Two Newly Identified Colletotrichum Species Associated with Mango Anthracnose in Central Thailand
Abstract
1. Introduction
2. Results
2.1. Fungal Isolates
2.2. Morphology-Based Identification
2.3. DNA Marker-Based Identification
2.4. Pathogenicity Test
3. Discussion
4. Materials and Methods
4.1. Fungal Isolation
4.2. Morphological Characteristics
4.3. DNA Extraction and Molecular Identification
4.4. Phylogenetic Analyses
4.5. Pathogenicity Test
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- The Top Mango Producing Countries in the World. Available online: https://www.worldatlas.com/articles/the-top-mango-producing-countries-in-the-world.html (accessed on 15 November 2022).
- Walker, J.; Nikandrow, A.; Millar, G. Species of Colletotrichum on Xanthium (asteraceae) with comments on some taxonomic and nomenclatural problems in Colletotrichum. Mycol. Res. 1991, 95, 1175–1193. [Google Scholar] [CrossRef] [Scilit]
- Đinh, Q.; Sangchote, S. Infection of Colletotrichum gloeosporioides on mango fruit and its resistance. Thai J. Agric. Sci. 2002, 33, 68–70. [Google Scholar]
- Ploetz, R.; Freeman, S. Foliar, floral and soilborne diseases. In The Mango, 2nd ed.; Botany, Production and Uses, CABI International: Wallingford, UK, 2009; pp. 231–302. [Google Scholar]
- Ploetz, R.C. Diseases of mango. In Diseases of Tropical Fruit Crops; Ploetz, R.C., Ed.; CAB International: Wallingford, UK, 2003; pp. 327–363. [Google Scholar]
- Nelson, S.C. Mango Anthracnose (Colletotrichum Gloeosporioides); University of Hawaii: Honolulu, HI, USA, 2008. [Google Scholar]
- Phoulivong, S.; Cai, L.; Chen, H.; McKenzie, E.H.C.; Abdelsalam, K.; Chukeatirote, E.; Hyde, K.D. Colletotrichum gloeosporioides is not a common pathogen on tropical fruits. Fungal Divers. 2010, 44, 33–43. [Google Scholar] [CrossRef] [Scilit]
- Pongpisutta, R.; Rattanakreetakul, C.; Bunjoedchoedchoo, R. Non-chemical fungicide treatments for anthracnose control in mango fruits cv. Nam Dork Mai See Tong. Agric. Sci. J. 2012, 43, 464–467. [Google Scholar]
- Lima, N.B.; Batista, M.V.D.A.; De Morais, M.A.; Barbosa, M.A.G.; Michereff, S.J.; Hyde, K.D.; Câmara, M.P.S. Five Colletotrichum species are responsible for mango anthracnose in northeastern Brazil. Fungal Divers. 2013, 61, 75–88. [Google Scholar] [CrossRef] [Scilit]
- Bincader, S.; Pongpisutta, R.; Rattanakreetakul, C. Diversity of Colletotrichum Species causing Anthracnose Disease from Mango cv. Nam Dork Mai See Tong based on ISSR-PCR. Indian J. Agric. Res. 2022, 56, 81–89. [Google Scholar] [CrossRef] [Scilit]
- Krishnapillai, N.; Wijeratnam, R.W. First Report of Colletotrichum asianum causing anthracnose on Willard mangoes in Sri Lanka. New Dis. Rep. 2014, 29, 1. [Google Scholar] [CrossRef] [Scilit]
- Tovar-Pedraza, J.M.; Mora-Aguilera, J.A.; Nava-Díaz, C.; Lima, N.B.; Michereff, S.J.; Sandoval-Islas, J.S.; Câmara, M.P.S.; Téliz-Ortiz, D.; Leyva-Mir, S.G. Distribution and Pathogenicity of Colletotrichum Species Associated With Mango Anthracnose in Mexico. Plant Dis. 2020, 104, 137–146. [Google Scholar] [CrossRef] [Scilit]
- Lima, N.B.; Lima, W.G.; Tovar-Pedraza, J.M.; Michereff, S.J.; Câmara, M.P. Comparative epidemiology of Colletotrichum species from mango in northeastern Brazil. Eur. J. Plant Pathol. 2014, 141, 679–688. [Google Scholar] [CrossRef] [Scilit]
- Cannon, P.F.; Damm, U.; Johnston, P.R.; Weir, B.S. Colletotrichum—Current status and future directions. Stud. Mycol. 2012, 73, 181–213. [Google Scholar] [CrossRef] [Scilit]
- Hassan, A.H.; Bebawy, A.S.; Saad, M.T.; Mosaad, G.S.; Saad, B.T.; Eltayeb, W.N.; Aboshanab, K.M. Metagenomic nanopore sequencing versus conventional diagnosis for identification of the dieback pathogens of mango trees. Biotechniques 2022, 73, 261–272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Savant, N.; Raut, S. Studies on Symptomatology of Die-Back of Mango Stone Grafts. Acta Hortic. 2000, 509, 823–832. [Google Scholar] [CrossRef] [Scilit]
