Identification of Accurate Reference Genes for qRT-PCR Analysis of Gene Expression in Eremochloa ophiuroides under Multiple Stresses of Phosphorus Deficiency and/or Aluminum Toxicity
Abstract
1. Introduction
2. Results
2.1. Gene-Specific Amplification Efficiency of Candidate Reference Genes
2.2. Expression Levels and Variations of Candidate Reference Genes
2.3. geNorm Analysis
2.4. NormFinder Analysis
2.5. BestKeeper Analysis
2.6. Comprehensive Ranking by RefFinder Analysis
2.7. Validation of Candidate Reference Genes
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Stress Treatments
4.2. RNA Isolation and cDNA Synthesis
4.3. Selection of Candidate Reference Genes and Primer Design
4.4. qRT-PCR Analysis
4.5. Stability of Internal Reference Genes
4.6. Validation of Reference Gene Expression
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Huggett, J.; Dheda, K.; Bustin, S.; Zumla, A. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. 2005, 6, 279–284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Radoni, A.; Thulke, S.; Mackay, I.M.; Landt, O.; Siegert, W.; Nitsche, A. Guideline to reference gene selection for quantitative real-time PCR. Biochem. Biophys. Res. Commun. 2004, 313, 856–862. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ginzinger, D.G. Gene quantification using real-time quantitative PCR. Exp. Hematol. 2002, 30, 503–512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bao, W.; Qu, Y.; Shan, X.; Wan, Y. Screening and Validation of Housekeeping Genes of the Root and Cotyledon of Cunninghamia lanceolata under Abiotic Stresses by Using Quantitative Real-Time PCR. Int. J. Mol. Sci. 2016, 17, 1198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bustin, S.A. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): Trends and problems. J. Mol. Endocrinol. 2002, 29, 23–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, S.Y.; Seo, P.J.; Yang, M.S.; Xiang, F.; Park, C.M. Exploring valid reference genes for gene expression studies in Brachypodium distachyon by real-time PCR. BMC Plant Biol. 2008, 8, 112. [Google Scholar] [CrossRef] [Scilit]
- Dheda, K.; Huggett, J.F.; Chang, J.S.; Kim, L.U.; Bustin, S.A.; Johnson, M.A.; Rook, G.A.; Zumla, A. The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Anal. Biochem. 2005, 344, 141–143. [Google Scholar] [CrossRef] [Scilit]
- Gutierrez, L.; Mauriat, M.; Guénin, S.; Pelloux, J.; Lefebvre, J.F.; Louvet, R.; Rusterucci, C.; Moritz, T.; Guerineau, F.; Bellini, C.; et al. The lack of a systematic validation of reference genes: A serious pitfall undervalued in reverse transcription-polymerase chain reaction (RT-PCR) analysis in plants. Plant Biotechnol. J. 2008, 6, 609–618. [Google Scholar] [CrossRef] [Scilit]
- LøVdal, T.; Lillo, C. Reference gene selection for quantitative real-time PCR normalization in tomato subjected to nitrogen, cold, and light stress. Anal. Biochem. 2009, 387, 238–242. [Google Scholar] [CrossRef] [Scilit]
- Die, J.V.; Román, B.; Nadal, S.; González-Verdejo, C.I. Evaluation of candidate reference genes for expression studies in Pisum sativum under different experimental conditions. Planta 2010, 232, 145–153. [Google Scholar] [CrossRef] [Scilit]
- Hanna, W.W. Centipedegrass—Diversity and Vulnerability. Crop Sci. 1995, 35, 332–334. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Zhao, H.; Guo, H.; Zong, J.; Wang, J. Use of Transcriptomic Analyses to Elucidate the Mechanism Governing Nodal Root Development in Eremochloa ophiuroides (Munro) Hack. Front. Plant Sci. 2021, 12, 659830. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruijter, J.M.; Ramakers, C.; Hoogaars, W.M.H.; Karlen, Y.; Moorman, A.F.M. Amplification Efficiency: Linking Baseline and Bias in the Analysis Of Quantitative PCR Data. Nucleic Acids Res. 2009, 37, e45. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, Research0034. [Google Scholar] [CrossRef] [Scilit]
