Next Article in Journal
Polyphenol and Tryptophan Contents of Purple Corn (Zea mays L.) Variety KND and Butterfly Pea (Clitoria ternatea) Aqueous Extracts: Insights into Phytochemical Profiles with Antioxidant Activities and PCA Analysis
Previous Article in Journal
Influence of Foliar Application of Hydrogen Peroxide on Gas Exchange, Photochemical Efficiency, and Growth of Soursop under Salt Stress
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Chromosomal Location of xa19, a Broad-Spectrum Rice Bacterial Blight Resistant Gene from XM5, a Mutant Line from IR24

by
Satoru Taura
1,2 and
Katsuyuki Ichitani
2,3,*
1
Institute of Gene Research, Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan
2
The United Graduate School of Agricultural Sciences, Kagoshima University, Kagoshima 890-0065, Japan
3
Faculty of Agriculture, Kagoshima University, Kagoshima 890-0065, Japan
*
Author to whom correspondence should be addressed.
Plants 2023, 12(3), 602; https://doi.org/10.3390/plants12030602
Submission received: 26 December 2022 / Revised: 22 January 2023 / Accepted: 27 January 2023 / Published: 29 January 2023
(This article belongs to the Section Plant Molecular Biology)

Abstract

Bacterial blight is an important rice disease caused by bacteria named Xanthomonas oryzae pv. oryzae (Xoo). XM5 is an Xoo resistant mutant line with the genetic background of IR24, an Indica Xoo susceptible cultivar, induced by a chemical mutagen N-methyl-N-nitrosourea (MNU). XM5 carries a recessive Xoo resistant gene, xa19. Trisomic analysis was conducted using the cross between XM5 and the trisomic series under the genetic background of IR24, showing that xa19 was located on chromosome 7. The approximate chromosomal location was found using 37 surely resistant plants in the F2 population from XM5 × Kinmaze, which was susceptible to most Japanese Xoo races. The IAS44 line carries a Japonica cultivar Asominori chromosomal segment covering the xa19 locus under the IR24 genetic background. Linkage analysis using the F2 population from the cross between XM5 and IAS44 revealed that xa19 was located within the 0.8 cM region between RM8262 and RM6728. xa19 is not allelic to the known Xoo resistant genes. However, its location suggests that it might be allelic to a lesion-mimic mutant gene spl5, some alleles of which are resistant to several Xoo races. Together with xa20 and xa42, three Xoo resistant genes were induced from IR24 by MNU. The significance of chemical mutagen as a source of Xoo resistance was discussed.

1. Introduction

Rice (Oryza sativa L.), an extremely important crop worldwide, is also a model plant of monocots. Its genome was sequenced in 2005. In fact, rice was the first crop to be sequenced [1]. The rice genome has been an anchor for other grass species genomes based on their synteny relation [2,3]. Bacterial blight is an important rice disease caused by bacteria named Xanthomonas oryzae pv. oryzae (Xoo), ranked fourth among pathogenic bacteria in molecular plant pathology [4]. According to a comprehensive review [5], it is a Gram-negative and non-spore-forming bacteria, motile by a single polar flagellum. After it invades leaves through water pores or wounds, it spreads rapidly through the vascular system to the tissues around the infected site. Consequently, the bacterial blight symptoms appear. The Xoo genome has also been sequenced [6,7,8]. After these pioneering works, more than one hundred Xoo genomes were sequenced with the assistance of next-generation sequencers [9,10]. The two genomes have opened the door for greater molecular understanding of the classical gene for gene theory [11]. A recent review by Jiang et al. summarized the 11 pairs of cloned rice resistance genes against Xoo and the cognate Xoo avirulence genes [12].
Jiang et al. reported more than 40 bacterial blight resistant genes [12]. According to the Oryzabase gene list (https://shigen.nig.ac.jp/rice/oryzabase/locale/change?lang=en (accessed on 26 December 2022)), XA1 (XANTHOMONAS ORYZAE PV. ORYZAE RESISTANCE 1) to XA44 are listed. Furthermore, according to our survey, xa-45(t) [13], and Xa46(t) [14] were recently reported. We induced mutation to IR24 using a chemical mutagen N-methyl-N-nitrosourea (MNU), and developed three Xoo resistant mutant lines, XM5, XM6 and XM14 [15,16,17,18,19,20]. Although IR24 is susceptible to almost all Xoo strains, the three XM lines are resistant to all Xoo races tested [16,17,18,20]. XM6 carries one recessive mutant Xoo resistant gene xa20 located on the long arm of chromosome 3 [17,20]. XM14 carries another mutant Xoo resistant gene xa42 located on the short arm of chromosome 3 [18,19]. Their locations are not overlapping with the Xoo resistant genes reported earlier. Understanding mutations and their applications have paved the way for advances in the elucidation of the genetic, physiological and biochemical bases of rice traits [21]. Creating variation through mutation has therefore grown to be among the most important tools available to improve rice [21]. In this context, the mutation for Xoo resistance from a susceptible cultivar IR24, as well as development of near-isogenic lines [22], might be a basis for the genetic study of resistance against Xoo and new sources for breeding rice cultivars that are resistant against Xoo. Actually, XM5 is resistant to all the six Philippines Xoo races. It carries a mutant Xoo resistant gene xa19 [16], of which mapping on the rice genome has not been undertaken.
Rice cultivars are classified into two varietal groups, Indica and Japonica [23]. This classification has been made according to morphological and physiological characters [24,25]. This classification corresponded to that by DNA sequences: Much DNA polymorphism was detected between Japonica and Indica cultivars, which contributed to DNA marker-based linkage analysis of many Xoo resistance genes including xa20 and xa42 in our group [18,19,20,26,27,28,29].
As reported from earlier studies [18,20], the F2 plants from the cross between Indica and Japonica cultivars carry a diverse genetic background showing many intermediate types of Xoo reaction. This phenomenon is partially explained by the QTLs affecting the degree of resistance [27,28,29]. Furthermore, the large variation in agronomic traits, such as the tiller number and plant height caused by the Indica–Japonica genetic difference, might increase the variation in lesion length [18]. To minimize such genetic noise, the Xoo resistance should be evaluated under the uniform genetic background. IAS lines, chromosomal segment substitution lines with a Japanese Japonica cultivar Asominori chromosomal segments under the IR24 genetic background [30], were adopted for precise linkage analysis of xa20 and xa42.
This report describes the reaction of XM5 to Japanese Xoo races and the chromosomal location of xa19, using the combination of trisomic analysis, rough linkage analysis using the DNA polymorphism between Indica and Japonica, and precise linkage analysis using IAS lines.