- Mo, J.; Zhao, G.; Li, Q.; Solangi, G.S.; Tang, L.; Guo, T.; Huang, S.; Hsiang, T. Identification and Characterization of Colletotrichum Species Associated with Mango Anthracnose in Guangxi, China. Plant Dis. 2018, 102, 1283–1289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, C.-J.; Chen, H.-K.; Ni, H.-F. Identification and characterization of Colletotrichum species associated with mango anthracnose in Taiwan. Eur. J. Plant Pathol. 2020, 157, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Giblin, F.R.; Tan, Y.P.; Mitchell, R.; Coates, L.M.; Irwin, J.A.G.; Shivas, R.G. Colletotrichum species associated with pre-and post-harvest diseases of avocado and mango in eastern Australia. Australas. Plant Pathol. 2018, 47, 269–276. [Google Scholar] [CrossRef] [Scilit]
- Benatar, G.V.; Wibowo, A. Suryanti First report of Colletotrichum asianum associated with mango fruit anthracnose in Indonesia. Crop. Prot. 2020, 141, 105432. [Google Scholar] [CrossRef] [Scilit]
- Prusky, D.; Alkan, N.; Miyara, I.; Barad, S.; Davidzon, M.; Kobiler, I.; Braun Miara, S.; Lichter, A.; Sherman, A.; Fluhr, R. Mechanisms modulating postharvest pathogen colonization of decaying fruits. In Postharvest Pathology. Plant Pathology in the 21st Century; Prusky, D., Gullino, M., Eds.; Springer: Dordrecht, The Netherlands, 2009; Volume 2, pp. 43–55. [Google Scholar]
- Prakash, O. Diseases and disorders of mango and their management. In Diseases of Fruits and Vegetables; Naqvi, S.A.M.H., Ed.; Springer: Dordrecht, The Netherlands, 2007; Volume 1, pp. 511–619. [Google Scholar]
- Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Crous, P.W. The Colletotrichum acutatum species complex. Stud. Mycol. 2012, 73, 37–113. [Google Scholar] [CrossRef] [Scilit]
- Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Johnston, P.R.; Weir, B.S.; Tan, Y.P.; Shivas, R.G.; Crous, P.W. The Colletotrichum boninense species complex. Stud. Mycol. 2012, 59, 75–88. [Google Scholar] [CrossRef] [Scilit]
- De Silva, D.D.; Ades, P.K.; Crous, P.W.; Taylor, P.W.J. Colletotrichum species associated with chili anthracnose in Australia. Plant Pathol. 2016, 66, 254–267. [Google Scholar] [CrossRef] [Scilit]
- Hyde, K.D.; Cai, L.; McKenzie, E.H.C.; Yang, Y.L.; Zhang, J.Z.; Prihastuti, H. Colletotrichum: A catalogue of confusion. Fungal Divers. 2009, 39, 1–17. [Google Scholar]
- Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hyde, K.D.; Cai, L.; Cannon, P.F.; Crouch, J.A.; Crous, P.W.; Damm, U.; Goodwin, P.H.; Chen, H.; Johnston, P.R.; Jones, E.B.G.; et al. Colletotrichum—Names in current use. Fungal Divers. 2009, 39, 147–182. [Google Scholar]
- Ramos, A.P.; Talhinhas, P.; Sreenivasaprasad, S.; Oliveira, H. Characterization of Colletotrichum gloeosporioides, as the main causal agent of citrus anthracnose, and C. karstii as species preferentially associated with lemon twig dieback in Portugal. Phytoparasitica 2016, 44, 549–561. [Google Scholar] [CrossRef] [Scilit]
- Udayanga, D.; Manamgoda, D.S.; Liu, X.; Chukeatirote, E.; Hyde, K.D. What are the common anthracnose pathogens of tropical fruits? Fungal Divers. 2013, 61, 165–179. [Google Scholar] [CrossRef] [Scilit]
- Alkemade, J.A.; Messmer, M.M.; Voegele, R.T.; Finckh, M.R.; Hohmann, P. Genetic diversity of Colletotrichum lupini and its virulence on white and Andean lupin. Sci. Rep. 2021, 11, 13547. [Google Scholar] [CrossRef] [Scilit]
- Plant Pathology Research Group. Host Index of Plant Diseases; Plant Portection Research and Development Office, Department of Agriculture: Bangkok, Thailand, 2014. [Google Scholar]
- Li, Q.; Bu, J.; Shu, J.; Yu, Z.; Tang, L.; Huang, S.; Guo, T.; Mo, J.; Luo, S.; Solangi, G.S.; et al. Colletotrichum species associated with mango in southern China. Sci. Rep. 2019, 9, 18891. [Google Scholar] [CrossRef] [Scilit]
- Vieira, W.A.S.; Michereff, S.J.; de Morais, M.A., Jr.; Hyde, K.D.; Câmara, M.P.S. Endophytic species of Colletotrichum associated with mango in northeastern Brazil. Fungal Divers. 2014, 67, 181–202. [Google Scholar] [CrossRef] [Scilit]
