Effect of Exogenous Calcium on Tolerance of Winter Wheat to Cold Stress during Stem Elongation Stage
Abstract
:1. Introduction
2. Results
2.1. Effects of Exogenous Calcium on Wheat Grain Yield under Low-Temperature Stress during the Stem Elongation Stage
2.2. Exogenous Calcium Effect on Leaf Lethal Temperature and Photosynthetic Capacity under Low-Temperature Stress during the Stem Elongation Stage
2.3. Effect of Exogenous Calcium on Osmotic Regulation under Low-Temperature Stress at the Stem Elongation Stage
2.4. Effect of Exogenous Calcium on Cell Membrane Peroxidation Rate and Antioxidant Enzyme Activity under Low-Temperature Stress at the Stem Elongation Stage
2.5. Effect of Exogenous Ca2+ and EGTA on Endogenous Calcium Content under Low-Temperature Stress at the Stem Elongation Stage
2.6. Effect of Exogenous Calcium on Gene Expression Related to Calcium Signaling and Cold-Responsive Genes under Low-Temperature Stress during the Stem Elongation Stage
2.7. Effect of Exogenous Calcium on Cold-Responsive Gene Expression under Low-Temperature Stress at Stem Elongation
2.8. Correlation Analysis
3. Discussion
3.1. Exogenous Calcium Improves Plant Tolerance to Low-Temperature Stress during Stem Elongation in Wheat
3.2. Exogenous Ca2+ Induced the Endogenous Ca2+ Content and Calcium Signaling Pathway
4. Materials and Methods
4.1. Experimental Design
4.1.1. Experiment I
4.1.2. Experiment II
4.2. Physiological Measurements
4.2.1. Leaf Half-Lethal Temperature
4.2.2. Leaf Photosynthesis and Chlorophyll Fluorescence
4.2.3. Osmolyte Content
4.2.4. Cell Membrane Damage and Antioxidant Enzyme Activities
4.2.5. Endogenous Calcium Content
4.2.6. Gene Expression
4.3. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Parry, M.A.; Reynolds, M.; Salvucci, M.E.; Raines, C.; Andralojc, P.J.; Zhu, X.-G.; Price, D.G.; Condon, A.G.; Furbank, R.T. Raising yield potential of wheat. II. Increasing photosynthetic capacity and efficiency. J. Exp. Bot. 2010, 62, 453–467. [Google Scholar] [CrossRef] [PubMed]
- Augspurger, C.K. Reconstructing patterns of temperature, phenology, and frost damage over 124 years: Spring damage risk is increasing. Ecology 2013, 94, 41–50. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Pu, H.; Liu, F.; Zhou, Q.; Cai, J.; Dai, T.; Cao, W.; Jiang, D. Winter wheat photosynthesis and grain yield responses to spring freeze. Agron. J. 2015, 107, 1002–1010. [Google Scholar] [CrossRef]
- Thakur, P.; Kumar, S.; Malik, J.A.; Berger, J.D.; Nayyar, H. Cold stress effects on reproductive development in grain crops: An overview. Environ. Exp. Bot. 2010, 67, 429–443. [Google Scholar] [CrossRef]
- Schulz, P.; Herde, M.; Romeis, T. Calcium-dependent protein kinases: Hubs in plant stress signaling and development. Plant Physiol. 2013, 163, 523–530. [Google Scholar] [CrossRef]
- Xia, X.-J.; Wang, Y.-J.; Zhou, Y.-H.; Tao, Y.; Mao, W.-H.; Shi, K.; Asami, T.; Chen, Z.; Yu, J.-Q. Reactive oxygen species are involved in brassinosteroid-induced stress tolerance in cucumber. Plant Physiol. 2009, 150, 801–814. [Google Scholar] [CrossRef] [PubMed]