2. Materials and Methods

2.1. Bacterial Races and Plant Materials

The Xoo bacterial races used for this study were five Japanese races: race I (strain T7174), race II (strain T7147), race III (strain T7133), race IV (strain H75373) and race V (strain H75304) and three Philippines races: race 1 (strain PXO 61), race 2 (strain PXO 86), and race 6 (strain PXO 99).
The International Rice Research Institute (IRRI) developed IR24, an Indica cultivar from the Philippines. It is susceptible to the above five Japanese races and six Philippine races: race 1, race 2, race 3 (strain PXO 79), race 4 (strain PXO 71), race 5 (strain PXO 112), and race 6 ([15,16,17,18,20] and Section 3). XM5 is a mutant line derived from IR24, induced by MNU. It is resistant to the six Philippines Xoo races above [15,16].
Khush et al. developed 12 primary trisomics of rice with an Indica cultivar IR36 genetic background [31]. However, IR36 carries a Xoo resistant gene, Xa4, which is not suitable for the genetic analysis of Xoo resistance. Therefore, trisomic series of IR24 were developed by backcrossing IR24 as the recurrent parent to original IR36 trisomic series [32]. In the present study, to ascertain the critical chromosome of xa19, trisomic analysis using the above trisomics with IR24 background was conducted. Six types of trisomics having IR24 background, Triplo 1, Triplo 6, Triplo7, Triplo 9, Triplo 10 and Triplo 11, were used. The digit after Triplo represents the extra chromosome number that each Triplo line carries [33]. These trisomics were susceptible to the six Philippine Xoo races. F2 populations from trisomic F1 plants derived from the crosses between six types of trisomics and XM5 were tested for the reaction against Xoo inoculation.
Kinmaze is a Japanese cultivar. Our preliminary DNA marker-based analysis suggests that it belongs to temperate Japonica. Kinmaze proved to be susceptible to Japanese Xoo races I, II and III [34]. Because the trisomic analysis suggested that xa19 was located on chromosome 7 (see Section 3), the F2 population from the cross between Kinmaze and XM5 was subjected to rough linkage analysis of xa19 with DNA markers on chromosome 7.
The IAS lines [30] were adopted for precise linkage analysis of xa19. The graphical genotypes of IAS lines are obtainable at http://www.shigen.nig.ac.jp/rice/oryzabase/strain/recombinant/genotypeIAS (accessed on 26 December 2022). Among them, IAS44 carries the Asominori chromosomal segment of chromosome 7, on which the initial linkage analysis (see Section 3) mapped the xa19 locus, under the IR24 genetic background. Asominori is resistant to Japanese Xoo races I and V, although it is susceptible to races II, III and IV [35]. Our preliminary experiment demonstrated that IAS44 was susceptible to the five Japanese Xoo races above. The F2 population from the cross between IAS44 and XM5 was subjected to precise linkage analysis of xa19.
XM5, IR24, IAS44, and Kinmaze were tested for their reactions to the five Japanese Xoo races. They had been tested separately before and were tested under the same condition. Three plants from each line were inoculated with each Xoo race.

2.2. Genetic Analysis of xa19

To determine the critical chromosome of xa19, the trisomics above were crossed with XM5 as a pollen donor. The F1 plants were planted in the screenhouse in IRRI; trisomic F1 plants were selected using morphological characteristics. Trisomic F1 plants from the cross of Triplo 11 were identified by microscopic observations of pollen mother cells at the metaphase of meiotic division. Before transplanting the F2 populations, the F2 seedlings were separated roughly into trisomics and disomics by visual observation, and were transplanted separately in the screenhouse. They were tested for reaction to the Philippine Xoo races 1, 2 and 6 simultaneously, and were classified as either trisomics or disomics using the same method as that described for trisomic F1 plant selection. Before inoculation, tillers of the respective plants were divided into three with different colored vinyl ties: one color for each Xoo race. The strategy of ascertaining the critical chromosome followed an explanation by Okumoto and Tanisaka [36]: If XAxa19 locus is located on the disomic chromosome, then the F2 segregation ratio of resistant type (xa19xa19): susceptible type (2Xa19xa19:1Xa19Xa19) is to be 1:3. However, when xa19 locus is located on the trisomic chromosome, the genotype of trisomic F1 plant is XA19XA19xa19. The trisomic F1 plant produces male and female gametes in the ratio of 2Xa19:1xa19:1Xa19Xa19:2Xa19xa19. However, most of the male gametes with an extra chromosome cannot take part in fertilization because of their weak viability. Consequently, for disomic plants, the ratio of 1 [resistant type (xa19xa19)]:8 [susceptible type (Xa19xa19, Xa19Xa19)] is expected. Regarding trisomic plants, segregation ratios of two kinds are expected: one is 1 [resistant type (xa19xa19xa19)]:44 [susceptible type (Xa19Xa19Xa19, Xa19Xa19xa19, Xa19xa19xa19)] by chromatid segregation. The other is 1:35 by maximum equational segregation. Iwata (1997) presented a relevant review about the rationale of trisomic analysis and two types of trisomic chromosome segregation, chromatid segregation and maximum equational segregation [37]. Therefore, when xa19 locus is located on the extra chromosome, the ratio of resistant plants is far smaller than 0.25. The goodness of fit of the observed segregation ratio to the expected ratio was examined by chi-square test.
In the F2 populations from the cross between Kinmaze and XM5, 299 F2 plants were inoculated with Japanese Xoo race III (strain T7133). Then 37 plants selected as surely resistant judged by visual observation were genotyped for DNA markers located on chromosome 7 (Table 1) [1,38,39,40,41].
In all, 210 F2 plants from the cross between IAS44 and XM5 were subjected to precise linkage analysis of xa19 using DNA markers. They were inoculated with Japanese Xoo race II (strain T7147). A linkage map around xa19 was constructed using Antmap [42]. The Kosambi’s function was adopted to calculate the map distance.

2.3. Evaluation of Xoo Resistance

The trisomic analysis of xa19 was conducted in IRRI, Los Baños, Philippines. Experiments were conducted in a greenhouse and in a screenhouse. The greenhouse, overlaid with transparent glass, was used for nursing. The screenhouse is a plastic greenhouse in which concrete beds with paddy field soil were located. Both facilities were screened with fine net to prevent insect invasion. F2 seeds were sown in wooden seed boxes (52 × 47 × 10 cm). Three-week-old seedlings were transplanted in the concrete bed with plant spacing of 20 × 20 cm in a screenhouse.
The genetic analysis using the F2 populations from the cross between Kinmaze and XM5, and that between IAS44 and XM5 was conducted at the Experimental Farm of the Faculty of Agriculture, Kagoshima University, Kagoshima, Japan, following a process described by [19].

2.4. Inoculation of Xoo

Preparation of Xoo for inoculation followed a process described by [20]. Briefly, Xoo stocks had been stored in skim milk medium at −80 °C. Potato semi-synthetic agar medium [43] was used for culture and inoculum preparation. The inoculum was diluted with distilled water. The absorbance was adjusted to A = 0.05 (620 nm) using a spectrophotometer, which corresponds to concentration of about 108 colony-forming units per milliliter.
The plants were inoculated using clipping method [44] when the most plants reached the booting stage. The reaction of the plants to Xoo was evaluated 18 days after inoculation, based on the lesion length and symptoms of the lesion. The progeny of the cross between XM5 and trisomics and that between XM5 and Kinmaze were scored as resistant (R) and susceptible (S), as judged from the combination of lesion length and symptoms of the lesion by visual observation. The progeny of the cross between XM5 and IAS44 were evaluated by measuring the lesion lengths of three leaves.

2.5. Molecular Techniques

Molecular techniques followed [18]. Briefly, DNA was extracted following [45] with some modifications. The PCR-mixture (5 μL) contained 10 ng of genomic DNA, 200 μM dNTPs, 0.2 μM of each primer, 0.25 U of Taq polymerase and 1× buffer containing MgCl2. PCR products were analyzed using electrophoresis in 10% (29:1) polyacrylamide gel, followed by ethidium bromide staining and ultraviolet light irradiation.

3. Results

3.1. The Reaction of XM5 to Japanese Xoo Races

XM5, IR24, Kinmaze and IAS44 (three plants per accession) were subjected to inoculation with five Japanese Xoo races. Table 2 shows that XM5 was resistant to all races tested, whereas IR24, Kinmaze and IAS44 were susceptible to all races tested.