- Zakaria, L.; Juhari, N.Z.; Vijaya, S.I.; Anuar, I.S.M. Molecular Characterization of Colletotrichum Isolates Associated with Anthracnose of Mango Fruit. Sains Malays. 2015, 44, 651–656. [Google Scholar] [CrossRef] [Scilit]
- Qin, L.P.; Huang, S.L.; Lin, S.H.; Lin, C.H. First report of anthracnose of Mangifera indica caused by Colletotrichum siamense in Sanya city in China. Plant Dis. 2017, 101, 1038. [Google Scholar] [CrossRef] [Scilit]
- Prihastuti, H.; McKenzie, E.; Hyde, K.D.; Cai, L.; McKenzi, E.H.C.; Hyde, E. Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Divers. 2009, 39, 89–109. [Google Scholar]
- James, R.S.; Ray, J.; Tan, Y.P.; Shivas, R.G. Colletotrichum siamense, C. theobromicola and C. queenslandicum from several plant species and the identification of C. asianum in the Northern Territory, Australia. Australas. Plant Dis. Notes 2014, 9, 138. [Google Scholar] [CrossRef] [Scilit]
- Vieira, W.A.S.; Lima, W.G.; Nascimento, E.S.; Michereff, S.J.; Câmara, M.P.S.; Doyle, V.P. The impact of phenotypic and molecular data on the inference of Colletotrichum diversity associated with Musa. Mycologia 2017, 109, 912–934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uysal, A.; Kurt, Ş. First report of fruit and leaf anthracnose caused by Colletotrichum karstii on avocado in Turkey. Crop. Prot. 2020, 133, 105145. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; Damm, U.; Crous, P.W.; Groenewald, J.Z.; Niu, X.L.; Lin, J.; Li, Y. Anthracnose Disease of Carpetgrass (Axonopus compressus) Caused by Colletotrichum hainanense sp. nov. Plant Dis. 2020, 104, 1744–1750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abirami, K.; Sakthivel, K.; Sheoran, N.; Baskaran, V.; Gautam, R.K.; Jerard, B.A.; Kumar, A. Occurrence of Anthracnose Disease Caused by Colletotrichum siamense on Dragon Fruit (Hylocereus undatus) in Andaman Islands, India. Plant Dis. 2019, 103, 768. [Google Scholar] [CrossRef] [Scilit]
- Zhao, H.J.; Chen, S.C.; Chen, Y.F.; Zou, C.C.; Wang, X.L.; Wang, Z.H.; Liu, A.R.; Ahammed, G.J. First Report of Red Dragon Fruit (Hylocereus polyrhizus) Anthracnose Caused by Colletotrichum siamense in China. Plant Dis. 2018, 102, 1175. [Google Scholar] [CrossRef] [Scilit]
- Sharma, G.; Pinnaka, A.K.; Shenoy, B.D. Resolving the Colletotrichum siamense species complex using ApMat marker. Fungal Divers. 2014, 71, 247–264. [Google Scholar] [CrossRef] [Scilit]
- Sharma, G.; Maymon, M.; Freeman, S. Epidemiology, pathology and identification of Colletotrichum including a novel species associated with avocado (Persea americana) anthracnose in Israel. Sci. Rep. 2017, 7, 15839. [Google Scholar] [CrossRef] [Scilit]
- Soares, M.G.O.; Alves, E.; Silveira, A.L.; Pereira, F.D.; Guimarães, S.S.C. Colletotrichum siamense is the main aetiological agent of anthracnose of avocado in south-eastern Brazil. Plant Pathol. 2020, 70, 154–166. [Google Scholar] [CrossRef] [Scilit]
- Johnston, P.R.; Jones, D. Relationships among Colletotrichum isolates from fruit-rots assessed using rDNA sequences. Mycologia 1997, 89, 420–430. [Google Scholar] [CrossRef] [Scilit]
- Pongpisutta, R.; Winyarat, W.; Rattanakreetakul, C. Rflp Identification of Colletotrichum Species Isolated from Chilli in Thailand. Acta Hortic. 2013, 973, 181–186. [Google Scholar] [CrossRef] [Scilit]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef] [Scilit]
- O’Donnell, K.; Cigelnik, E. Two Divergent Intragenomic rDNA ITS2 Types within a Monophyletic Lineage of the FungusFusariumAre Nonorthologous. Mol. Phylogenetics Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice across a Large Model Space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Scilit]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Scilit]
- Drummond, A.J.; Rambaut, A. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 2007, 7, 214. [Google Scholar] [CrossRef] [Scilit]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2019; Available online: https://www.R-project.org/ (accessed on 10 October 2022).