- De Ketelaere, A.; Goossens, K.; Peelman, L.; Burvenich, C. Technical Note: Validation of Internal Control Genes for Gene Expression Analysis in Bovine Polymorphonuclear Leukocytes. J. Dairy Sci. 2006, 89, 4066–4069. [Google Scholar] [CrossRef] [Scilit]
- Silveira, E.D.; Alves-Ferreira, M.; Guimarães, L.A.; da Silva, F.R.; Carneiro, V.T. Selection of reference genes for quantitative real-time PCR expression studies in the apomictic and sexual grass Brachiaria brizantha. BMC Plant Biol. 2009, 9, 84. [Google Scholar] [CrossRef] [Scilit]
- Marum, L.; Miguel, A.; Ricardo, C.P.; Miguel, C. Reference gene selection for quantitative real-time PCR normalization in Quercus suber. PLoS ONE 2012, 7, e35113. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Tan, Z.; Hu, B.; Yang, Z.; Xu, B.; Zhuang, L.; Huang, B. Selection and validation of reference genes for target gene analysis with quantitative RT-PCR in leaves and roots of bermudagrass under four different abiotic stresses. Physiol. Plant. 2015, 155, 138–148. [Google Scholar] [CrossRef] [Scilit]
- Sasaki, T.; Yamamoto, Y.; Ezaki, B.; Katsuhara, M.; Ahn, S.J.; Ryan, P.R.; Delhaize, E.; Matsumoto, H. A wheat gene encoding an aluminum-activated malate transporter. Plant J. 2004, 37, 645–653. [Google Scholar] [CrossRef] [Scilit]
- Ligaba, A.; Katsuhara, M.; Ryan, P.R.; Shibasaka, M.; Matsumoto, H. The BnALMT1 and BnALMT2 genes from rape encode aluminum-activated malate transporters that enhance the aluminum resistance of plant cells. Plant Physiol. 2006, 142, 1294–1303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoekenga, O.A. AtALMT1, which encodes a malate transporter, is identified as one of several genes critical for aluminum tolerance in Arabidopsis. Proc. Natl. Acad. Sci. USA 2006, 103, 9738–9743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balzergue, C.; Dartevelle, T.; Godon, C.; Laugier, E.; Meisrimler, C.; Teulon, J.M.; Creff, A.; Bissler, M.; Brouchoud, C.; Hagège, A.; et al. Low phosphate activates STOP1-ALMT1 to rapidly inhibit root cell elongation. Nat. Commun. 2017, 8, 15300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wan, D.; Wan, Y.; Yang, Q.; Zou, B.; Ren, W.; Ding, Y.; Wang, Z.; Wang, R.; Wang, K.; Hou, X. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses. PLoS ONE 2017, 12, e0169465. [Google Scholar] [CrossRef] [Scilit]
- Jacob, F.; Guertler, R.; Naim, S.; Nixdorf, S.; Fedier, A.; Hacker, N.F.; Heinzelmann-Schwarz, V. Careful selection of reference genes is required for reliable performance of RT-qPCR in human normal and cancer cell lines. PLoS ONE 2013, 8, e59180. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Xue, J.; Zhu, L.; Hu, H.; Yang, J.; Cui, J.; Xu, J. Selection and Optimization of Reference Genes for MicroRNA Expression Normalization by qRT-PCR in Chinese Cedar (Cryptomeria fortunei) under Multiple Stresses. Int. J. Mol. Sci. 2021, 22, 7246. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Zhu, L.; Xue, J.; Yang, J.; Xu, J. Selection and Verification of Appropriate Reference Genes for Expression Normalization in Cryptomeria fortunei under Abiotic Stress and Hormone Treatments. Genes 2021, 12, 791. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.; Tian, Q.; Huang, W.; Liu, J.; Xia, X.; Yang, X.; Mou, H. Identification and evaluation of reference genes for quantitative real-time PCR analysis in Passiflora edulis under stem rot condition. Mol. Biol. Rep. 2020, 47, 2951–2962. [Google Scholar] [CrossRef] [Scilit]