3.2. Trisomic Analysis of xa19

F2 populations from trisomic F1 plants derived from the crosses between six types of trisomics and XM5 were tested for Xoo resistance (Table 3). Plants were insufficient for segregation analysis in some F2 populations. F2 populations from trisomic F1 plants obtained by crossing XM5 with Triplo 1, Triplo 9, Triplo 10, and Triplo 11 showed disomic segregation with a ratio of 1 resistant: 3 susceptible. The trisomic fraction of the F2 population from trisomic F1 plants derived from the cross between Triplo 6 and XM5 was found to be significantly different from the disomic ratio at the 1% level, although the segregation for resistance in disomic fraction of this F2 fitted the disomic segregation ratio. On the other hand, the segregations of the disomic fraction and trisomic fraction of the F2 population from trisomic F1 plants in the cross of Triplo 7 × XM5 were significantly different from the disomic ratio. They gave good fit to the theoretical trisomic segregation ratio [37]. These results indicated that xa19 was located on chromosome 7.

3.3. Rough Mapping of xa19

After trisomic analysis, the F2 population from the cross between Kinmaze and XM5 was subjected to linkage analysis of xa19 using 9 DNA markers, RM481, RM7479, RM5672, RM1253, RM3583, RM3859, RM214, RM500, and RM11 (Table 4). Our visual observation after inoculation of Xoo race III indicated that 299 F2 plants were classified into 73 resistant plants and 226 susceptible plants. As reported before [18,20], the cross between Indica and Japonica cultivars showed many intermediate types. Therefore, the 37 resistant plants judged by stringent observation were subjected to further analysis. Based on the assumption that all the 37 plants were homozygous for xa19 gene, xa19 should be linked closely with DNA markers at which all the plants were homozygous for the XM5 allele. The data of the F2 generation suggest that xa19 is located between RM7479 and RM5672, as shown in Table 4. To narrow down the chromosomal location, the genotypes of the two markers, RM6574 and RM6728, were examined for F2 plants Nos. 1–6. Because the frequency of recombination between RM7479 and RM5672 was very low (approximately 4/64), we skipped the genotyping of RM6574 and RM6728 for the remaining plants, assuming that they were homozygous for the XM5 allele at the two DNA markers. The F3 generation of the F2 plants Nos. 1–6 (ca. 30 plants per F2 plant) were also subjected to a progeny test of Xoo resistance after inoculation with Xoo race III, confirming that they were fixed for the xa19 gene. The genotyping of additional DNA markers, RM6574 and RM6728, revealed that xa19 was located between the two DNA markers, RM6574 and RM5672. These results confirmed the result of trisomic analysis, and revealed the approximate location of xa19.

3.4. Linkage Analysis of xa19

The genotypes of IAS44 had been checked for the following 7 DNA markers on chromosome 7: C1057, X338, R1440, C451, R1245, R1789 and C213 (http://www.shigen.nig.ac.jp/rice/oryzabase/strain/recombinant/genotypeIAS (accessed on 26 December 2022). IAS44 is homozygous for the Asominori allele at the RFLP marker loci spanning C1057 and R1789 on chromosome 7. Only C213 on chromosome 7 was homozygous for IR24 allele. C1057 is originally a cDNA clone, of which the DDBJ accession number is D15667. The cDNA sequence information indicates that it is located on around 2,635 kb of chromosome 7 of the updated rice genome Os-Nipponbare-Reference-IRGSP-1.0 [46]. Also, R1789 was originally a cDNA clone, of which DDBJ accession number is D24363. It is located on around 26,530 kb. Subsequently, we checked the genotypes of IAS44 for the PCR-based DNA markers in our stock: IAS44 was a homozygote for the Asominori allele of DNA markers spanning RM481 and RM11 (Table 1). As described above, IAS44 was susceptible to the five Japanese Xoo races (Table 2). The F2 population from the cross between XM5 and IAS44 showed a bimodal distribution of lesion length after inoculation with Xoo race II (Figure 1). Using the lesion length of 6 cm as the dividing point, the 210 F2 plants were classified into 43 resistant plants and 167 susceptible plants. The segregation ratio 43:167 fitted 1:3, one-gene segregation (χ2 = 2.292, p = 0.13). Genotypes of all F2 plants were determined using five DNA markers: RM6574, RM21134, RM8262, RM6728 and RM5672. In Table 5, Plant Nos. 10 and 18–20 showed short lesion length, suggesting that they were resistant against Xoo race II, and thus homozygous for the xa19 gene. Plant No. 11 showed long lesion length, and its genotypes of the DNA markers surrounding xa19 were homozygous for XM5 or heterozygous. These results suggest that it is heterozygous at the xa19 locus. The combination of the lesion length and genotypes of DNA markers of these plants suggested that xa19 was located between RM8262 and RM6728. The 13 recombinants between RM6574 and RM5672 were subjected to the F3 progeny test for Xoo resistance using Xoo race II. The remaining plants were not subjected to the F3 progeny test because their genotypes of xa19 could be inferred from the results of the F2 generation and these plants contributed little to narrowing down the xa19 location. All the results confirmed that xa19 was located between RM8262 and RM6728 (Table 5). Based on the inference that the genotype of the xa19 locus was identical to RM6728 except F2 plant No. 11 (Table 5), the linkage map around xa19 was constructed (Figure 2). The xa19 gene was closely linked with RM6728 with a genetic distance of 0.3 cm calculated using Kosambi’s function. With the aid of the information related to the physical location of RFLP markers of the framework map by Harushima et al. [47] and PCR-based DNA markers in this study, the xa19 gene was located on the short arm of chromosome 7, close to the centromere.