- Zeng, H.; Xu, L.; Singh, A.; Wang, H.; Du, L.; Poovaiah, B.W. Involvement of calmodulin and calmodulin-like proteins in plant responses to abiotic stresses. Front. Plant Sci. 2015, 6, 600. [Google Scholar] [CrossRef] [PubMed]
- Mori, K.; Renhu, N.; Naito, M.; Nakamura, A.; Shiba, H.; Yamamoto, T.; Suzaki, T.; Iida, H.; Miura, K. Ca2+-permeable mechanosensitive channels MCA1 and MCA2 mediate cold-induced cytosolic Ca2+ increase and cold tolerance in Arabidopsis. Sci. Rep. 2018, 8, 550. [Google Scholar] [CrossRef] [PubMed]
- Thomashow, M.F. Role of Cold-Responsive Genes in Plant Freezing Tolerance1. Plant Physiol. 1998, 118, 1–8. [Google Scholar] [CrossRef]
- Kaur, N.; Gupta, A.K. Signal transduction pathways under abiotic stresses in plants. Curr. Sci. 2005, 88, 1771–1780. [Google Scholar]
- Song, Q.; Liu, Y.; Pang, J.; Yong, J.W.H.; Chen, Y.; Bai, C.; Gille, C.; Shi, Q.; Wu, D.; Han, X.; et al. Supplementary calcium restores peanut (Arachis hypogaea) growth and photosynthetic capacity under low nocturnal temperatures. Front. Plant Sci. 2020, 10, 1637. [Google Scholar] [CrossRef]
- Wu, D.; Liu, Y.; Pang, J.; Yong, J.W.H.; Chen, Y.; Bai, C.; Han, X.; Liu, X.; Sun, Z.; Zhang, S. Exogenous calcium alleviates nocturnal chilling-induced feedback inhibition of photosynthesis by improving sink demand in peanuts (Arachis hypogaea). Front. Plant Sci. 2020, 11, 607029. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.; Liu, Y.; Ni, Y.; Meng, Z.; Lu, T.; Li, T. Exogenous calcium alleviates low night temperature stress on the photosynthetic apparatus of tomato leaves. PLoS ONE 2014, 9, e97322. [Google Scholar] [CrossRef] [PubMed]
- Farooq, M.; Aziz, T.; Basra, S.M.A.; Wahid, A.; Khaliq, A.; Cheema, M.A. Exploring the role of calcium to improve chilling tolerance in hybrid maize. J. Agron. Crop. Sci. 2008, 194, 350–359. [Google Scholar] [CrossRef]
- Jia, Y.; Zou, D.; Wang, J.; Sha, H.; Liu, H.; Inayat, M.A.; Sun, J.; Zheng, H.; Xia, N.; Zhao, H. Effects of γ-aminobutyric acid, glutamic acid, and calcium chloride on rice (Oryza sativa L.) under cold stress during the early vegetative stage. J. Plant Growth Regul. 2016, 36, 240–253. [Google Scholar] [CrossRef]
- Li, X.; Cai, J.; Liu, F.; Dai, T.; Cao, W.; Jiang, D. Cold priming drives the sub-cellular antioxidant systems to protect photosynthetic electron transport against subsequent low-temperature stress in winter wheat. Plant Physiol. Biochem. 2014, 82, 34–43. [Google Scholar] [CrossRef]
- Wang, W.; Wang, X.; Zhang, J.; Huang, M.; Cai, J.; Zhou, Q.; Dai, T.; Jiang, D. Salicylic acid and cold priming induce late-spring freezing tolerance by maintaining cellular redox homeostasis and protecting photosynthetic apparatus in wheat. Plant Growth Regul. 2019, 90, 109–121. [Google Scholar] [CrossRef]