- Tu, Z.; Hao, Z.; Zhong, W.; Li, H. Identification of Suitable Reference Genes for RT-qPCR Assays in Liriodendron chinense (Hemsl.) Sarg. Forests 2019, 10, 441. [Google Scholar] [CrossRef] [Scilit]
- Thellin, O.; Zorzi, W.; Lakaye, B.; De Borman, B.; Coumans, B.; Hennen, G.; Grisar, T.; Igout, A.; Heinen, E. Housekeeping genes as internal standards: Use and limits. J. Biotechnol. 1999, 75, 291–295. [Google Scholar] [CrossRef] [Scilit]
- Lupberger, J.; Kreuzer, K.A.; Baskaynak, G.; Peters, U.R.; Coutre, P.L.; Schmidt, C.A. Quantitative analysis of beta-actin, beta-2-microglobulin and porphobilinogen deaminase mRNA and their comparison as control transcripts for RT-PCR. Mol. Cell. Probes 2002, 16, 25–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Hu, B.; Tan, Z.; Liu, J.; Yang, Z.; Li, Z.; Huang, B. Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses. Plant Cell Rep. 2015, 34, 1825–1834. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gresner, S.M.; Golanska, E.; Kulczycka-Wojdala, D.; Jaskolski, D.J.; Papierz, W.; Liberski, P.P. Selection of reference genes for gene expression studies in astrocytomas. Anal. Biochem. 2011, 408, 163–165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zainuddin, A.; Chua, K.H.; Abdul Rahim, N.; Makpol, S. Effect of experimental treatment on GAPDH mRNA expression as a housekeeping gene in human diploid fibroblasts. BMC Mol. Biol. 2010, 11, 59. [Google Scholar] [CrossRef] [Scilit]
- Puig-Fàbregas, J.; Alcaraz-Rocha, P.; Fernández, E.; Rotllant, J.; Sobrino, C. Evaluation of actin as a reference for quantitative gene expression studies in Emiliania huxleyi (Prymnesiophyceae) under ocean acidification conditions. Phycologia 2021, 60, 148–157. [Google Scholar] [CrossRef] [Scilit]
- Yan, J.; Chen, J.; Zhang, T.; Liu, J.; Liu, H. Evaluation of Aluminum Tolerance and Nutrient Uptake of 50 Centipedegrass Accessions and Cultivars. HortScience A Publ. Am. Soc. Hortic. Sci. 2009, 44, 857–861. [Google Scholar] [CrossRef] [Scilit]
- Chen, R.F.; Zhang, F.L.; Zhang, Q.M.; Sun, Q.B.; Dong, X.Y.; Shen, R.F. Aluminium-phosphorus interactions in plants growing on acid soils: Does phosphorus always alleviate aluminium toxicity? J. Sci. Food Agr. 2012, 92, 995–1000. [Google Scholar] [CrossRef] [Scilit]
- Maksup, S.; Supaibulwatana, K.; Selvaraj, G. High-quality reference genes for quantifying the transcriptional responses of Oryza sativa L. (ssp. indica and japonica) to abiotic stress conditions. Chin. Sci. Bull. 2013, 58, 1919–1930. [Google Scholar] [CrossRef] [Scilit]
- Sudhakar Reddy, P.; Srinivas Reddy, D.; Sivasakthi, K.; Bhatnagar-Mathur, P.; Vadez, V.; Sharma, K.K. Evaluation of Sorghum [Sorghum bicolor (L.)] Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization. Front. Plant Sci. 2016, 7, 529. [Google Scholar] [CrossRef] [Scilit]
- Andersen, C.L.; Jensen, J.L.; Rntoft, T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, F.; Xiao, P.; Chen, D.; Xu, L.; Zhang, B. miRDeepFinder: A miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol. Biol. 2012, 80, 75–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Gene | Primer Sequence (5’ to 3’) | Tm (°C) | Amplification Size (bp) | Mean Efficiency | R |
|---|---|---|---|---|---|
| ACT | TGCATACGTTGCGCTCGACTA | 62.8 | 155 | 1.863 | 0.9999 |
| CGATGAAGGATGGCTGGAAGA | 62.3 | ||||
| TUB | GCTTTCCTCGTATGCTCCTGTG | 61.6 | 220 | 1.880 | 0.9995 |
| GATGGTGCGCTTGGTCTTGAT | 62.3 | ||||
| GAPDH | TTGAAGGGTGGTGCCAAGAAG | 62.4 | 120 | 1.843 | 0.9999 |
| AGCAAGAGGAGCAAGGCAGTT | 60.9 | ||||
| TIP41 | ATACTGTGGGAGTGATGCTGTG | 57.4 | 157 | 1.852 | 0.9997 |
| CAAGATAACCTCGTCGTAGAAA | 54.6 | ||||
| CACS | TAAGATGTGATGTGACGGGAAAG | 59.4 | 226 | 1.859 | 0.9997 |
| TCTGGTGGCACGAAACTGACT | 60.3 | ||||
| HNR | GTTGTTGATCGTGCGACTCCG | 63.6 | 204 | 1.931 | 0.9998 |