4. Discussion

The results of this study show that xa19 was located on chromosome 7, flanked by the two DNA markers, RM8262 and RM6728, using the combination of trisomic analysis, primary linkage analysis using the DNA polymorphism between Indica and Japonica, and chromosomal segment substitution lines. Among 46 reported Xoo resistance genes, two genes were located on chromosome 7. Kumar et al. [48] reported that a dominant Xoo resistance gene Xa33 is flanked by two SSR markers RMWR7.1 (4.080 Mb) and RMWR7.6 (4.129 Mb) on chromosome 7. These two markers are encompassed by two SSR markers RM21077 (4.060 Mb) and RM21122 (4.836 Mb) on chromosome 7. The primer information of RMWR7.1 and RMWR7.6 was not published, but chromosomal locations of these markers were available. Furthermore, primer information of RM21077 and RM21122 was published elsewhere [1]. They are located on 4028 kb and 4804 kb, respectively, on IRGSP 1.0, and on 4060 kb and 4836 kb on IRGSP Build 5.0 (https://rgp.dna.affrc.go.jp/E/IRGSP/Build5/build5.html (accessed on 26 December 2022)). Therefore, we infer that Kumar et al. [48] used IRGSP Build 5.0 as the reference genome [1]. The chromosomal region ranging from 4080 kb to 4129 kb on IRGSP Build 5.0 corresponds to that ranging from 4047 kb to 4100 kb on Os-Nipponbare-Reference-IRGSP-1.0. Therefore, xa19 is not allelic to Xa33 [48]. Vikal et al. reported that xa8 is flanked between RM21044 and RM21045 on chromosome 7 [49]. Their location on Os-Nipponbare-Reference-IRGSP-1.0 is 3698 kb and 3707 kb. Therefore, xa19 is not allelic to xa8.
Mizobuchi et al. reported their isolation of five lesion-mimic mutants that showed reduced symptoms after infection with the rice blast fungus from 13,000 M2 lines of rice, one mutant of which was allelic to the previously reported lesion-mimic gene spl5-1, and named spl5-2 [50]. The homozygotes of spl5-2 under the Taichung 65 background showed resistance to Xoo strains T7174 (race I) and T7133 (race III), although the original cultivar Taichung 65 was susceptible to them. Furthermore, the homozygotes of spl5-1 under the Norin 8 background were found to be resistant to the two Xoo races, although the original cultivar Norin 8 was susceptible to them. Mizobuchi et al. also reported that other lesion-mimic mutants, spl4, spl7, spl10, Spl12, spl13, spl14 and Spl15 were also resistant to them, although their original lines were susceptible to them [50]. Among these lesion-mimic genes, spl5 was reported to be located between morphological marker genes g and Rc, both of which had been reported to be located on chromosome 7 [51]. Chen et al. conducted fine mapping of SPL5 and located this gene to the 15.1 kb region flanked by two DNA markers, InDel66 and CAPS7, both of which are located on 5564 and 5579 kb of the updated rice genome IRGSP 1.0 [52]. According to Oryzabase https://shigen.nig.ac.jp/rice/oryzabase/gene/detail/812 (accessed on 26 December 2022), SPL5 is the same gene as Os07g0203700 in RAP-DB (http:// rapdb.dna.affrc.go.jp/ (accessed on 26 December 2022)) [53], and as LOC_Os07g10390 in the Rice Genome Annotation Project (rice.plantbiology.msu.edu/ (accessed on 26 December 2022)) [46]. It encodes the cleavage and polyadenylation specificity factor (CPSF). One base deletion in the recessive spl5 allele (spl5-1 in [50]) induced in Norin 8 by gamma ray irradiation [51] caused frame-shift mutation inducing a premature stop codon, leading to loss of about 41% amino acids (560 aa) in its C-terminus, including the whole CPSF_A domain [52]. It is likely that the loss of amino acids makes spl5 protein lose its normal biological function. The candidate xa19 chromosomal region contains SPL5 gene. Therefore, some possibility exists that xa19 is allelic to SPL5. Our earlier report did not mention the lesion-mimic morphology of XM5 [16]. Actually, our recent close observation revealed that XM5 sometimes shows slight brown spots in its leaves similarly to lesion-mimic mutants, although we did not identify the condition that makes XM5 lesion-mimic.
We have mapped three mutant Xoo resistant genes on the rice genome: they were located on the chromosomal region where a series of Xoo resistant genes from Xa1 to Xa46 were not located. Regarding the xa20 and xa42 genes, no homolog of the cloned Xoo resistant gene has been identified in the candidate chromosomal regions in the Rice Genome Annotation Project (http://rice.plantbiology.msu.edu/index.shtml (accessed on 26 December 2022)) [46] or The Rice Annotation Project Database (https://rapdb.dna.affrc.go.jp/ (accessed on 26 December 2022)) [19,20,53]. These results suggest that mutations induced by N-methyl-N-nitrosourea are a credible source of novel resistance mechanism(s) against Xoo [20]. In the case of xa19, this gene might be allelic to spl5, a lesion-mimic mutant gene resistant against Xoo. If so, xa19 is distinct from the reported spl5 gene in that brown spots on the leaves of XM5 are conditional, and not so severe as homozygotes of the reported spl5 gene [50,52], suggesting that N-methyl- N-nitrosourea might also contribute to the resistance mechanism by creating a new allele. We are undertaking fine mapping of the xa19 gene to clone this gene, using next generation DNA sequencer.
Most of the Xoo resistant genes found in extant resistant cultivars and wild relatives are dominant. Moreover, they follow the gene-for-gene theory, as suggested by Flor [11,22,54]. Of the four recessive Xoo resistant genes cloned earlier, three, xa13 [55], xa25 [56] and xa41 [57], encode SWEET-type protein. Also, xa5 [58] encodes the TFIIA transcription factor. Their corresponding cognate avirulence genes of Xoo all encode the TAL effector [12], suggesting that the recessive Xoo resistant genes also follow the gene-for-gene theory suggested by Flor [11]. However, all the three mutant resistant genes in our lab, xa19, xa20 and xa42, are resistant against all the Xoo races tested: they can be designated as broad-resistant genes, which can contribute to a rice breeding program. The identification of these genes might also contribute to the new molecular mechanism of broad-spectrum Xoo resistance. According to the review by Sato et al., the mutagenic effects of nitrosamides including MNU are characterized by specific nucleotide substitution [59]; Particularly, the MNU induces predominantly a GC to AT transition, based on data obtained with human cells and E. coli. Such a substitution tendency was also reported in rice, and the mutation rate of an M2 mutant population was calculated as 7.4 × 10−6 per nucleotide, representing one mutation in every 135 kb genome sequence [60]. These facts suggest that a very small genetic change such as one amino acid substitution might produce a new Xoo resistant gene. Recent studies produced a Xoo resistant rice plant using genome-editing technique by inducing mutation to targeted genes through a reverse genetic approach [10,61,62,63]. However, forward genetic mutation approaches might create a new resistant gene at a locus on which resistant genes have never been identified. Zeng et al. [61] produced a CRISPR/Cas9-mediated mutation of OsSWEET14 that confers resistance to Xoo without a yield penalty: a tradeoff between immunity and growth which is thought to occur as a result of prioritizing resource allocation to either of the two processes [64]. The combination of forward and reverse genetics on disease resistance is expected to contribute to the understanding and breeding of broad-spectrum-resistant rice cultivars without any yield penalty.

5. Conclusions

XM5 is an Xoo resistant mutant line with the genetic background of IR24, an Indica Xoo susceptible cultivar, induced by a chemical mutagen N-methyl-N-nitrosourea (MNU). XM5 carries a recessive Xoo resistant gene xa19. Genetic analysis showed that xa19 was located within 0.8 cM region between RM8262 and RM6728 on chromosome 7. xa19 is not allelic to the known Xoo resistant genes. However, its location suggests that it might be allelic to a lesion-mimic mutant gene spl5, some alleles of which are resistant to several Xoo races.

Author Contributions

Conceptualization, S.T. and K.I.; methodology, S.T.; software, S.T. and K.I.; validation, S.T.; formal analysis, S.T.; investigation, S.T.; resources, S.T.; data curation, S.T.; writing—original draft preparation, S.T.; writing—review and editing, K.I.; visualization, K.I.; supervision, S.T.; project administration, S.T.; funding acquisition, K.I. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by JSPS KAKENHI Grant Number JP19H02934 from the Japan Society for the Promotion of Science.

Data Availability Statement

Data is contained within the article.

