S.; Shifriss, C. Tolerance to Cucumber Mosaic Virus in Pepper: Development of Advanced Breeding Lines and Evaluation of Virus Level. Plant Dis. 1997, 81, 185–188. [Google Scholar] [CrossRef][Green Version]
- Caranta, C.; Pflieger, S.; Lefebvre, V.; Daubèze, A.M.; Thabuis, A.; Palloix, A. QTLs Involved in the Restriction of Cucumber Mosaic Virus (CMV) Long-Distance Movement in Pepper. Theor. Appl. Genet. 2002, 104, 586–591. [Google Scholar] [CrossRef]
- Suzuki, K.; Kuroda, T.; Miura, Y.; Murai, J. Screening and Field Trials of Virus Resistant Sources in Capsicum spp. Plant Dis. 2003, 87, 779–783. [Google Scholar] [CrossRef]
- Cebolla-Cornejo, J.; Soler, S.; Gomar, B.; Soria, M.D.; Nuez, F. Screening Capsicum Germplasm for Resistance to Tomato Spotted Wilt Virus (TSWV). Ann. Appl. Biol. 2003, 143, 143–152. [Google Scholar] [CrossRef]
- Kim, H.J.; Han, J.H.; Yoo, J.H.; Cho, H.J.; Kim, B.D. Development of a Sequence Characteristic Amplified Region Marker Linked to the L4 Locus Conferring Broad Spectrum Resistance to Tobamoviruses in Pepper Plants. Mol. Cells 2008, 25, 205–210. [Google Scholar] [CrossRef]
- Hoang, N.H.; Yang, H.-B.; Kang, B.-C. Identification and Inheritance of a New Source of Resistance against Tomato Spotted Wilt Virus (TSWV) in Capsicum. Sci. Hortic. 2013, 161, 8–14. [Google Scholar] [CrossRef]
- Choi, S.; Lee, J.-H.; Kang, W.-H.; Kim, J.; Huy, H.N.; Park, S.-W.; Son, E.-H.; Kwon, J.-K.; Kang, B.-C. Identification of Cucumber Mosaic Resistance 2 (Cmr2) That Confers Resistance to a New Cucumber Mosaic Virus Isolate P1 (CMV-P1) in Pepper (Capsicum Spp.). Front. Plant Sci. 2018, 9, 1106. [Google Scholar] [CrossRef]
- Lee, J.; Hong, J.-H.; Do, J.W.; Yoon, J.B. Identification of QTLs for Resistance to Anthracnose to Two Colletotrichum Species in Pepper. J. Crop Sci. Biotechnol. 2010, 13, 227–233. [Google Scholar] [CrossRef]
- Lee, J.; Do, J.W.; Yoon, J.B. Development of STS Markers Linked to the Major QTLs for Resistance to the Pepper Anthracnose Caused by Colletotrichum acutatum and C. Capsici. Hortic. Environ. Biotechnol. 2011, 52, 596–601. [Google Scholar] [CrossRef]
- Yoon, J. Identification of Genetic Resources, Interspecific Hybridization and Inheritance Analysis for Breeding Pepper (Capsicum annuum) Resistant to Anthracnose. Ph.D. Thesis, Seoul National University, Seoul, Republic of Korea, 2003. [Google Scholar]
- Charron, C.; Nicolaï, M.; Gallois, J.; Robaglia, C.; Moury, B.; Palloix, A.; Caranta, C. Natural Variation and Functional Analyses Provide Evidence for Co-evolution between Plant eIF4E and Potyviral VPg. Plant J. 2008, 54, 56–68. [Google Scholar] [CrossRef]
- Tomita, R.; Sekine, K.-T.; Mizumoto, H.; Sakamoto, M.; Murai, J.; Kiba, A.; Hikichi, Y.; Suzuki, K.; Kobayashi, K. Genetic Basis for the Hierarchical Interaction Between Tobamovirus spp. and L Resistance Gene Alleles from Different Pepper Species. Int. Soc. Mol. Plant-Microbe Interact. 2011, 24, 108–117. [Google Scholar] [CrossRef]
IT | Bacterial Spot | Anthracnose | Powdery Mildew | Phytophthora Root Rot | Potyvirus | Species | Origin | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
FA1 | FA2 | FA4 | FA5 | FA6 | FA10 | FA11 | FA12 | FA13 | FA14 | FA18 | |||
231144 | R | R | R | R | R | R | R | R | R | R | R | C. baccatum | United States |
261664 | R | R | R | R | R | R | R | R | R | R | R | C. chacoense | Argentina |
283491 | R | R | R | R | R | R | R | R | R | R | R | C. chacoense | United Kingdom |
283493 | R | R | R | R | R | R | R | R | R | R | R | C. chacoense | Bolivia |
283494 | R | R | R | R | R | R | R | R | R | R | R | C. chacoense | Bolivia |
283495 | R | R | R | R | R | R | R | R | R | R | R | C. chacoense | Bolivia |
283496 | R | R | R | R | R | R | R | R | R | R | R | C. chacoense | Argentina |
283501 | H | R | R | R | H | R | R | H | H | R | R | C. chacoense | Unknown |
231145 | R | R | R | R | R | R | R | R | R | - | R | C. baccatum | Netherlands |
261224 | R | R | R | R | R | R | R | R | R | - | R | C. chinense | Costa Rica |
261663 | R | R | R | R | R | R | R | R | R | R | - | C. chacoense | United Kingdom |
283281 | R | - | R | R | R | R | R | R | R | R | R | C. chacoense | Unknown |
283492 | R | - | R | R | R | R | R | R | R | R | R | C. chacoense | Bolivia |
IT | CMV | Phytophthora Root Rot | Potyvirus | TSWV | Species | Origin | |
---|---|---|---|---|---|---|---|
FA7 | FA13 | FA14 | FA18 | FA19 | |||
229195 | R | R | R | R | R | C. chinense | Hungary |
229196 | R | R | R | R | R | C. chinense | Hungary |
229198 | R | R | R | R | R | C. chinense | Hungary |
235726 | R | R | R | R | R | C. chinense | Peru |
235732 | R | R | R | R | R | C. chinense | United States |
235734 | R | R | R | R | R | C. frutescens | Netherlands |
236421 | R | R | R | R | R | C. annuum | United States |
236726 | R | R | R | R | R | C. chinense | United States |
236736 | R | R | R | R | R | C. baccatum | Peru |
229199 | R | R | R | R | H | C. chinense | Hungary |
Response | Disease Phenotype | Marker Prediction Count No. of Accession | Marker Accuracy % |
---|---|---|---|
True Resistance | 7 | 3 | 42.86 |
False Resistance | - | 706 | - |
True Susceptible | 2371 | 1665 | 70.22 |
False Susceptible | - | 4 | - |
Overall | n = 2378 | n = 2378 | 70.14 |
True Resistance | 11 | 3 | 27.27 |
False Resistance | - | 16 | - |
True Susceptible | 1809 | 1793 | 99.12 |
False Susceptible | - | 8 | - |
Overall | n = 1820 | n = 1820 | 98.68 |
No. | Species | Asia | Europe | North America | South America | Africa | Oceania | Unknown | Total |
---|---|---|---|---|---|---|---|---|---|
1 | C. annuum | 2477 | 1134 | 377 | 127 | 49 | 13 | 353 | 4530 |
2 | C. chinense | 12 | 69 | 58 | 137 | 4 | - | 3 | 283 |
3 | C. baccatum | 23 | 31 | 44 | 162 | 2 | 1 | 15 | 278 |
4 | C. frutescens | 50 | 24 | 76 | 49 | 6 | 1 | 19 | 225 |
5 | C. chacoense | - | 4 | - | 6 | - | - | 1 | 11 |
6 | C. pubescens | 1 | - | - | 2 | - | - | - | 3 |
7 | C. galapagoense | - | - | 1 | - | - | - | - | 1 |
8 | Capsicum sp. | 98 | 72 | 7 | 3 | 4 | - | 143 | 327 |
Total | 2661 | 1334 | 563 | 486 | 65 | 15 | 534 | 5658 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ro, N.; Lee, G.-A.; Ko, H.-C.; Oh, H.; Lee, S.; Haile, M.; Lee, J. Exploring Disease Resistance in Pepper (Capsicum spp.) Germplasm Collection Using Fluidigm SNP Genotyping. Plants 2024, 13, 1344. https://doi.org/10.3390/plants13101344
Ro N, Lee G-A, Ko H-C, Oh H, Lee S, Haile M, Lee J. Exploring Disease Resistance in Pepper (Capsicum spp.) Germplasm Collection Using Fluidigm SNP Genotyping. Plants. 2024; 13(10):1344. https://doi.org/10.3390/plants13101344
Chicago/Turabian StyleRo, Nayoung, Gi-An Lee, Ho-Cheol Ko, Hyeonseok Oh, Sukyeung Lee, Mesfin Haile, and Jundae Lee. 2024. "Exploring Disease Resistance in Pepper (Capsicum spp.) Germplasm Collection Using Fluidigm SNP Genotyping" Plants 13, no. 10: 1344. https://doi.org/10.3390/plants13101344
APA StyleRo, N., Lee, G.-A., Ko, H.-C., Oh, H., Lee, S., Haile, M., & Lee, J. (2024). Exploring Disease Resistance in Pepper (Capsicum spp.) Germplasm Collection Using Fluidigm SNP Genotyping. Plants, 13(10), 1344. https://doi.org/10.3390/plants13101344