| TATCTTCTTGCCCACTGCTTG | 58.2 | ||||
| EP | GAGACCGATCTCAACGAGGCT | 60.7 | 223 | 2.000 | 0.9999 |
| TGCGCTTGGTGACATACATTAGG | 62.7 | ||||
| EF1α | GGATCTGAAGCGTGGGTATGT | 58.9 | 239 | 1.868 | 0.9999 |
| CACCGTTCTTGAGGAATTTGG | 59.7 | ||||
| EIF4α | GACTATTTGGGTGTCAAAGTGC | 56.6 | 207 | 1.874 | 0.9997 |
| ATCCTTGAATCCACGGGAAAG | 60.5 | ||||
| PP2A | ATTCAACCATACAAATGGGCTAAG | 59.8 | 194 | 1.867 | 0.9996 |
| CTGGGTCGAATTGGAGGAAGT | 60.5 | ||||
| actin | GCACGGAATCGTCAGCAA | 58.1 | 288 | 1.923 | 0.9934 |
| CCCTCGTAGATGGGGACAGT | 58.6 |
| Rank | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Total | GAPDH | TIP41 | HNR | PP2A | CACS | EIF4α | ACT | EP | EF1α | TUB | actin |
| WR | CACS | PP2A | EP | EF1α | GAPDH | TIP41 | EIF4α | HNR | ACT | TUB | actin |
| PR | EF1α | CACS | EP | GAPDH | TIP41 | HNR | PP2A | EIF4α | TUB | ACT | actin |
| AR | CACS | EF1α | EIF4α | PP2A | TIP41 | TUB | GAPDH | HNR | EP | ACT | actin |
| MR | CACS | EP | PP2A | ACT | TUB | GAPDH | TIP41 | EF1α | EIF4α | actin | HNR |
| WS | GAPDH | EIF4α | HNR | EP | CACS | actin | ACT | PP2A | TIP41 | EF1α | TUB |
| PS | TIP41 | ACT | GAPDH | EIF4α | PP2A | EP | HNR | CACS | actin | EF1α | TUB |
| AS | GAPDH | CACS | PP2A | EIF4α | ACT | TIP41 | HNR | actin | EP | EF1α | TUB |
| MS | GAPDH | ACT | TIP41 | HNR | EP | actin | CACS | EIF4α | EF1α | PP2A | TUB |
| WL | PP2A | TIP41 | HNR | GAPDH | CACS | EP | ACT | TUB | EIF4α | actin | EF1α |
| PL | GAPDH | TIP41 | HNR | PP2A | TUB | EIF4α | CACS | ACT | EP | EF1α | actin |
| AL | GAPDH | HNR | TIP41 | CACS | TUB | actin | ACT | EF1α | EP | PP2A | EIF4α |
| ML | CACS | TIP41 | EP | actin | ACT | PP2A | GAPDH | HNR | EIF4α | TUB | EF1α |
| WR | PR | AR | MR | ||||
| Most | Least | Most | Least | Most | Least | Most | Least |
| CACS | actin | EF1α | actin | CACS | actin | CACS | HNR |
| PP2A | CACS | EF1α | EP | ||||
| WS | PS | AS | MS | ||||
| Most | Least | Most | Least | Most | Least | Most | Least |
| GAPDH | TUB | TIP41 | TUB | GAPDH | TUB | GAPDH | TUB |
| EIF4α | ACT | CACS | ACT | ||||
| PP2A | TIP41 | ||||||
| EIF4α | |||||||
| WL | PL | AL | ML | ||||
| Most | Least | Most | Least | Most | Least | Most | Least |
| PP2A | EF1α | GAPDH | actin | GAPDH | EIF4α | CACS | EF1α |
| TIP41 | TIP41 | HNR | TIP41 | ||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; He, Q.; Li, X.; Zhang, Y.; Li, J.; Zhang, L.; Yao, X.; Zhang, X.; Liu, C.; Wang, H. Identification of Accurate Reference Genes for qRT-PCR Analysis of Gene Expression in Eremochloa ophiuroides under Multiple Stresses of Phosphorus Deficiency and/or Aluminum Toxicity. Plants 2023, 12, 3751. https://doi.org/10.3390/plants12213751
Chen Y, He Q, Li X, Zhang Y, Li J, Zhang L, Yao X, Zhang X, Liu C, Wang H. Identification of Accurate Reference Genes for qRT-PCR Analysis of Gene Expression in Eremochloa ophiuroides under Multiple Stresses of Phosphorus Deficiency and/or Aluminum Toxicity. Plants. 2023; 12(21):3751. https://doi.org/10.3390/plants12213751
Chicago/Turabian StyleChen, Ying, Qingqing He, Xiaohui Li, Yuan Zhang, Jianjian Li, Ling Zhang, Xiang Yao, Xueli Zhang, Chuanqiang Liu, and Haoran Wang. 2023. "Identification of Accurate Reference Genes for qRT-PCR Analysis of Gene Expression in Eremochloa ophiuroides under Multiple Stresses of Phosphorus Deficiency and/or Aluminum Toxicity" Plants 12, no. 21: 3751. https://doi.org/10.3390/plants12213751
APA StyleChen, Y., He, Q., Li, X., Zhang, Y., Li, J., Zhang, L., Yao, X., Zhang, X., Liu, C., & Wang, H. (2023). Identification of Accurate Reference Genes for qRT-PCR Analysis of Gene Expression in Eremochloa ophiuroides under Multiple Stresses of Phosphorus Deficiency and/or Aluminum Toxicity. Plants, 12(21), 3751. https://doi.org/10.3390/plants12213751