Acknowledgments

We gratefully acknowledge Atsushi Yoshimura of Kyushu University for the kind provision of IAS lines. We are also grateful to Tsugufumi Ogawa for kind the provision of trisomics having IR24 background. We thank Daisuke Kawahara and Masataka Nakagawa for their technical assistance and Li Yunfei for editing the manuscript.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. International Rice Genome Sequencing Project (IRGSP). The map-based sequence of the rice genome. Nature 2005, 436, 793–800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Gale, M.D.; Devos, K.M. Plant Comparative Genetics after 10 Years. Science 1998, 282, 656–659. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Bennetzen, J.L.; Chen, M. Grass Genomic Synteny Illuminates Plant Genome Function and Evolution. Rice 2008, 1, 109–118. [Google Scholar] [CrossRef] [Scilit]
  4. Mansfield, J.; Genin, S.; Magori, S.; Citovsky, V.; Sriariyanum, M.; Ronald, P.; Dow, M.; Verdier, V.; Beer, S.V.; Machado, M.A.; et al. Top 10 Plant Pathogenic Bacteria in Molecular Plant Pathology: Top 10 Plant Pathogenic Bacteria. Mol. Plant Pathol. 2012, 13, 614–629. [Google Scholar] [CrossRef] [Scilit]
  5. Ezuka, A.; Kaku, H. A Historical Review of Bacterial Blight of Rice. Bull. Natl. Inst. Agrobiol. Resour. 2000, 15, 1–207. [Google Scholar]
  6. Ochiai, H.; Inoue, Y.; Takeya, M.; Sasaki, A.; Kaku, H. Genome Sequence of Xanthomonas oryzae pv. oryzae Suggests Contribution of Large Numbers of Effector Genes and Insertion Sequences to Its Race Diversity. JARQ 2005, 39, 275–287. [Google Scholar] [CrossRef] [Scilit]
  7. Lee, B.-M.; Park, Y.-J.; Park, D.-S.; Kang, H.-W.; Kim, J.-G.; Song, E.-S.; Park, I.-C.; Yoon, U.-H.; Hahn, J.-H.; Koo, B.-S.; et al. The Genome Sequence of Xanthomonas oryzae pathovar oryzae KACC10331, the Bacterial Blight Pathogen of Rice. Nucleic Acids Res. 2005, 33, 577–586. [Google Scholar] [CrossRef] [Scilit]
  8. Salzberg, S.L.; Sommer, D.D.; Schatz, M.C.; Phillippy, A.M.; Rabinowicz, P.D.; Tsuge, S.; Furutani, A.; Ochiai, H.; Delcher, A.L.; Kelley, D.; et al. Genome Sequence and Rapid Evolution of the Rice Pathogen Xanthomonas oryzae pv. oryzae PXO99A. BMC Genom. 2008, 9, 204. [Google Scholar] [CrossRef] [Scilit]
  9. Midha, S.; Bansal, K.; Kumar, S.; Girija, A.M.; Mishra, D.; Brahma, K.; Laha, G.S.; Sundaram, R.M.; Sonti, R.V.; Patil, P.B. Population Genomic Insights into Variation and Evolution of Xanthomonas oryzae pv. oryzae. Sci. Rep. 2017, 7, 40694. [Google Scholar] [CrossRef] [Scilit]
  10. Oliva, R.; Ji, C.; Atienza-Grande, G.; Huguet-Tapia, J.C.; Perez-Quintero, A.; Li, T.; Eom, J.-S.; Li, C.; Nguyen, H.; Liu, B.; et al. Broad-Spectrum Resistance to Bacterial Blight in Rice Using Genome Editing. Nat. Biotechnol. 2019, 37, 1344–1350. [Google Scholar] [CrossRef] [Scilit]
  11. Flor, H.H. Current Status of the Gene-For-Gene Concept. Annu. Rev. Phytopathol. 1971, 9, 275–296. [Google Scholar] [CrossRef] [Scilit]
  12. Jiang, N.; Yan, J.; Liang, Y.; Shi, Y.; He, Z.; Wu, Y.; Zeng, Q.; Liu, X.; Peng, J. Resistance Genes and Their Interactions with Bacterial Blight/Leaf Streak Pathogens (Xanthomonas oryzae) in Rice (Oryza sativa L.)—An Updated Review. Rice 2020, 13, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Neelam, K.; Mahajan, R.; Gupta, V.; Bhatia, D.; Gill, B.K.; Komal, R.; Lore, J.S.; Mangat, G.S.; Singh, K. High-Resolution Genetic Mapping of a Novel Bacterial Blight Resistance Gene xa-45(t) Identified from Oryza glaberrima and Transferred to Oryza sativa. Theor. Appl. Genet. 2020, 133, 689–705. [Google Scholar] [CrossRef] [Scilit]
  14. Chen, S.; Wang, C.; Yang, J.; Chen, B.; Wang, W.; Su, J.; Feng, A.; Zeng, L.; Zhu, X. Identification of the Novel Bacterial Blight Resistance Gene Xa46(t) by Mapping and Expression Analysis of the Rice Mutant H120. Sci. Rep. 2020, 10, 12642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Taura, S.; Ogawa, T.; Yoshimura, A.; Omura, T. Induction of Mutants Resistant to Bacterial Blight in Rice. Jpn. J. Breed. 1991, 41, 279–288. [Google Scholar] [CrossRef] [Scilit]
  16. Taura, S.; Ogawa, T.; Yoshimura, A.; Ikeda, R.; Omura, T. Identification of a Recessive Resistance Gene in Induced Mutant Line XM5 of Rice to Rice Bacterial Blight. Jpn. J. Breed. 1991, 41, 427–432. [Google Scholar] [CrossRef] [Scilit]
  17. Taura, S.; Ogawa, T.; Yoshimura, A.; Ikeda, R.; lwata, N. Identification of a Recessive Resistance Gene to Rice Bacterial Blight of Mutant Line XM6, Oryza sativa L. Jpn. J. Breed. 1992, 42, 7–13. [Google Scholar] [CrossRef] [Scilit]
  18. Busungu, C.; Taura, S.; Sakagami, J.-I.; Ichitani, K. Identification and Linkage Analysis of a New Rice Bacterial Blight Resistance Gene from XM14, a Mutant Line from IR24. Breed. Sci. 2016, 66, 636–645. [Google Scholar] [CrossRef] [Scilit]
  19. Busungu, C.; Taura, S.; Sakagami, J.-I.; Anai, T.; Ichitani, K. High-Resolution Mapping and Characterization of xa42, a Resistance Gene against Multiple Xanthomonas oryzae pv. oryzae Races in Rice (Oryza sativa L.). Breed. Sci. 2018, 68, 188–199. [Google Scholar] [CrossRef] [Scilit]
  20. Msami, J.A.; Kawaguchi, Y.; Ichitani, K.; Taura, S. Linkage Analysis of Rice Bacterial Blight Resistance Gene xa20 in XM6, a Mutant Line from IR24. Breed. Sci. 2021, 71, 144–154. [Google Scholar] [CrossRef] [Scilit]
  21. Viana, V.E.; Pegoraro, C.; Busanello, C.; Costa de Oliveira, A. Mutagenesis in Rice: The Basis for Breeding a New Super Plant. Front. Plant Sci. 2019, 10, 1326. [Google Scholar] [CrossRef] [Scilit]
  22. Ogawa, T.; Yamamoto, T.; Khush, G.S.; Mew, T.-W. Breeding of Near-Isogenic Lines of Rice with Single Genes for Resistance to Bacterial Blight Pathogen (Xanthomonas campestris pv. oryzae). Jpn. J. Breed. 1991, 41, 523–529. [Google Scholar] [CrossRef] [Scilit]
  23. Ichitani, K.; Taura, S.; Sato, M.; Kuboyama, T. Distribution of Hwc2-1, a causal gene of a hybrid weakness, in the World Rice Core collection and the Japanese Rice mini Core collection: Its implications for varietal differentiation and artificial selection. Breed. Sci. 2016, 66, 776–789. [Google Scholar] [CrossRef] [Scilit]