- Agricolae: Statistical Procedures for Agricultural Research, R Package Version 1.4.0. Available online: https://myaseen208.github.io/agricolae/https://cran.r-project.org/package=agricolae (accessed on 10 October 2022).






| Location of Origin | Geographic Coordinates 1 | Isolate Code | Source |
|---|---|---|---|
| Plaeng Yao 1, Chachoengsao | 13°36′28.6″ N 101°17′53.5″ E | CS001 | Fruit |
| CS002 | Fruit | ||
| CS003 | Fruit | ||
| Plaeng Yao 2, Chachoengsao | 13°36′42.2″ N 101°17′41.6″ E | CS004 | Fruit |
| CS005 | Leaf | ||
| CS006 | Leaf | ||
| CS007 | Inflorescence | ||
| Plaeng Yao 2, Chachoengsao | 13°36′50.2″ N 101°17′24.8″ E | CS008 | Fruit |
| CS009 | Fruit | ||
| CS010 | Leaf | ||
| Sak Lek 1, Phichit | 16°28′20.9″ N 100°33′42.4″ E | PC001 | Fruit |
| PC002 | Fruit | ||
| PC003 | Fruit | ||
| PC004 | Leaf | ||
| PC005 | Fruit | ||
| PC006 | Leaf | ||
| PC007 | Fruit | ||
| Sak Lek 2, Phichit | 16°28′41.7″ N 100°33′52.4″ E | PC008 | Leaf |
| PC009 | Fruit | ||
| PC010 | Leaf | ||
| PC011 | Leaf | ||
| PC012 | Leaf | ||
| Mueang Ratchaburi, Ratchaburi | 13°35′50.0″ N 99°49′57.1″ E | RB001 | Fruit |
| RB002 | Leaf | ||
| Paktho, Ratchaburi | 13°24′47.5″ N 99°45′32.9″ E | RB003 | Fruit |
| RB004 | Inflorescence | ||
| RB005 | Fruit | ||
| RB006 | Fruit | ||
| RB007 | Fruit | ||
| RB008 | Fruit | ||
| RB009 | Fruit | ||
| RB010 | Fruit | ||
| RB011 | Fruit | ||
| RB012 | Fruit | ||
| Bang Phae, Ratchaburi | 13°39′50.5″ N 99°57′54.4″ E | RB013 | Fruit |
| RB014 | Fruit | ||
| RB015 | Fruit |
| Isolate Code | Taxon | Lesion Diameter (cm) * | |
|---|---|---|---|
| Fruit | Leaves | ||
| CS001 | C. gloeosporioides | 9.30a | 0.33gh |
| CS002 | C. gloeosporioides | 9.07ab | 0.58c–h |
| CS003 | C. gloeosporioides | 7.97e–j | 0.45d–h |
| CS004 | C. gloeosporioides | 9.00abc | 0.75b–h |
| CS005 | C. gloeosporioides | 8.62b–e | 1.12bc |
| CS006 | C. gloeosporioides | 7.85f–k | 1.03b–e |
| CS007 | C. gloeosporioides | 8.53b–f | 0.65b–h |
| CS008 | C. gloeosporioides | 8.32c–h | 0.80b–h |
| CS009 | C. gloeosporioides | 8.50b–f | 0.43e–h |
| CS010 | C. gloeosporioides | 8.38b–g | 0.48c–h |
| PC001 | C. asianum | 8.52b–f | 0.60c–h |
| PC002 | C. siamense | 8.72a–d | 0.58c–h |
| PC003 | C. asianum | 8.67a–e | 0.82b–h |
| PC004 | C. asianum | 8.48b–f | 1.10bcd |
| PC005 | C. asianum | 8.73a–d | 0.93b–g |
| PC006 | C. acutatum | 6.88m | 0.32gh |
| PC007 | C. acutatum | 8.38b–g | 0.25h |
| PC008 | C. gloeosporioides | 7.47i–m | 0.82b–h |
| PC009 | C. gloeosporioides | 7.53i–m | 0.93b–g |
| PC010 | C. gloeosporioides | 7.18klm | 0.35fgh |
| PC011 | C. acutatum | 8.03d–i | 0.45d–h |
| PC012 | C. acutatum | 7.48i–m | 0.40e–h |
| RB001 | C. asianum | 7.67h–l | 0.37fgh |
| RB002 | C. gloeosporioides | 7.48i–m | 0.72b–h |
| RB003 | C. siamense | 7.48i–m | 0.68b–h |
| RB004 | C. gloeosporioides | 7.63h–l | 0.67b–h |
| RB005 | C. asianum | 7.65h–l | 0.82b–h |
| RB006 | C. siamense | 7.23klm | 2.48a |
| RB007 | C. asianum | 7.50i–m | 0.93b–g |
| RB008 | C. gloeosporioides | 7.73g–l | 0.73b–h |
| RB009 | C. gloeosporioides | 8.40b–g | 0.88b–h |
| RB010 | C. asianum | 8.13d–i | 1.28b |
| RB011 | C. asianum | 7.88f–k | 1.28b |
| RB012 | C. asianum | 8.32c–h | 1.03b–e |
| RB013 | C. gloeosporioides | 7.28j–m | 0.80b–h |
| RB014 | C. acutatum | 7.27j–m | 0.50c–h |
| RB015 | C. gloeosporioides | 7.08lm | 1.00b–f |
| Gene | Primer | Sequence (5′-3′) | Annealing Temperature (°C) | References |
|---|---|---|---|---|
| Actin | ACT-512F | ATGTGCAAGGCCGGTTTCGC | 58 | [49] |
| ACT-783R | TACGAGTCCTTCTGGCCCAT | |||
| β-tubulin | T1 | AACATGCGTGAGATTGTAAGT | 55 | [50] |
| T2 | TAGTGACCCTTGGCCCAGTTG | |||
| Chitin synthase 1 | CHS-79F | TGGGGCAAGGATGCTTGGAAGAAG | 58 | [49] |
| CHS-345R | TGGAAGAACCATCTGTGAGAGTTG | |||
| ITS region | ITS5 | GGAAGTAAAAGTCGTAACAAGG | 56 | [51] |
| ITS4 | TCCTCCGCTTATTGATATGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rattanakreetakul, C.; Keawmanee, P.; Bincader, S.; Mongkolporn, O.; Phuntumart, V.; Chiba, S.; Pongpisutta, R. Two Newly Identified Colletotrichum Species Associated with Mango Anthracnose in Central Thailand. Plants 2023, 12, 1130. https://doi.org/10.3390/plants12051130
Rattanakreetakul C, Keawmanee P, Bincader S, Mongkolporn O, Phuntumart V, Chiba S, Pongpisutta R. Two Newly Identified Colletotrichum Species Associated with Mango Anthracnose in Central Thailand. Plants. 2023; 12(5):1130. https://doi.org/10.3390/plants12051130
Chicago/Turabian StyleRattanakreetakul, Chainarong, Pisut Keawmanee, Santiti Bincader, Orarat Mongkolporn, Vipaporn Phuntumart, Sotaro Chiba, and Ratiya Pongpisutta. 2023. "Two Newly Identified Colletotrichum Species Associated with Mango Anthracnose in Central Thailand" Plants 12, no. 5: 1130. https://doi.org/10.3390/plants12051130
APA StyleRattanakreetakul, C., Keawmanee, P., Bincader, S., Mongkolporn, O., Phuntumart, V., Chiba, S., & Pongpisutta, R. (2023). Two Newly Identified Colletotrichum Species Associated with Mango Anthracnose in Central Thailand. Plants, 12(5), 1130. https://doi.org/10.3390/plants12051130