- Banerjee, A.; Roychoudhury, A. Regulation of photosynthesis under salinity and drought stress. In Environment and Photosynthesis: A Future Prospect; Studium Press: New Delhi, India, 2018; pp. 134–144. [Google Scholar]
- Ji, H.; Xiao, L.; Xia, Y.; Song, H.; Liu, B.; Tang, L.; Cao, W.; Zhu, Y.; Liu, L. Effects of jointing and booting low-temperature stresses on grain yield and yield components in wheat. Agric. For. Meteorol. 2017, 243, 33–42. [Google Scholar] [CrossRef]
- Su, L.; Dai, Z.; Li, S.; Xin, H. A novel system for evaluating drought–cold tolerance of grapevines using chlorophyll fluorescence. BMC Plant Biol. 2015, 15, 82. [Google Scholar] [CrossRef] [PubMed]
- Sangwan, V.; Foulds, I.; Singh, J.; Dhindsa, R.S. Cold-activation of Brassica napus BN115 promoter is mediated by structural changes in membranes and cytoskeleton and requires Ca2+ influx. Plant J. 2001, 27, 1–12. [Google Scholar] [CrossRef]
- Ensminger, I.; Busch, F.; Huner, N.P.A. Photostasis and cold acclimation: Sensing low temperature through photosynthesis. Physiol. Plant. 2006, 126, 28–44. [Google Scholar] [CrossRef]
- Lin, K.H.; Hwang, W.C.; Lo, H.F. Chilling stress and chilling tolerance of sweet potato as sensed by chlorophyll fluorescence. Photosynthetica 2007, 45, 628–632. [Google Scholar] [CrossRef]
- Brestic, M.; Zivcak, M.; Kunderlikova, K.; Sytar, O.; Shao, H.; Kalaji, H.M.; Allakhverdiev, S.I. Low PSI content limits the photoprotection of PSI and PSII in early growth stages of chlorophyll b-deficient wheat mutant lines. Photosynth. Res. 2015, 125, 151–166. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.-F.; Han, X.-R.; Zhan, X.-M.; Yang, J.-F.; Wang, Y.-Z.; Song, Q.-B.; Chen, X. Regulation of calcium on peanut photosynthesis under low night temperature stress. J. Integr. Agric. 2013, 12, 2172–2178. [Google Scholar] [CrossRef]
- Kołodziejczyk, I.; Dzitko, K.; Szewczyk, R.; Posmyk, M.M. Exogenous melatonin improves corn (Zea mays L.) embryo proteome in seeds subjected to chilling stress. J. Plant Physiol. 2016, 193, 47–56. [Google Scholar] [CrossRef]
- Xu, S.; Hu, J.; Li, Y.; Ma, W.; Zheng, Y.; Zhu, S. Chilling tolerance in Nicotiana tabacum induced by seed priming with putrescine. Plant Growth Regul. 2010, 63, 279–290. [Google Scholar] [CrossRef]
- Shi, Q.; Bao, Z.; Zhu, Z.; Ying, Q.; Qian, Q. Effects of different treatments of salicylic acid on heat tolerance, chlorophyll fluorescence, and antioxidant enzyme activity in seedlings of Cucumis sativa L. Plant Growth Regul. 2006, 48, 127–135. [Google Scholar] [CrossRef]
- Shi, H.T.; Ye, T.T.; Zhong, B.; Liu, X.; Chan, Z.L. Comparative proteomic and metabolomic analyses reveal mechanisms of improved cold stress tolerance in bermudagrass (Cynodon dactylon (L.) Pers.) by exogenous calcium. J. Integr. Plant Biol. 2014, 56, 1064–1079. [Google Scholar] [CrossRef]
- Bodelón, O.G.; Blanch, M.; Sanchez-Ballesta, M.T.; Escribano, M.I.; Merodio, C. The effects of high CO2 levels on anthocyanin composition, antioxidant activity, and soluble sugar content of strawberries stored at low non-freezing temperatures. Food Chem. 2010, 122, 673–678. [Google Scholar] [CrossRef]
- Bolouri-Moghaddam, M.R.; Le Roy, K.; Xiang, L.; Rolland, F.; Ende, W.V.D. Sugar signaling and antioxidant network connections in plant cells. FEBS J. 2010, 277, 2022–2037. [Google Scholar] [CrossRef]
- Dörffling, K.; Schulenburg, S.; Lesselich, G.; Dörffling, H. Abscisic acid and proline levels in cold hardened winter wheat leaves to variety-specific differences in freezing resistance. J. Agron. Crop. Sci. 1990, 165, 230–239. [Google Scholar] [CrossRef]
- Ludwig, A.A.; Saitoh, H.; Felix, G.; Freymark, G.; Miersch, O.; Wasternack, C.; Boller, T.; Jones, J.D.G.; Romeis, T. Ethylene-mediated cross-talk between calcium-dependent protein kinase and MAPK signaling controls stress responses in plants. Proc. Natl. Acad. Sci. USA 2005, 102, 10736–10741. [Google Scholar] [CrossRef]
- Wang, J.; Song, J.; Wu, X.; Deng, Q.; Zhu, Z.; Ren, M.; Ye, M.; Zeng, R. Seed priming with calcium chloride enhances wheat resistance against wheat aphid Schizaphis graminum Rondani. Pest Manag. Sci. 2021, 77, 4709–4718. [Google Scholar] [CrossRef]
- Min, K.; Liu, B.; Lee, S.-R.; Arora, R. Supplemental calcium improves freezing tolerance of spinach (Spinacia oleracea L.) by mitigating membrane and photosynthetic damage, and bolstering anti-oxidant and cell-wall status. Sci. Hortic. 2021, 288, 110212. [Google Scholar] [CrossRef]
- Luan, S.; Kudla, J.; Rodriguez-Concepcion, M.; Yalovsky, S.; Gruissem, W. Calmodulins, and calcineurin B-like proteins: Calcium sensors for specific signal response coupling in plants. Plant Cell. 2002, 14, 14389–14400. [Google Scholar] [CrossRef]
- Batistic, O.; Kudla, J. Integration and channeling of calcium signaling through the CBL calcium sensor/CIPK protein kinase network. Planta 2004, 219, 915–924. [Google Scholar] [CrossRef] [PubMed]
- Xiang, Y.; Huang, Y.M.; Xiong, L.Z. Characterization of stress-responsive CIPK genes in rice for stress tolerance improvement. Plant Physiol. 2007, 144, 1416–1428. [Google Scholar] [CrossRef]
- Ruelland, E.; Vaultier, M.-N.; Zachowski, A.; Hurry, V. Cold signaling and cold acclimation in plants. Adv. Bot. Res. 2009, 49, 35–150. [Google Scholar]
- Castellani, J.W.; Tipton, M.J. Cold stress effects on exposure tolerance and exercise performance. Compr. Physiol. 2015, 6, 443–469. [Google Scholar]
- Hwarari, D.; Guan, Y.; Ahmad, B.; Movahedi, A.; Min, T.; Hao, Z.; Lu, Y.; Chen, J.; Yang, L. ICE-CBF-COR Signaling Cascade and Its Regulation in Plants Responding to Cold Stress. Int. J. Mol. Sci. 2022, 23, 1549. [Google Scholar] [CrossRef] [PubMed]
- Ito, Y.; Katsura, K.; Maruyama, K.; Taji, T.; Kobayashi, M.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Functional analysis of rice DREB1/CBF-type transcription factors involved in cold-responsive gene expression in transgenic rice. Plant Cell Physiol. 2006, 47, 141–153. [Google Scholar] [CrossRef]
- Niu, C.-F.; Wei, W.; Zhou, Q.-Y.; Tian, A.-G.; Hao, Y.-J.; Zhang, W.-K.; Ma, B.; Lin, Q.; Zhang, Z.-B.; Zhang, J.-S.; et al. Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant Cell Environ. 2012, 35, 1156–1170. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Ding, Y.; Yang, S. Molecular Regulation of CBF Signaling in Cold Acclimation. Trends Plant Sci. 2018, 23, 623–637. [Google Scholar] [CrossRef] [PubMed]
- Ganeshan, S.; Vitamvas, P.; Fowler, D.B.; Chibbar, R.N. Quantitative expression analysis of selected COR genes reveals their differential expression in leaf and crown tissues of wheat (Triticum aestivum L.) during an extended low-temperature acclimation regimen. J. Exp. Bot. 2008, 59, 2393–2402. [Google Scholar] [CrossRef]
- Breton, G.; Danyluk, J.; Charron, J.-B.F.; Sarhan, F. Expression profiling and bioinformatic analyses of a novel stress-regulated multispanning transmembrane protein family from cereals and Arabidopsis. Plant Physiol. 2003, 132, 64–74. [Google Scholar] [CrossRef]
- Henriksson, K.N.; Trewavas, A.J. The effect of short-term low-temperature treatments on gene expression in Arabidopsis correlates with changes in intracellular Ca2+ levels. Plant Cell Environ. 2003, 26, 485–496. [Google Scholar] [CrossRef]
- Cai, Q.; Wang, S.; Cui, Z.; Sun, J.; Ishii, Y. Changes in freezing tolerance and its relationship with the contents of carbohydrates and proline in overwintering centipedegrass (Eremochloa ophiuroides (Munro) Hack.). Plant Prod. Sci. 2004, 7, 421–426. [Google Scholar] [CrossRef]
- Cui, Y.; Tian, Z.; Zhang, X.; Muhammad, A.; Han, H.; Jiang, D.; Cao, W.; Dai, T. Effect of water deficit during vegetative growth periods on post-anthesis photosynthetic capacity and grain yield in winter wheat (Triticum aestivum L.). Acta Physiol. Plant. 2015, 37, 196. [Google Scholar] [CrossRef]
- Maxwell, K.; Johnson, G.N. Chlorophyll fluorescence—A practical guide. J. Exp. Bot. 2000, 51, 659–668. [Google Scholar] [CrossRef]
- Moya, J.L.; Ros, R.; Picazo, I. Influence of cadmium and nickel on growth, net photosynthesis and carbohydrate distribution in rice plants. Photosynth. Res. 1993, 36, 75–80. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Li, B.; Lu, X.; Yuan, L.; Yang, Y.; Yuan, Y.; Du, J.; Guo, S. The effect of exogenous calcium on mitochondria, respiratory metabolism enzymes and ion transport in cucumber roots under hypoxia. Sci. Rep. 2015, 5, 11391. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Wang, X.; Peng, X.; Ge, J.; Cai, J.; Huang, M.; Zhou, Q.; Zhong, Y.; Jiang, D. Cold priming improves chilling resistance in wheat seedlings: Changing of photosystem II imprints during recovery from priming. Environ. Exp. Bot. 2023, 207, 105220. [Google Scholar] [CrossRef]
Treatment | Spikes | Kernels per Spike | Thousand Grain Weight (g) | Yield (g) |
---|---|---|---|---|
CC | 13.00 ab | 51.67 b | 50.35 b | 33.03 b |
CaC | 13.25 ab | 57.13 a | 54.60 a | 39.98 a |
CL | 11.25 b | 41.53 d | 48.35 b | 20.76 c |
CaL | 14.25 a | 46.00 c | 52.71 a | 33.00 b |
Treatment | Total Sugar (mg g−1 DW) | Fructose (mg g−1 DW) | Sucrose (mg g−1 DW) | Free Amino Acids (mg g−1 DW) |
---|---|---|---|---|
CC | 35.96 c | 21.23 c | 4.79 c | 45.68 a |
CaC | 46.45 c | 30.34 c | 9.37 c | 46.98 a |
CL | 108.53 b | 83.58 ab | 47.20 b | 48.14 a |
CaL | 133.49 a | 91.23 a | 71.81 a | 45.73 a |
Enzymes | CC | CaC | CL | CaL |
---|---|---|---|---|
SOD (U mg−1 protein) | 4.01 c | 10.34 a | 6.56 b | 11.37 a |
POD (umol mg−1 min−1 protein) | 2.21 c | 3.06 a | 2.59 b | 3.26 a |
CAT (umol mg−1 min−1 protein) | 1.70 ab | 1.79 ab | 1.29 b | 2.09 a |
APX (umol mg−1 min−1 protein) | 0.55 b | 1.14 a | 0.23 b | 1.15 a |
MDHAR (umol mg−1 min−1 protein) | 1.16 b | 1.64 a | 0.79 c | 1.69 a |
DHAR (umol mg−1 min−1 protein) | 7.10 b | 10.73 b | 8.02 b | 17.91 a |
GPX (umol mg−1 min−1 protein) | 0.90 bc | 1.46 ab | 0.82 c | 1.86 a |
GR (umol mg−1 min−1 protein) | 3.89 b | 5.42 a | 4.20 b | 5.99 a |
Gene Name | Forward Primer Sequence | Reverse Primer Sequence |
---|---|---|
CAMTA | ATGGGAGTTGGGCGGTGATG | CATGTTCTCTTCGCCATCAC |
CBL2 | AGACGAGCAAGAAGGAGAGC | CTGAAGCATTTGGGTGAAAC |
CBL4 | TCAAGAAGAACCCGGCATCAC | CCGAATGCATCACAAAGCTCGG |
CBL6 | GACATACCAAATCGTCCCAAG | ATCACACCATCATCAACCACAG |
CIPK2 | TGCATTCCCCTAGTGATGTCTG | CCATACACAAACGCACTGTCC |
CIPK29 | ACGCGCAAGAAGGTCCACTT | ACACGAGCTGGCGGAAGTAA |
CIPK31 | CAGCCCACTGTGGAAGAGC | TTACAACAATCGGCCTTTCGC |
MAPK2C | GATTGTAAGCTCAAAATATGTG | ACATAGTTCAGGTGCTCGGTA |
MAPKflrs | GCAAACTGTGACCTAAAA | ACAGAAGCTCTGGTGCC |
ICE1 | CAACAAGGTCGTAGGAGATG | CCAATCAGCATAAGAAAACG |
ICE4 | CAAGGGCAAGAAGAAGGG | GCGTCACCAAGGATTGAA |
WCOR14 | CGACCACCAGACCCAGACC | CGAGCGGCGAGGAAACAC |
WCOR15 | CTGGTTAGTCGTCCTCTGA | CCTTCTTCAACTCGTCGG |
WCOR18 | GTGGACGCACTGGGTGGTC | ACCTTGTTGCCGAGGCTGA |
WCOR410 | CCTCCTCGGCAACCTCCTC | TCTTGACCTCGGGCTCTTCC |
WCOR413 | GACAAGACGAACTGGAAGA | ACAACAACGAACGCAATC |
Wrab17 | GATGCCACCAAGGAGAAGTC | CTCACTTGTCTCCTCCCATC |
Actin | ACAGTGTCTGGATCGGTGGC | GTGGACAATGCCGGGACCAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Malko, M.M.; Peng, X.; Gao, X.; Cai, J.; Zhou, Q.; Wang, X.; Jiang, D. Effect of Exogenous Calcium on Tolerance of Winter Wheat to Cold Stress during Stem Elongation Stage. Plants 2023, 12, 3784. https://doi.org/10.3390/plants12213784
Malko MM, Peng X, Gao X, Cai J, Zhou Q, Wang X, Jiang D. Effect of Exogenous Calcium on Tolerance of Winter Wheat to Cold Stress during Stem Elongation Stage. Plants. 2023; 12(21):3784. https://doi.org/10.3390/plants12213784
Chicago/Turabian StyleMalko, Maguje Masa, Xinyue Peng, Xing Gao, Jian Cai, Qin Zhou, Xiao Wang, and Dong Jiang. 2023. "Effect of Exogenous Calcium on Tolerance of Winter Wheat to Cold Stress during Stem Elongation Stage" Plants 12, no. 21: 3784. https://doi.org/10.3390/plants12213784
APA StyleMalko, M. M., Peng, X., Gao, X., Cai, J., Zhou, Q., Wang, X., & Jiang, D. (2023). Effect of Exogenous Calcium on Tolerance of Winter Wheat to Cold Stress during Stem Elongation Stage. Plants, 12(21), 3784. https://doi.org/10.3390/plants12213784