  24. Oka, H.-I. Phylogenetic differentiation of the cultivated rice plant I. Variation of various characters and character combinations among rice varieties. Jpn. J. Breed. 1953, 3, 33–43. [Google Scholar] [CrossRef] [Scilit]
  25. Sato, Y.-I. Variation in Spikelet Shape of the indica and japonica Rice Cultivars in Asian Origin. Jpn. J. Breed. 1991, 41, 121–134. [Google Scholar] [CrossRef] [Scilit]
  26. Wang, C.; Tan, M.; Xu, X.; Wen, G.; Zhang, D.; Lin, X. Localizing the Bacterial Blight Resistance Gene, Xa22(t), to a 100-Kilobase Bacterial Artificial Chromosome. Phytopathology 2003, 90, 1258–1262. [Google Scholar] [CrossRef] [Scilit]
  27. Li, Z.K.; Arif, M.; Zhong, D.B.; Fu, B.Y.; Xu, J.L.; Domingo-Rey, J.; Ali, J.; Vijayakumar, C.H.M.; Yu, S.B.; Khush, G.S. Complex Genetic Networks Underlying the Defensive System of Rice (Oryza sativa L.) to Xanthomonas oryzae pv. oryzae. Proc. Natl. Acad. Sci. USA 2006, 103, 7994–7999. [Google Scholar] [CrossRef] [Scilit]
  28. Djedatin, G.; Ndjiondjop, M.-N.; Sanni, A.; Lorieux, M.; Verdier, V.; Ghesquiere, A. Identification of Novel Major and Minor QTLs Associated with Xanthomonas oryzae pv. oryzae (African Strains) Resistance in Rice (Oryza sativa L.). Rice 2016, 9, 18. [Google Scholar] [CrossRef] [Scilit]
  29. Shah, S.; Tsuneyoshi, H.; Ichitani, K.; Taura, S. QTL Analysis Revealed One Major Genetic Factor Inhibiting Lesion Elongation by Bacterial Blight (Xanthomonas oryzae pv. oryzae) from a japonica Cultivar Koshihikari in Rice. Plants 2022, 11, 867. [Google Scholar] [CrossRef] [Scilit]
  30. Kubo, T.; Aida, Y.; Nakamura, K.; Tsunematsu, H.; Doi, K.; Yoshimura, A. Reciprocal Chromosome Segment Substitution Series Derived from Japonica and Indica Cross of Rice (Oryza sativa L.). Breed. Sci. 2002, 52, 319–325. [Google Scholar] [CrossRef] [Scilit]
  31. Khush, G.S.; Singh, R.J.; Sur, S.C.; Librojo, A.L. Primary Trisomics of Rice: Origin, Morphology, Cytology and Usein Linkage Mapping. Genetics 1984, 107, 141–163. [Google Scholar] [CrossRef] [Scilit]
  32. Ogawa, T.; Yamamoto, T.; Kaku, H.; Taura, S.; Khush, G.; Mew, T. Resistance to Rice Bacterial Leaf Blight: Report of April 1982-March 1988; Government of Japan: Tokyo, Japan; International Rice Research Institute: Manila, Philippines, 1988. [Google Scholar]
  33. Khush, G.S. Announcement -Change in the Designation of Trisomics of IR36. Rice Genet. Newsl. 1990, 7, 14. [Google Scholar]
  34. Kaku, H.; Kimura, T. Reaction Types of Rice Cultivars to Strains of Xanthomonas oxyzae. Bull. Chugoku Natl. Agric. Exp. Station. Ser. E Environ. Div. 1978, 13, 17–43. [Google Scholar]
  35. Kaku, H.; Kimura, T. Qualitative Resistance Reaction of Rice Cultivar Asominori to Certain Race II Strains of Xanthomonas campestris pv. oryzae. Jpn. J. Phytopathol. 1989, 55, 657–659. [Google Scholar] [CrossRef] [Scilit]
  36. Okumoto, Y.; Tanisaka, T. Trisomic Analysis of a Strong Photoperiod-Sensitivity Gene E1 in Rice (Oryza sativa L.). Euphytica 1997, 95, 301–307. [Google Scholar] [CrossRef] [Scilit]
  37. Iwata, N. Trisomic Analysis. In Science of the Rice Plant Vol. 3 Genetics; Matsuo, T., Futsuhara, Y., Kikuchi, F., Yamaguchi, H., Eds.; Food and Agriculture Policy Research Center: Tokyo, Japan, 1997; pp. 186–197. [Google Scholar]
  38. Temnykh, S.; DeClerck, G.; Lukashova, A.; Lipovich, L.; Cartinhour, S.; McCouch, S. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome Res. 2001, 8, 1441–1452. [Google Scholar] [CrossRef] [Scilit]
  39. McCouch, S.R.; Teytelman, L.; Xu, Y.; Lobos, K.B.; Clare, K.; Walton, M.; Fu, B.; Maghirang, R.; Li, Z.; Xing, Y.; et al. Development and Mapping of 2240 New SSR Markers for Rice (Oryza sativa L.). DNA Res. 2002, 9, 199–207. [Google Scholar] [CrossRef] [Scilit]
  40. Chen, X.; Temnykh, S.; Xu, Y.; Cho, Y.G.; McCouch, S.R. Development of a Microsatellite Framework Map Providing Genome-Wide Coverage in Rice (Oryza sativa L.). Theor. Appl. Genet. 1997, 95, 553–567. [Google Scholar] [CrossRef] [Scilit]
  41. Panaud, O.; Chen, X.; McCouch, S.R. Development of Microsatellite Markers and Characterization of Simple Sequence Length Polymorphism (SSLP) in Rice (Oryza sativa L.). Mol. Gen. Genet. 1996, 252, 597–607. [Google Scholar] [CrossRef] [Scilit]
  42. Iwata, H.; Ninomiya, S. AntMap: Constructing Genetic Linkage Maps Using an Ant Colony Optimization Algorithm. Breed. Sci. 2006, 56, 371–377. [Google Scholar] [CrossRef] [Scilit]
  43. Wakimoto, S. Biological and Physiological Properties of Xanthomonas oryzae Phage. Sci. Bull. Fac. Agric. Kyushu Univ. 1954, 14, 485–493, (In Japanese with English summary). [Google Scholar] [CrossRef]
  44. Kauffman, H.E.; Reddy, A.P.K.; Hsieh, S.P.Y.; Merca, S.D. An Improved Technique for Evaluating Resistance of Rice Varieties to Xanthomonas oryzae. Plant Dis. Rep. 1973, 57, 537–541. [Google Scholar]
  45. Dellaporta, S.L.; Wood, J.; Hicks, J.B. Plant DNA Minipreparation: Version II. Plant Mol. Biol. Rep. 1983, 1, 19–21. [Google Scholar] [CrossRef] [Scilit]
  46. Kawahara, Y.; de la Bastide, M.; Hamilton, J.P.; Kanamori, H.; McCombie, W.R.; Ouyang, S.; Schwartz, D.C.; Tanaka, T.; Wu, J.; Zhou, S.; et al. Improvement of the Oryza Sativa Nipponbare Reference Genome Using next Generation Sequence and Optical Map Data. Rice 2013, 6, 4. [Google Scholar] [CrossRef] [Scilit]
  47. Harushima, Y.; Yano, M.; Shomura, A.; Sato, M.; Shimano, T.; Kuboki, Y.; Yamamoto, T.; Lin, S.Y.; Antonio, B.A.; Parco, A.; et al. A High-Density Rice Genetic Linkage Map with 2275 Markers Using a Single F2 Population. Genetics 1998, 148, 479–494. [Google Scholar] [CrossRef] [Scilit]
  48. Kumar, P.N.; Sujatha, K.; Laha, G.S.; Rao, K.S.; Mishra, B.; Viraktamath, B.C.; Hari, Y.; Reddy, C.S.; Balachandran, S.M.; Ram, T.; et al. Identification and Fine-Mapping of Xa33, a Novel Gene for Resistance to Xanthomonas oryzae pv. oryzae. Phytopathology 2012, 102, 222–228. [Google Scholar] [CrossRef] [Scilit]
  49. Vikal, Y.; Chawla, H.; Sharma, R.; Lore, J.S.; Singh, K. Mapping of Bacterial Blight Resistance Gene xa8 in Rice (Oryza sativa L.). Indian J. Genet. 2014, 74, 589. [Google Scholar] [CrossRef] [Scilit]
  50. Mizobuchi, R.; Hirabayashi, H.; Kaji, R.; Nishizawa, Y.; Yoshimura, A.; Satoh, H.; Ogawa, T.; Okamoto, M. Isolation and Characterization of Rice Lesion-Mimic Mutants with Enhanced Resistance to Rice Blast and Bacterial Blight. Plant Sci. 2002, 163, 345–353. [Google Scholar] [CrossRef] [Scilit]
  51. Iwata, N.; Omura, T.; Satoh, H. Linkage Studies in Rice (Oryza sativa L.): On Some Mutants for Physiological Leaf Spots. J. Fac. Agric. Kyushu Univ. 1978, 22, 243–251. [Google Scholar] [CrossRef] [Scilit]
  52. Chen, X.; Hao, L.; Pan, J.; Zheng, X.; Jiang, G.; Jin, Y.; Gu, Z.; Qian, Q.; Zhai, W.; Ma, B. SPL5, a Cell Death and Defense-Related Gene, Encodes a Putative Splicing Factor 3b Subunit 3 (SF3b3) in Rice. Mol. Breed. 2012, 30, 939–949. [Google Scholar] [CrossRef] [Scilit]
  53. Sakai, H.; Lee, S.S.; Tanaka, T.; Numa, H.; Kim, J.; Kawahara, Y.; Wakimoto, H.; Yang, C.; Iwamoto, M.; Abe, T.; et al. Rice Annotation Project Database (RAP-DB): An Integrative and Interactive Database for Rice Genomics. Plant Cell Physiol. 2013, 54, e6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Niño-Liu, D.O.; Ronald, P.C.; Bogdanove, A.J. Xanthomonas oryzae pathovars: Model Pathogens of a Model Crop. Mol. Plant Pathol. 2006, 7, 303–324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Yang, B.; Sugio, A.; White, F.F. Os8N3 Is a Host Disease-Susceptibility Gene for Bacterial Blight of Rice. Proc. Natl. Acad. Sci. USA 2006, 103, 10503–10508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Liu, Q.; Yuan, M.; Zhou, Y.; Li, X.; Xiao, J.; Wang, S. A Paralog of the MtN3/Saliva Family Recessively Confers Race-Specific Resistance to Xanthomonas oryzae in Rice. Plant Cell Environ. 2011, 34, 1958–1969. [Google Scholar] [CrossRef] [Scilit]
  57. Hutin, M.; Sabot, F.; Ghesquière, A.; Koebnik, R.; Szurek, B. A Knowledge-Based Molecular Screen Uncovers a Broad-Spectrum OsSWEET14 Resistance Allele to Bacterial Blight from Wild Rice. Plant J. 2015, 84, 694–703. [Google Scholar] [CrossRef] [Scilit]
  58. Iyer, A.S.; McCouch, S.R. The Rice Bacterial Blight Resistance Gene xa5 Encodes a Novel Form of Disease Resistance. Mol. Plant Microbe Interact. 2004, 17, 1348–1354. [Google Scholar] [CrossRef] [Scilit]
  59. Satoh, H.; Matsusaka, H.; Kumamaru, T. Use of N-Methyl-N-Nitrosourea Treatment of Fertilized Egg Cells for Saturation Mutagenesis of Rice. Breed. Sci. 2010, 60, 475–485. [Google Scholar] [CrossRef] [Scilit]
  60. Suzuki, T.; Eiguchi, M.; Kumamaru, T.; Satoh, H.; Matsusaka, H.; Moriguchi, K.; Nagato, Y.; Kurata, N. MNU-Induced Mutant Pools and High Performance TILLING Enable Finding of Any Gene Mutation in Rice. Mol. Genet. Genom. 2008, 279, 213–223. [Google Scholar] [CrossRef] [Scilit]
  61. Zeng, X.; Luo, Y.; Vu, N.T.Q.; Shen, S.; Xia, K.; Zhang, M. CRISPR/Cas9-Mediated Mutation of OsSWEET14 in Rice Cv. Zhonghua11 Confers Resistance to Xanthomonas oryzae pv. oryzae without Yield Penalty. BMC Plant Biol. 2020, 20, 313. [Google Scholar] [CrossRef] [Scilit]
  62. Zhou, J.; Peng, Z.; Long, J.; Sosso, D.; Liu, B.; Eom, J.-S.; Huang, S.; Liu, S.; Vera Cruz, C.; Frommer, W.B.; et al. Gene Targeting by the TAL Effector PthXo2 Reveals Cryptic Resistance Gene for Bacterial Blight of Rice. Plant J. 2015, 82, 632–643. [Google Scholar] [CrossRef] [Scilit]
  63. Xu, Z.; Xu, X.; Gong, Q.; Li, Z.; Li, Y.; Wang, S.; Yang, Y.; Ma, W.; Liu, L.; Zhu, B.; et al. Engineering Broad-Spectrum Bacterial Blight Resistance by Simultaneously Disrupting Variable TALE-Binding Elements of Multiple Susceptibility Genes in Rice. Mol. Plant 2019, 12, 1434–1446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Calvo-Baltanás, V.; Wang, J.; Chae, E. Hybrid Incompatibility of the Plant Immune System: An Opposite Force to Heterosis Equilibrating Hybrid Performances. Front. Plant Sci. 2021, 11, 576796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Frequency distribution of lesion length at 18 days after inoculation with Xoo Japanese race II (T7147) of the F2 population from the cross between XM5 and IAS44. The classified genotypes were assessed for RM6728 as noted: black, homozygous for XM5; gray, heterozygous; white, homozygous for IAS44. XM5 (10 plants), IAS44 (5 plants) and IR24 (10 plants) were planted as reference, and their lesion length ranges are shown as stippled boxes on the top.
Figure 1. Frequency distribution of lesion length at 18 days after inoculation with Xoo Japanese race II (T7147) of the F2 population from the cross between XM5 and IAS44. The classified genotypes were assessed for RM6728 as noted: black, homozygous for XM5; gray, heterozygous; white, homozygous for IAS44. XM5 (10 plants), IAS44 (5 plants) and IR24 (10 plants) were planted as reference, and their lesion length ranges are shown as stippled boxes on the top.
Plants 12 00602 g001
Figure 2. Linkage map of xa19 and surrounding DNA markers. (a,b) RFLP framework maps of chromosome 7 modified from Harushima et al. [47]. (c) the linkage map of xa19 gene constructed from F2 population from the cross between XM5 and IAS44 (n = 210). DNA markers located near each other on Os-Nipponbare-Reference-IRGSP-1.0 are connected by dotted lines.
Figure 2. Linkage map of xa19 and surrounding DNA markers. (a,b) RFLP framework maps of chromosome 7 modified from Harushima et al. [47]. (c) the linkage map of xa19 gene constructed from F2 population from the cross between XM5 and IAS44 (n = 210). DNA markers located near each other on Os-Nipponbare-Reference-IRGSP-1.0 are connected by dotted lines.
Plants 12 00602 g002
Table 1. Primer sequences of DNA markers for linkage analysis of xa19 gene.
Table 1. Primer sequences of DNA markers for linkage analysis of xa19 gene.
Marker NameDirectionPrimer SequenceLocation of Os-Nipponbare-Reference-IRGSP-1.0 of Chromosome 7
From (bp)To (bp)Source
RM481FTAGCTAGCCGATTGAATGGC2,876,1652,876,333[38]
RCTCCACCTCCTATGTTGTTG
RM7479FCCAGTTGCAACAAAGCTCTG4,135,5264,135,741[39]
RTAGGAGCGTTTGTAGGAGCG
RM6574FAACCTCGAATTCCTTGGGAG4,682,8294,682,937[39]
RTTCGACTCCAAGGAGTGCTC
RM21134FGCTTCCTCGAGGGATGGTACGG4,947,9934,948,107[1]
RGCTGAATTCCAACTTTCCGAGACC
RM8262FCATTAGCCGTGGTGTATTTG5,299,4015,299,600[39]
RTTTCATCCCTAGTGCCAAC
RM6728FGGGTATGTGTCGCTATTTTA5,730,0325,730,175[39]
RGAAATCTGGAATTTTCCCTA
RM5672FCACCCTACAAGGAAACAAGC6,381,1906,380,982[39]
RTGCCCAATATAGAGGCAACC
RM1253FCTGAACTTGCCTGAGAACTC6,968,8206,968,994[39]
RGACGACCTCTCCATGCTCG
RM3583FTACAATTTGGCGACCTCCTC8,045,8488,045,978[39]
RGGATGCCATGTCATCATCTG
RM3859FTTGCAGATCGGTTTCCACTG8,878,2098,878,399[39]
RGGTCCTGGATTCATGGTGTC
RM214FCTGATGATAGAAACCTCTTCTC12,784,61212,784,504[40]
RAAGAACAGCTGACTTCACAA
RM500FGAGCTTGCCAGAGTGGAAAG15,911,53915,911,794[38]
RGTTACACCGAGAGCCAGCTC
RM11FTCTCCTCTTCCCCC GATC19,257,90719,258,032[41]
RATAGCGGGCGAGGCTTAG
Table 2. Reaction in lesion length (cm) XM5, IR24 and IAS44 after inoculation with five Japanese races Xanthomonas oryzae pv. oryzae.
Table 2. Reaction in lesion length (cm) XM5, IR24 and IAS44 after inoculation with five Japanese races Xanthomonas oryzae pv. oryzae.
Rice AccessionLesion Length 1 (cm)
Race IRace IIRace IIIRace IVRace V
T7174T7147T7133H75373H75304
XM51.8 ± 0.21.1 ± 0.62.2 ± 1.02.5 ± 0.51.1 ± 0.3
IR2424.6 ± 5.730.2 ± 6.729.0 ± 3.520.2 ± 1.521.0 ± 4.8
Kinmaze9.1 ± 3.113.9 ± 3.019.9 ± 4.05.7 ± 0.715.4 ± 2.3
IAS4415.2 ± 3.919.7 ± 5.525.0 ± 1.211.4 ± 0.710.7 ± 1.1
1 Lesion length ± standard deviation at 18 days after inoculation.
Table 3. Segregation for resistance to the bacterial blight pathogen in F2 populations from trisomic F1 plants derived from the cross between trisomics and XM5.
Table 3. Segregation for resistance to the bacterial blight pathogen in F2 populations from trisomic F1 plants derived from the cross between trisomics and XM5.
CrossFraction of Population χ2
Reaction of F2 Plants 1Expected Ratio
RSTotal1:31:81:441:35
Triplo 1 × XM5Total918271
Triplo 6 × XM52x441652091.73720.914 ** 2
2x+11757622.737 **0.2870.602
Total4524028512.895 **
Triplo 7 × XM52x786915.143 **1.210
2x+10494916.333 **1.1141.400
Total713514230.507 **
Triplo 9 × XM5Total541782320.368
Triplo 10 × XM5Total1679950.372
Triplo 11 × XM5Total461892353.689
1 R and S, respectively, denote resistant and susceptible to Philippine Xoo race 1 (PXO 61), race 2 (PXO86), and race 6 (PXO 99). 2 ** means significant at 1% level.
Table 4. Genotypes of DNA markers on chromosome 7 of 37 selected resistant plants against Japanese Xoo race III in the F2 population from the cross between XM5 and Kinmaze.
Table 4. Genotypes of DNA markers on chromosome 7 of 37 selected resistant plants against Japanese Xoo race III in the F2 population from the cross between XM5 and Kinmaze.
F2 Plant No. 2Genotype of DNA Marker Loci 1
RM481RM7479RM6574RM6728RM5672RM1253RM3583RM3859RM214RM500RM11
1KHHXXXXXXXX
2HHHXXXXXXXX
3HHHXXXXXXXX
4XXXXXXXXXXH
5XXXXXHHHHHH
6XXXXHHHHHHH
7XX--XXXXXXX
8XX--NDXXNDXXX
9XX--NDXXXXXX
10XX--XXXXXXX
11XX--XXXXXHH
12XX--XXXXXXX
13XX--XXXXXXX
14XX--NDXXXXXH
15XX--XXXXXXX
16XX--XXXXXXX
17HX--XXXXXXX
18XX--NDXXXXXX
19XX--NDXXXXXH
20XX--XXXXXXX
21HX--XXXXXXX
22XX--XXXXXXX
23XX--XXXXXXX
24XX--XXXXXXH
25XX--XXXXXXX
26XX--XXXXXXX
27XX--XXXXXXH
28XX--XXXXXXX
29XX--XXXXXXH
30NDX--XXXXXXX
31XX--XXXXXXH
32XX--XXXXXXX
33XX--XXXXXXX
34XX--XXXXXXX
35XX--XXXXXXX
36XX--XXXXXXH
37XX--XXXXXXX
1 X, H, K, ND and -, respectively, denote homozygotes for XM5, heterozygotes, homozygotes for Kinmaze, genotypes not determined mainly due to error in molecular techniques, and genotypes not tested. 2 1–6 were subjected to progeny test using F3 generation for inheritance of Xoo resistance and genotyping of additional DNA markers, RM6574 and RM6728.
Table 5. Genotypes of informative recombinants for the DNA marker loci linked with xa19 on chromosome 7 in the F2 population (XM5 × IAS44), and the gene segregation in the F3 generation.
Table 5. Genotypes of informative recombinants for the DNA marker loci linked with xa19 on chromosome 7 in the F2 population (XM5 × IAS44), and the gene segregation in the F3 generation.
F2 Plant No.Lesion Length (cm)Genotypes of the DNA Marker Loci 1Segregation in F3 Plants 2
RM6574RM21134RM8262RM6728RM5672RSTotal
116.0AAHHH72229
248.3AAHHH101424
342.5AAHHH82028
419.3HAHHH52429
517.0HHAAA02929
618.9HHAAA02424
724.3HHAAA02929
826.8HHAAA02424
913.7HHHAA02020
101.9HHHXX29029
1149.3HHHXX51520
1216.6XXHHH72229
1318.1XXHHH52328
1414.0XHHHH- 3-
1529.0XHHHH--
1618.9XHHHH--
1713.0XHHHH--
180.8XXXXH--
190.3XXXXH--
200.4XXXXH--
1 X, H and A, respectively, denote homozygotes for XM5, heterozygotes, homozygotes for IAS44. 2 R and S, respectively, denote resistant and susceptible to Xoo race II and the gene segregation in the F3 generation. 3 indicates that F3 progeny were not tested for Xoo resistance.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Taura, S.; Ichitani, K. Chromosomal Location of xa19, a Broad-Spectrum Rice Bacterial Blight Resistant Gene from XM5, a Mutant Line from IR24. Plants 2023, 12, 602. https://doi.org/10.3390/plants12030602

AMA Style

Taura S, Ichitani K. Chromosomal Location of xa19, a Broad-Spectrum Rice Bacterial Blight Resistant Gene from XM5, a Mutant Line from IR24. Plants. 2023; 12(3):602. https://doi.org/10.3390/plants12030602

Chicago/Turabian Style

Taura, Satoru, and Katsuyuki Ichitani. 2023. "Chromosomal Location of xa19, a Broad-Spectrum Rice Bacterial Blight Resistant Gene from XM5, a Mutant Line from IR24" Plants 12, no. 3: 602. https://doi.org/10.3390/plants12030602

APA Style

Taura, S., & Ichitani, K. (2023). Chromosomal Location of xa19, a Broad-Spectrum Rice Bacterial Blight Resistant Gene from XM5, a Mutant Line from IR24. Plants, 12(3), 602. https://doi.org/10.3390/plants12030602

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop