Next Article in Journal
Hormonal Interplay Leading to Black Knot Disease Establishment and Progression in Plums
Previous Article in Journal
Bacillus velezensis ZN-S10 Reforms the Rhizosphere Microbial Community and Enhances Tomato Resistance to TPN
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Cytokinins BAP and 2-iP Modulate Different Molecular Mechanisms on Shoot Proliferation and Root Development in Lemongrass (Cymbopogon citratus)

by
María del Rosario Cárdenas-Aquino
1,†,
Alberto Camas-Reyes
1,†,
Eliana Valencia-Lozano
1,
Lorena López-Sánchez
2,
Agustino Martínez-Antonio
1,* and
José Luis Cabrera-Ponce
1,*
1
Departamento de Ingeniería Genética, Cinvestav Irapuato, Km. 9.6 Libramiento Norte Carr. Irapuato-León, Irapuato Gto 36824, Mexico
2
Red de Estudios Moleculares Avanzados, Unidad de Microscopia Avanzada, Instituto de Ecología, A.C. INECOL 1975–2023, Carretera antigua a Coatepec 351, Col. El Haya, Xalapa 91073, Mexico
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Plants 2023, 12(20), 3637; https://doi.org/10.3390/plants12203637
Submission received: 8 September 2023 / Revised: 16 October 2023 / Accepted: 18 October 2023 / Published: 21 October 2023

Abstract

The known activities of cytokinins (CKs) are promoting shoot multiplication, root growth inhibition, and delaying senescence. 6-Benzylaminopurine (BAP) has been the most effective CK to induce shoot proliferation in cereal and grasses. Previously, we reported that in lemongrass (Cymbopogon citratus) micropropagation, BAP 10 µM induces high shoot proliferation, while the natural CK 6-(γ,γ-Dimethylallylamino)purine (2-iP) 10 µM shows less pronounced effects and developed rooting. To understand the molecular mechanisms involved, we perform a protein–protein interaction (PPI) network based on the genes of Brachypodium distachyon involved in shoot proliferation/repression, cell cycle, stem cell maintenance, auxin response factors, and CK signaling to analyze the molecular mechanisms in BAP versus 2-iP plants. A different pattern of gene expression was observed between BAP- versus 2-iP-treated plants. In shoots derived from BAP, we found upregulated genes that have already been demonstrated to be involved in de novo shoot proliferation development in several plant species; CK receptors (AHK3, ARR1), stem cell maintenance (STM, REV and CLV3), cell cycle regulation (CDKA-CYCD3 complex), as well as the auxin response factor (ARF5) and CK metabolism (CKX1). In contrast, in the 2-iP culture medium, there was an upregulation of genes involved in shoot repression (BRC1, MAX3), ARR4, a type A-response regulator (RR), and auxin metabolism (SHY2).

1. Introduction

Cymbopogon citratus (DC.) Stapf (lemongrass) is a member of the family Poaceae (https://www.itis.gov/), which is widely distributed in the tropical and subtropical regions of Africa, Asia, and America [1]. The annual world production of lemongrass oil is around 1000 tons from an area of 16,000 ha. The crop is extensively cultivated in marginal and waste lands and also along the borders as live much. The major share of lemongrass oil produced in the world is either from Cymbopogon flexuosus or from C. citratus [2]. Lemongrass is known for its high content of essential oils, such as citral, geraniol, citronellol, citronellal, linalool, elemol, 1,8-cineole, limonene, β-caryophyllene, methyl heptanone, and geranyl acetate/formate [3,4], as well as for its applications as a medicinal supplement, insect repellent, insecticide, perfumery, and pharmaceuticals [1,5,6]. Plant micropropagation via a shoot apex culture supplemented with 6-Benzylaminopurine (BAP) has been the most effective cytokinin (CK) in grasses; little bluestem (Schizachyrium scoparium L.) [7], vetiver grass [8], Cymbopogon schoenanthus [9], switchgrass (Panicum virgatum L.) [10], finger millet (Eleusine coracana (L.) Gaertn.) [11], Pennisetum purpureum [12], Pennisetum × advena ‘Rubrum’ [13], and cereals; as well as rice [14], wheat [15], wheat, durum wheat, oat, barley, triticale [16], and sorghum [17].
We have previously reported that, when using an MS medium supplemented with BAP 10 µM, 5% sucrose, and 5 g/L gelriteTM, a high shoot proliferation was induced (23.3 shoots/explant) [4]. In contrast, when using the natural CK 6-(γ,γ-Dimethylallylamino)purine (2-iP) 10 µM, the expected activation of shoots was substantially decreased (8.8 shoots/explant) and rooting developed in one step [4]. In this scenario, two different molecular mechanisms were activated under the BAP and 2-iP culture media in the lemongrass tissue culture. To understand the differences between the BAP and 2-iP effects in lemongrass, we reconstructed a network using the STRING database v11.5 [18] with the genes involved in shoot proliferation/repression, stem cell maintenance, CK signaling, cell cycle, and auxin signaling, based on the Brachypodium distachyon homologous genes present in the Arabidopsis thaliana genome (Figure 1). We analyzed 13 genes that are involved in CK signaling (AHK3, ARR1, and ARR4), stem cell maintenance (STM, REV, and CLV3), cell cycle regulation (CDKA-CYCD3 complex), auxin signaling (ARF5), CK metabolism (CKX1), shoot repression (BRC1 and MAX3), and auxin signaling repressor (SHY2) for RT-qPCR analysis. Gene expression analysis revealed that in the BAP culture medium (CM), the genes involved in shoot proliferation, such as CK signaling (AHK3, ARR1), stem cell maintenance (STM, REV, and CLV3), cell cycle regulation (CDKA-CYCD3 complex), auxin signaling (ARF5), and CK metabolism (CKX1), were higher upregulated. In contrast, in 2-iP CM, there was an upregulation of genes involved in shoot repression (BRC1 and MAX3), auxin (SHY2), and CK signaling activating the A-type response regulator (RR) ARR4.
The goal of this study was to elucidate the molecular mechanisms that BAP uses to activate shoot proliferation and 2-iP root development in lemongrass (C. citratus).

2. Results

2.1. Shoot Proliferation

Lemongrass plants grown in a medium supplemented with BAP 10 µM, 5% sucrose, and 5 g/L gelriteTM are consistent with the canonical effects of CKs developed 23.3 shoots per initial explant after 2 months in culture (Figure 2A).
In contrast, in a medium supplemented with 2-iP 10 µM, 5% sucrose, and 5 g/L gelriteTM, fewer amounts of shoots were produced (8.8 shoots) and it also developed thick, red-pigmented roots in a single step of culture (Figure 2B).
We performed histological analysis of longitudinal sections of roots from both CKs in which a higher number of axillary meristems (AMs) were observed in plants grown on BAP 10 µM compared to the 2-iP 10 µM CM (Figure 2C,D).
Several publications indicate that high levels of CK promote shoot growth and suppress root formation. However, our results suggest a different role in 2-iP inducing roots (Figure 2B). Plants grown on BAP 10 µM did not produce roots (Figure 2A). Instead, in plants grown on 2-iP 10 µM, the root phenotypes were thicker and pigmented, possibly due to the biosynthesis of anthocyanins (Figure 2B).

2.2. Histology of C. citratus Roots

Roots derived from 2-iP plants are red pigmented and four times thicker than control (Ctrl) lemongrass roots (Figure 3). Longitudinal sections of C. citratus from root tips (RT) showed a root cap (calyptra) composed by several layers of cells containing statocytes (statenchyma); root cap (RC); cortex (CX); protodermis (PD); quiescent center (QC); distal meristem (DM); pith (P); meristem zone (MZ); and elongation zone (EZ) (Figure 3B,D). The cells from the RT derived from 2-iP have nuclei (3.76 µm), nucleolus (2.42 µm), and cell area of 107.07 µm2 (Figure 3A,B) (Table 1). In contrast, RT cells derived from Ctrl roots contain smaller nuclei (3.2 µm), nucleolus (1.88 µm) and cell area of 63.36 µm2 (Figure 3C,D) (Table 1).

2.3. Gene Expression Analysis

We analyzed the expression of 13 genes (AHK3, ARR1, ARR4, STM, REV, CLV3, CDKA, CYCD3, ARF5, SHY2, CKX1, BRC1, and MAX3) (Figure 1) via RT-qPCR. A different pattern expression was observed in plants grown on BAP compared to those grown on 2-iP (Figure 2 and Figure 4), confirming that CKs modulates shoot proliferation and root development.

2.3.1. CK Signaling Genes

The expression of AHK3 and the B-type RR ARR1 were upregulated in BAP CM (2.8 and 3.5 folds, respectively) compared to 2-iP CM (0.4 and 0.3 folds, respectively), while upregulation of the A-type RR, ARR4, was found in 2-iP-treated plants (5 fold) compared to BAP (0.2 fold) (Figure 4).

2.3.2. Stem Cell Maintenance Genes

The analysis revealed that the levels of STM, CLV3, and REV were higher in BAP CM (4.7, 3.2, and 2.8 folds, respectively) compared to 2-iP CM (0.2, 0.3, and 0.4 folds, respectively) (Figure 4).

2.3.3. Cell Cycle Regulation Genes

The CDKA-CYCD3 complex remained upregulated in the BAP CM (2.1 and 1.6 folds, respectively) compared to the 2-iP CM (0.5 and 0.6 folds, respectively) (Figure 4).

2.3.4. Auxin Signaling Gene

The ARF5 expression was revealed to be the most highly upregulated gene in BAP CM (5.4 fold) compared to the treatment with 2-iP (0.2 fold) (Figure 4).

2.3.5. Auxin Signaling Repressor Gene

The analysis reveals that SHY2 was the most upregulated gene in 2-iP CM (3.5 fold) compared to the treatment with BAP (0.3 fold) (Figure 4).

2.3.6. CK Metabolism Gene

The CKX1 expression remains upregulated in BAP CM (3.2 fold) compared to the CM with 2-iP (0.3 fold) (Figure 4).

2.3.7. Shoot Proliferation Repressor Genes

The analysis revealed that the levels of BRC1 and MAX3 remained elevated in the 2-iP CM (1.7 and 1.8 folds, respectively) when compared to the BAP CM (0.6 and 0.6 folds, respectively) (Figure 4).

3. Discussion

CKs have been mainly used in plant micropropagation, including Poaceae members like cereals and grasses, due to the positive regulation of shoot and the negative regulation of root development [19,20,21].
The known molecular mechanisms of CKs (zeatin, 2-iP and BAP) rely on the two-component CK signaling [22,23,24,25], cell cycle regulation [26], direct binding with type-B RRs [27], RNA, proteins, ribosomal proteins, and polyribosomes synthesis [28,29,30,31,32,33,34]. Furthermore, CKs are inhibitors of senescence by downregulating several transcription factors (TFs) [35] involved in several types of stress (drought, osmotic, salt, temperature, and oxidative) and crosstalk during plant stress with ABA and jasmonic acid.
Based on that, we aimed to understand by using a PPI network STRINGv11.5 database containing the molecular mechanisms involved in lemongrass grown in the high shoot proliferation medium (BAP 10 µM) versus the low shoot proliferation and root development medium (2-iP 10 µM) (Figure 2 and Figure 5).
The interpretation of the molecular mechanism found in this work is as follows:

3.1. Cytokinin Signaling

Interestingly, we found that different molecular mechanisms between BAP and 2-iP relied on CK signaling, specifically with the type of RRs. Type-A RRs evolved with land plants, indicating that their signaling pathway and negative feedback regulation were established simultaneously to activate vascularization and root development, whereas type-B RRs were already present, advocating that they had CK-independent functions [36].
In our analysis, AHK3 and ARR1 were higher expressed in BAP than the 2-iP-containing medium and in agreement with our results, where BAP has been demonstrated to be involved in the expression/mutant restitution of type-B RRs that function as repressors of root development [27,37,38,39,40,41,42,43] (Figure 4 and Figure 5).
Type-B PeRR12 is a negative regulator of root development in poplar, repressing the WUSCHEL-related homeobox PeWOX5, which is involved in the maintenance of the stem cells in the root apical meristem (RAM), and PeWOX11, which interacts with the auxin signaling pathway regulating the founder cells during de novo root regeneration [44]. PeRR12 also represses PePIN1 and PePIN3 transcripts, two auxin efflux carriers involved in root and shoot development [45].
Type-B PtRR13 is a negative regulator of root development in Populus. A transcriptome analysis showed that it altered the expression levels of RING1, a negative regulator of vascularization, PDR9, an auxin efflux transporter, and also two apetala/ethylene responsive factors [46].
In our analysis AHK3 was expressed lower and ARR4 higher in the 2-iP-containing medium. 2-iP has demonstrated to be involved in the expression of type-A RRs that function as activators of root development (Figure 4 and Figure 5). Roots developed in 2-iP were pigmented and four times thicker than normal lemongrass roots. The histological analysis from RT revealed that they contain a prominent root cap (RC) composed by several layers of cells containing statocytes (statenchyma), CX, PD, QC, DM, P, MZ, and EZ.
When cultured in a 2,4-D-containing medium, the explants of roots from 2-iP were capable of developing the somatic embryogenesis process while in normal roots, it was not possible.
However, the BAP-containing medium activates B-type RRs, TFs involved in shoot proliferation, and root inhibition.
Type-A RRs contribute to the correct function of RAM, regulating post-transcriptionally PIN auxin efflux carriers. Transcriptome analysis of Arabidopsis-treated plants with 2-iP revealed the upregulation of genes involved in photosynthesis, ribosome biogenesis, CK responsive factors, several type-A RRs (ARR3,-4,-6,-7,-8,-9,-15,-17), while senescence and catabolism genes were downregulated [35].
The overexpression of type-A RRs in Arabidopsis substantially increased lateral root development and inhibits shoot development in ARR3,-5,-6,-16 and -17 when supplemented with 2-iP, where mutated type-A RRs led to reduced root architecture [47]. The RcRR1, a type-A RRs of Rosa canina, has been found to be involved in CK-modulated rhizoid organogenesis [48].
Successful rooting from shoots using 2-iP has been observed in date palm [49], amaryllis [50], sweet cherry [51], and apple [52,53]. Moreover, 2-iP is involved in nitrogen signaling and regulates root architecture and development by modulating polar auxin transport and vascular patterning in the root meristem [54].
CK signaling loss correlates with a reduced meristem size, whereas enhanced cytokinin action stimulates meristem activity. The shoot architecture is normally promoted in the stem cells located in the central zone of the shoot apical meristem (SAM) [55,56,57].
Accordingly, STM, CLV3, and REV genes involved in stem cell maintenance, AMs initiation, and shoot proliferation regulation were upregulated in BAP compared to 2-iP-treated shoots. High levels of the expression of STM activates stem cell maintenance in plant meristems [58,59,60,61,62], CK biosynthesis [63,64], meristem initiation, and AMs development [65,66,67] (Figure 5).
CLV3 is involved in maintaining the stem cell population in the SAM and is central to continuing shoot growth [68]. The TF REV gene regulates the STM expression [67] and is an activator of shoot proliferation, where REV mutants develop fewer shoots [69].

3.2. Cell Cycle

The CK BAP induces the CYCD3 expression at the G1-S cell cycle phase transition, showing that CYCD3 induction may be a direct response to BAP or an indirect response of cells reaching a particular position in the cell cycle under the influence of BAP [70], where the same occurred in our results with BAP at the concentration of 10 μM (Figure 4 and Figure 5). CYCD3-1 forms a complex with CDKA, which is required for the maintenance of undifferentiated cells in the SAM [71,72], determines the cell number and expansion in developing lateral organs (shoots), and mediates CK effects in apical growth and development [73] (Figure 5).

3.3. BRC1 Shoot Repressor

In our results, we found that BAP activates poorly BRC1 compared to 2-iP (Figure 4 and Figure 5), as described by Xu et al. [74], in which the formation of mutant phenotypes in Panicum virgatum L. is rescued via the BAP application. In another example, the work of Lewis et al. [75] showed that the overexpression of BRC1 results in a reduced number of shoots. BRC1 encodes a shoot growth inhibitory TF [76], which in 2-iP (10 μM), its relative expression was elevated compared to BAP (10 μM) and the associated plant phenotypes show fewer AMs, but with developed roots (Figure 2).

3.4. SHY2 (IAA3/Short Hypocotyl 2)

CKs cooperate with other plant growth regulators to regulate root meristem development; for example, the SHY2 gene is an essential axis of the interaction between CKs, auxin, and brassinosteroids (BR) [77,78]; it is therefore upregulated after the CM with 2-iP (Figure 5).
The expression of SHY2 upon 2-iP CM negatively regulates polar auxin transport carried out via PIN, redistributes the auxin concentration, and induces cell proliferation. Alternatively, auxin and CK are regulated via antagonism in the meristematic and differentiation zones of the roots to control the meristem size [79].

3.5. Strigolactone (SL) Biosynthesis

MAX3 and BRC1, which are involved in SL biosynthesis and repress shoot proliferation, were upregulated in 2-iP CM (Figure 4 and Figure 5). The exogenous supply of SL can upregulate the BRC1 expression independently of any new protein synthesis, suggesting that BRC1 is the most direct target of SL signaling [80,81]. MAX3 transcript profiling revealed that the upregulation of SL biosynthetic genes was indirectly triggered by CKs and led to the activation of the BRC1 expression [82].

3.6. CK Oxidase/Dehydrogenase

Exposure to 10 μM BAP caused the induction of the CK oxidase/dehydrogenase gene CKX1, which was also reported in the work of Vylíčilová et al. [83], suggesting that BAP has an independent mode of action or may act as a negative regulator of CK perception by upregulating specific genes, such as CKX1 to balance the endogenous CK concentration (Figure 4 and Figure 5).

3.7. Auxin Response Factor

ARF5 is an auxin response factor that regulates auxin-responsive elements (Figure 5). It plays a crucial role in plant development, especially in embryonic development, cell differentiation, and organogenesis [84]. Mutations result in a defective embryo and SAM development [84].

4. Materials and Methods

4.1. Shoot Proliferation of Lemongrass (C. citratus)

C. citratus plants were cultivated under standard in vitro conditions under a 16/8 h light/dark photoperiod, according to Camas-Reyes et al. [4]. Two week-old germinated seedlings of lemongrass (C. citratus) on an MS medium [85] supplemented with 1% sucrose, at pH 5.8 were subcultured in two different CM: an MS medium supplemented with BAP 10 µM, 5% sucrose, 5 g/L gelriteTM, at pH 5.8, and an MS medium supplemented with 2-iP 10 µM, 5% sucrose, 5 g/L gelriteTM, at pH 5.8.

4.2. Histology of C. citratus Shoots and Roots

Shoots and roots of C. citratus were randomly selected (10 samples of BAP CM and 10 samples of 2-iP CM for shoot histology; 10 samples of 2-iP CM and 10 samples of control CM for root histology). These were fixed in FAE (5% formaldehyde, 10% acetic acid, and 50% ethanol), followed by dehydration in a series of ethanol dilutions (20%, 40%, 60%, 80%, and 100% ethanol) for 2 h each. Shoot samples were embedded in Technovit 7100 (Heraeus Kulzer, Hesse-Hanau, Deu) and root samples in a mix of acetonitrile/Spurr EMS (Hatfield, UK) following the manufacturer’s instructions. Shoot sections (14 μm) were obtained on a rotary microtome (Reichert-Jung 2040, Leica (Hernalser Hauptstrasse, Vienna); and the root semithin sections (500 nm) with a Leica EM UC7 ultramicrotome Leica (Hernalser Hauptstrasse, Vienna). Tissue sections were stained with a 0.02% toluidine blue solution (HYCEL, Zapopan, Mexico) for 3 min, washed with distilled water for 1 min, and then air dried [86]. Shoot images were taken with a DM6000B microscope (Leica) and root photos were taken with a DMi8 inverted microscope (Leica). The open source image processing software FIJI (Fiji Is Just ImageJ), based on ImageJ2 [87], was used.

4.3. Isolation of RNA and Real Time Gene Expression Analysis

Total RNA was isolated from the shoots derived from cultures containing BAP and/or 2-iP using Trizol (Invitrogen, Carlsbad, CA, USA). The RNA concentration was measured using its absorbance at 260 nm, where a ratio of 260 nm/280 nm was assessed and its integrity was confirmed via electrophoresis in agarose 1% (w/v) gels. The samples of cDNA were amplified via RT-qPCR using Maxima SYBR Green/ROX qPCR (Thermo Scientific, Waltham, MA, USA) in a Real-Time PCR System (CFX96 BioRad). Elongation factor 1α (EF1α), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and actin (ACT) were used as reference genes for qPCR normalization [88] (Table 2).
Retfinder, NormFinder, Bestkeeper, and Delta-Ct analyses were used. Three replicates were created for each of these reference genes, where the relative expression and weighted Ct. were calculated. Next, a Delta-Ct of each gene and the relative amount of target gene expression were analyzed using the 2−ΔΔCt method [89]. RT-qPCR analysis was based on at least three biological replicates with three technical repetitions for each sample and the control treatment.
To select the genes, a PPI network with a medium confidence (0.4) was performed with STRING (v11.5, http://string-db.org), based on the B. distachyon homologous genes present in the A. thaliana genome (Figure 1). The selected genes to be followed by RT-qPCR were AHK3 (Histidine kinase 3); ARR1 (Response regulator 1); ARR4 (Response regulator 4); STM (Shoot meristemless); REV (Revoluta); CLV3 (Clavata 3); CDKA (Cyclin-dependent kinase A1); CYCD3 (Cyclin D3); ARF5 (Monopteros); SHY2 (Short hypocotyl 2); CKX1 (CK oxidase/dehydrogenase 1); BRC1 (Branched 1); and MAX3 (Carotenoid cleavage dioxygenase 7, CCD7) (Table 2).
The gene identifier was made according to UniProt (http://www.uniprot.org) and NCBI (http://www.ncbi.nlm.nih.gov) databases. Sequences of B. distachyon genes were analyzed using blastN and blastP. Oligonucleotides were designed for qPCR (2−ΔΔCt method analysis) gene expression or transcriptional analysis.

5. Conclusions and Perspectives

In lemongrass (C. citratus), shoots developed in the BAP-containing medium drive the mechanisms to activate gene expression for AMs; stem cell maintenance mediated by STM, REV, and CLV3; CK metabolism CKX1; CK signaling mediated by AHK3, ARR1; cell cycle progression by CDKA-CYCD3; and auxin signaling by ARF5.
Plants developed in 2-iP showed higher expression levels in the genes involved in root development; MAX3; BRC1, a major shoot repressor; SHY2 and ARR4.
The molecular mechanisms of BAP activating ARR1 (B-type RRs) to produce shoots and repress root development are in agreement with the high shoot proliferation in C. citratus.
The molecular mechanisms of 2-iP activating ARR4 (A-type RRs) to produce roots and repress shoot proliferation are in agreement with the 2-iP phenotype showed in C. citratus.
Further experiments on transcriptomic/proteomic/metabolomics analysis are required to satisfactorily corroborate our findings.

Author Contributions

Conceptualization, A.C.-R. and J.L.C.-P.; formal analysis L.L.-S.; funding acquisition, A.M.-A.; investigation, M.d.R.C.-A.; methodology, A.C.-R. and J.L.C.-P.; resources, A.M.-A. and J.L.C.-P.; validation, E.V.-L.; visualization, M.d.R.C.-A. and J.L.C.-P.; writing–original draft M.d.R.C.-A., A.C.-R. and J.L.C.-P.; writing–review and editing M.d.R.C.-A., A.C.-R., A.M.-A. and J.L.C.-P. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financed through the framework agreement CEIA/CEC/IRA/20220408/006 for collaboration in a research project between Ingredientes Especializados S.A. de C.V. and CINVESTAV-Irapuato.

Data Availability Statement

The datasets supporting the conclusions of this article are included within the article.

Acknowledgments

We would like to thank Ingredientes Especializados S.A. de C.V., especially to Francisco Javier Martínez Vela and Julio César Limón Gutiérrez for financing the research project. M.d.R.C.-A. is grateful for the grant support from “CONACYT-Estancias Posdoctorales por México”. The authors thank Alex Bermúdez-Valle for his help in seed sterilization, and to Elsa García-Vázquez and Osiel Recoder-Meléndez for their help in media preparation.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Avoseh, O.; Oyedeji, O.; Rungqu, P.; Nkeh-Chungag, B.; Oyedeji, A. Cymbopogon species; Ethnopharmacology, Phytochemistry and the Pharmacological Importance. Molecules 2015, 20, 7438–7453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Skaria, B.P.; Joy, P.P.; Mathew, S.; Mathew, G. 24—Lemongrass. In Handbook of Herbs and Spices; Peter, K.V., Ed.; Woodhead Publishing Series in Food Science, Technology and Nutrition; Woodhead publishing: Cambridge, England, 2006; Volume 3, pp. 400–419. [Google Scholar] [CrossRef] [Scilit]
  3. Ganjewala, D.; Luthra, R. Essential Oil Biosynthesis and Regulation in the Genus Cymbopogon. Nat. Prod. Commun. 2010, 5, 163–172. [Google Scholar] [CrossRef] [Scilit]
  4. Camas-Reyes, A.; Vuelvas-Nolasco, R.; Cabrera-Ponce, J.L.; Pereyra-Alférez, B.; Molina-Torres, J.; Martínez-Antonio, A. Effect of Different Cytokinins on Shoot Outgrowth and Bioactive Compounds Profile of Lemograss Essential Oil. Int. J. Plant Biol. 2022, 13, 298–314. [Google Scholar] [CrossRef] [Scilit]
  5. Khanuja, S.P.S.; Shasany, A.K.; Pawar, A.; Lal, R.K.; Darokar, M.P.; Naqvi, A.A.; Rajkumar, S.; Sundaresan, V.; Lal, N.; Kumar, S. Essential oil constituents and RAPD markers to establish species relationship in Cymbopogon Spreng. (Poaceae). Biochem. Syst. Ecol. 2005, 33, 171–186. [Google Scholar] [CrossRef] [Scilit]
  6. Aibinu, I.; Adenipekun, T.; Adelowowtan, T.; Ogunsanya, T.; Ogungbemi, T. Evaluation of the antimicrobial properties of different parts of Citrus aurantifolia (lime fruit) as used locally. Afr. J. Tradit. Complement. Altern. Med. 2007, 4, 185–190. [Google Scholar]
  7. Hawkins, S.M.; Robacker, C.D. Micropropagation of Little Bluestem (Schizachyrium scoparium L.). Hortscience 2019, 54, 348–352. [Google Scholar] [CrossRef] [Scilit]
  8. Sompornpailin, K.; Khunchuay, C. Synergistic effects of BAP and kinetin media additives on regeneration of vetiver grass (Vetiveria zizanioides L. Nash). Aust. J. Crop Sci. 2016, 10, 726–731. [Google Scholar] [CrossRef] [Scilit]
  9. Abdelsalam, A.; Mahran, E.; Chowdhury, K.; Boroujerdi, A.; El-Bakry, A. NMR-based metabolomic analysis of wild, greenhouse, and in vitro regenerated shoots of Cymbopogon schoenanthus subsp. proximus with GC-MS assessment of proximadiol. Physiol. Mol. Biol. Pla. 2017, 23, 369–383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Alexandrova, K.S.; Denchev, P.D.; Conger, B.V. Micropropagation of switchgrass by node culture. Crop Sci. 1996, 36, 1709–1711. [Google Scholar] [CrossRef] [Scilit]
  11. Satish, L.; Ceasar, S.A.; Shilpha, J.; Rency, A.S.; Rathinapriya, P.; Ramesh, M. Direct plant regeneration from in vitro-derived shoot apical meristems of finger millet (Eleusine coracana (L.) Gaertn.). In Vitro Cell. Dev. Biol. Plant 2015, 51, 192–200. [Google Scholar] [CrossRef] [Scilit]
  12. Karasawa, M.M.G.; Pinto, J.E.B.P.; Pereira, A.V.; Pinto, J.C.; Silva, F.G. In Vitro Propagation of Pennisetum purpureum Schum. In International Grassland Congress, Sao Paulo, Brazil, 2021. Available online: https://uknowledge.uky.edu/igc/19/13/11/ (accessed on 1 September 2023).
  13. Pożoga, M.; Olewnicki, D.; Wójcik-Gront, E.; Latocha, P. An Efficient Method of Pennisetum × advena ‘Rubrum’ Plantlets Production Using the Temporary Immersion Bioreactor Systems and Agar Cultures. Plants 2023, 12, 1534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Nautiyal (nee Gairi), A.; Rashid, A.; Agnihotri, A. Induction of multiple shoots in Oryza sativa: Roles of thidiazuron, 6-benzylaminopurine, decapitation, flooding, and Ethrel® treatments. In Vitro Cell. Dev. Biol. Plant 2022, 58, 1126–1137. [Google Scholar] [CrossRef] [Scilit]
  15. Tanzarella, O.A.; Greco, B. Clonal propagation of Triticum durum DESF. from immature embryos and shoot base explants. Euphytica 1985, 34, 273–277. [Google Scholar] [CrossRef] [Scilit]
  16. Ganeshan, S.; Chodaparambil, S.V.; Båga, M.; Fowler, D.B.; Hucl, P.; Rossnagel, B.G.; Chibbar, R.N. In vitro regeneration of cereals based on multiple shoot induction from mature embryos in response to thidiazuron. Plant Cell Tissue Organ Cult. 2006, 85, 63–73. [Google Scholar] [CrossRef] [Scilit]
  17. Pola, S.; Saradamani, N.; Ramana, T. Enhanced shoot regeneration in tissue culture studies of Sorghum bicolor. Int. J. Agr. Technol. 2007, 3, 275–286. Available online: http://www.ijat-aatsea.com/pdf/Nov_V3_no2_07/11-IJAT2007_20-P%20275-286.pdf (accessed on 1 September 2023).
  18. Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING database in 2021: Customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef] [Scilit]
  19. Skoog, F.; Miller, C.O. Chemical regulation of growth and organ formation in plant tissues cultured in vitro. Symp. Soc. Exp. Biol. 1957, 11, 118–130. [Google Scholar]
  20. Mok, D.W.; Mok, M.C. Cytokinin metabolism and action. Annu. Rev. Plant Physiol. Plant Mol. Biol. 2001, 52, 89–118. [Google Scholar] [CrossRef] [Scilit]
  21. Kieber, J.J.; Schaller, G.E. Cytokinins. Arabidopsis Book 2014, 12, e0168. [Google Scholar] [CrossRef] [Scilit]
  22. Heyl, A.; Schmülling, T. Cytokinin signal perception and transduction. Curr. Opin. Plant Biol. 2003, 6, 480–488. [Google Scholar] [CrossRef] [Scilit]
  23. Sakakibara, H. Cytokinins: Activity, biosynthesis, and translocation. Annu. Rev. Plant Biol. 2006, 57, 431–449. [Google Scholar] [CrossRef] [Scilit]
  24. Müller, B.; Sheen, J. Advances in cytokinin signaling. Science 2007, 318, 68–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Brenner, W.G.; Schmülling, T. Transcript profiling of cytokinin action in Arabidopsis roots and shoots discovers largely similar but also organ-specific responses. BMC Plant Biol. 2012, 12, 112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Yang, W.; Cortijo, S.; Korsbo, N.; Roszak, P.; Schiessl, K.; Gurzadyan, A.; Wightman, R.; Jönsson, H.; Meyerowitz, E. Molecular mechanism of cytokinin-activated cell division in Arabidopsis. Science 2021, 371, 1350–1355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Zubo, Y.O.; Blakley, I.C.; Yamburenko, M.V.; Worthen, J.M.; Street, I.H.; Franco-Zorrilla, J.M.; Zhang, W.; Hill, K.; Raines, T.; Solano, R.; et al. Cytokinin induces genome-wide binding of the type-B response regulator ARR10 to regulate growth and development in Arabidopsis. Proc. Natl. Acad. Sci. USA 2017, 114, E5995–E6004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Matthysse, A.G.; Abrams, M. A factor mediating interaction of kinins with the genetic material. Biochim. Biophys. Acta Nucleic Acids Protein Synth. 1970, 199, 511–518. [Google Scholar] [CrossRef] [Scilit]
  29. Klämbt, D. Cytokinin effects on protein synthesis of in vitro systems of higher plants. Plant Cell Physiol. 1976, 17, 73–76. [Google Scholar] [CrossRef] [Scilit]
  30. Muren, R.C.; Fosket, D.E. Cytokinin-Mediated Translational Control of Protein Synthesis in Cultured Cells of Glycine max. J. Exp. Bot. 1977, 28, 775–784. [Google Scholar] [CrossRef] [Scilit]
  31. Kulaeva, O.N. Cytokinin Action on Transcription and Translation in Plants. In Metabolism and Molecular Activities of Cytokinins. Proceedings in Life Sciences; Guern, J., Péaud-Lenoël, C., Eds.; Springer: Berlin/Heidelberg, Germany, 1981; pp. 218–227. [Google Scholar] [CrossRef] [Scilit]
  32. Waliszewska-Wojtkowiak, B.; Schneider, J.; Szweykowska, A. Effect of Kinetin on the Transcription Activity of Chromatin from Cucumber Cotyledons. Biochem. Physiol. Pflanz. 1985, 180, 413–422. [Google Scholar] [CrossRef] [Scilit]
  33. Crowell, D.N.; Kadlecek, A.T.; John, M.C.; Amasino, R.M. Cytokinin-induced mRNAs in cultured soybean cells. Proc. Natl. Acad. Sci. USA 1990, 87, 8815–8819. [Google Scholar] [CrossRef] [Scilit]
  34. Gaudino, R.J.; Pikaard, C.S. Cytokinin induction of RNA polymerase I transcription in Arabidopsis thaliana. J. Biol. Chem. 1997, 272, 6799–6804. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Hallmark, H.T.; Rashotte, A.M. Cytokinin isopentenyladenine and its glucoside isopentenyladenine-9G delay leaf senescence through activation of cytokinin-associated genes. Plant Direct 2020, 4, e00292. [Google Scholar] [CrossRef] [Scilit]
  36. Werner, T.; Schmülling, T. Cytokinin action in plant development. Curr. Opin. Plant Biol. 2009, 12, 527–538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Mason, M.G.; Mathews, D.E.; Argyros, D.A.; Maxwell, B.B.; Kieber, J.J.; Alonso, J.M.; Ecker, J.R.; Schaller, G.E. Multiple type-B response regulators mediate cytokinin signal transduction in Arabidopsis. Plant Cell 2005, 17, 3007–3018. [Google Scholar] [CrossRef] [Scilit]
  38. Yokoyama, A.; Yamashino, T.; Amano, Y.-I.; Tajima, Y.; Imamura, A.; Sakakibara, H.; Mizuno, T. Type-B ARR transcription factors, ARR10 and ARR12, are implicated in cytokinin-mediated regulation of protoxylem differentiation in roots of Arabidopsis thaliana. Plant Cell Physiol. 2007, 48, 84–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Ishida, K.; Yamashino, T.; Yokoyama, A.; Mizuno, T. Three type-B response regulators, ARR1, ARR10 and ARR12, play essential but redundant roles in cytokinin signal transduction throughout the life cycle of Arabidopsis thaliana. Plant Cell Physiol. 2008, 49, 47–57. [Google Scholar] [CrossRef] [Scilit]
  40. Argyros, R.D.; Mathews, D.E.; Chiang, Y.H.; Palmer, C.M.; Thibault, D.M.; Etheridge, N.; Argyros, D.A.; Mason, M.G.; Kieber, J.J.; Schaller, G.E. Type B response regulators of Arabidopsis play key roles in cytokinin signaling and plant development. Plant Cell 2008, 20, 2102–2116. [Google Scholar] [CrossRef] [Scilit]
  41. Chang, H.; Chen, D.; Kam, J.; Richardson, T.; Drenth, J.; Guo, X.; McIntyre, C.L.; Chai, S.; Rae, A.L.; Xue, G.P. Abiotic stress upregulated TaZFP34 represses the expression of type-B response regulator and SHY2 genes and enhances root to shoot ratio in wheat. Plant Sci. 2016, 252, 88–102. [Google Scholar] [CrossRef] [Scilit]
  42. Worthen, J.M.; Yamburenko, M.V.; Lim, J.; Nimchuk, Z.L.; Kieber, J.J.; Schaller, G.E. Type-B response regulators of rice play key roles in growth, development and cytokinin signaling. Development 2019, 146, dev174870. [Google Scholar] [CrossRef] [Scilit]
  43. Li, C.; Gong, C.; Wu, J.; Yang, L.; Zhou, L.; Wu, B.; Gao, L.; Ling, F.; You, A.; Li, C.; et al. Improvement of Rice Agronomic Traits by Editing Type-B Response Regulators. Int. J. Mol. Sci. 2022, 23, 14165. [Google Scholar] [CrossRef] [Scilit]
  44. Wan, Q.; Zhai, N.; Xie, D.; Liu, W.; Xu, L. WOX11: The founder of plant organ regeneration. Cell Regen. 2023, 12, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Qi, H.; Cai, H.; Liu, X.; Liu, S.; Ding, C.; Xu, M. The cytokinin type-B response regulator PeRR12 is a negative regulator of adventitious rooting and salt tolerance in poplar. Plant Sci. 2022, 325, 111456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Ramírez-Carvajal, G.A.; Morse, A.M.; Dervinis, C.; Davis, J.M. The cytokinin type-B response regulator PtRR13 is a negative regulator of adventitious root development in Populus. Plant Physiol. 2009, 150, 759–771. [Google Scholar] [CrossRef] [Scilit]
  47. Ren, B.; Liang, Y.; Deng, Y.; Chen, Q.; Zhang, J.; Yang, X.; Zuo, J. Genome-wide comparative analysis of type-A Arabidopsis response regulator genes by overexpression studies reveals their diverse roles and regulatory mechanisms in cytokinin signaling. Cell Res. 2009, 19, 1178–1190. [Google Scholar] [CrossRef] [Scilit]
  48. Gao, B.; Fan, L.; Li, X.; Yang, H.; Liu, F.; Wang, L.; Xi, L.; Ma, N.; Zhao, L. RcRR1, a Rosa canina type-A response regulator gene, is involved in cytokinin-modulated rhizoid organogenesis. PLoS One 2013, 8, e72914. [Google Scholar] [CrossRef] [Scilit]
  49. Mazri, M.A. Role of cytokinins and physical state of the culture medium to improve in vitro shoot multiplication, rooting and acclimatization of date palm (Phoenix dactylifera L.) cv. Boufeggous. J. Plant Biochem. Biotechnol. 2015, 24, 268–275. [Google Scholar] [CrossRef] [Scilit]
  50. Zakizadeh, S.; Kaviani, B.; Onsinejad, R. In vitro rooting of amaryllis (Hippeastrum johnsonii), a bulbous plant, via NAA and 2-iP. Ann. Biol. Res. 2013, 4, 69–71. [Google Scholar]
  51. Ružić, D.V.; Vujović, T.I. The effects of cytokinin types and their concentration on in vitro multiplication of sweet cherry cv. Lapins (Prunus avium L.). Hortic. Sci. 2008, 35, 12–21. [Google Scholar] [CrossRef] [Scilit]
  52. De Klerk, G.J.; Hanecakova, J.; Jasik, J. The role of cytokinins in rooting of stem slices cut from apple microcuttings. Plant Biosyst. 2001, 135, 79–84. [Google Scholar] [CrossRef] [Scilit]
  53. Jaakola, L.; Tolvanen, A.; Laine, K.; Hohtola, A. Effect of N6-isopentenyladenine concentration on growth initiation in vitro and rooting of bilberry and lingonberry microshoots. Plant Cell Tissue Organ Cult. 2001, 66, 73–77. [Google Scholar] [CrossRef] [Scilit]
  54. Bishopp, A.; Lehesranta, S.; Vatén, A.; Help, H.; El-Showk, S.; Scheres, B.; Helariutta, K.; Mähönen, A.P.; Sakakibara, H.; Helariutta, Y. Phloem-transported cytokinin regulates polar auxin transport and maintains vascular pattern in the root meristem. Curr. Biol. 2011, 21, 927–932. [Google Scholar] [CrossRef] [Scilit]
  55. Barton, M.K. Twenty years on: The inner workings of the shoot apical meristem, a developmental dynamo. Dev. Biol. 2010, 341, 95–113. [Google Scholar] [CrossRef] [Scilit]
  56. Sussex, I.M.; Kerk, N.M. The evolution of plant architecture. Curr. Opin. Plant Biol. 2001, 4, 33–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Shi, B.; Vernoux, T. Patterning at the shoot apical meristem and phyllotaxis. Curr. Top. Dev. Biol. 2019, 131, 81–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Barton, M.K.; Poethig, R.S. Formation of the shoot apical meristem in Arabidopsis thaliana: An analysis of development in the wild type and in the shoot meristemless mutant. Development 1993, 119, 823–831. [Google Scholar] [CrossRef] [Scilit]
  59. Clark, S.E. Organ formation at the vegetative shoot meristem. Plant Cell 1997, 9, 1067–1076. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Endrizzi, K.; Moussian, B.; Haecker, A.; Levin, J.Z.; Laux, T. The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE. Plant J. 1996, 10, 967–979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Long, J.A.; Barton, M.K. The development of apical embryonic pattern in Arabidopsis. Development 1998, 125, 3027–3035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Aida, M.; Ishida, T.; Tasaka, M. Shoot apical meristem and cotyledon formation during Arabidopsis embryogenesis: Interaction among the CUP-SHAPED COTYLEDON and SHOOT MERISTEMLESS genes. Development 1999, 126, 1563–1570. [Google Scholar] [CrossRef] [Scilit]
  63. Wang, J.; Tian, C.; Zhang, C.; Shi, B.; Cao, X.; Zhang, T.Q.; Zhao, Z.; Wang, J.W.; Jiao, Y. Cytokinin Signaling Activates WUSCHEL Expression during Axillary Meristem Initiation. Plant Cell 2017, 29, 1373–1387. [Google Scholar] [CrossRef] [Scilit]
  64. Teo, W.L.; Kumar, P.; Goh, C.J.; Swarup, S. The expression of Brostm, a KNOTTED1-like gene, marks the cell type and timing of in vitro shoot induction in Brassica oleracea. Plant Mol. Biol. 2001, 46, 567–580. [Google Scholar] [CrossRef] [Scilit]
  65. Greb, T.; Clarenz, O.; Schafer, E.; Muller, D.; Herrero, R.; Schmitz, G.; Theres, K. Molecular analysis of the LATERAL SUPPRESSOR gene in Arabidopsis reveals a conserved control mechanism for axillary meristem formation. Genes Dev. 2003, 17, 1175–1187. [Google Scholar] [CrossRef] [Scilit]
  66. Long, J.; Barton, M.K. Initiation of axillary and floral meristems in Arabidopsis. Dev. Biol. 2000, 218, 341–353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Shi, B.; Zhang, C.; Tian, C.; Wang, J.; Wang, Q.; Xu, T.; Xu, Y.; Ohno, C.; Sablowski, R.; Heisler, M.G.; et al. Two-Step Regulation of a Meristematic Cell Population Acting in Shoot proliferation in Arabidopsis. PLoS Genet. 2016, 12, e1006168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Hirakawa, Y. Evolution of meristem zonation by CLE gene duplication in land plants. Nat. Plants 2022, 8, 735–740. [Google Scholar] [CrossRef] [Scilit]
  69. Hong, S.-Y.; Botterweg-Paredes, E.; Doll, J.; Eguen, T.; Blaakmeer, A.; Matton, S.; Xie, Y.; Lunding, B.S.; Zentgraf, U.; Guan, C.; et al. Multi-level analysis of the interactions between REVOLUTA and MORE AXILLARY BRANCHES 2 in controlling plant development reveals parallel, independent and antagonistic functions. Development 2020, 147, dev183681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  70. Riou-Khamlichi, C.; Huntley, R.; Jacqmard, A.; Murray, J.A. Cytokinin activation of Arabidopsis cell division through a D-type cyclin. Science 1999, 283, 1541–1544. [Google Scholar] [CrossRef] [Scilit]
  71. Gaamouche, T.; Manes, C.L.; Kwiatkowska, D.; Berckmans, B.; Koumproglou, R.; Maes, S.; Beeckman, T.; Vernoux, T.; Doonan, J.H.; Traas, J.; et al. Cyclin-dependent kinase activity maintains the shoot apical meristem cells in an undifferentiated state. Plant J. 2010, 64, 26–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  72. Scofield, S.; Dewitte, W.; Nieuwland, J.; Murray, J.A.H. The Arabidopsis homeobox gene SHOOT MERISTEMLESS has cellular and meristem-organisational roles with differential requirements for cytokinin and CYCD3 activity. Plant J. 2013, 75, 53–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  73. Dewitte, W.; Scofield, S.; Alcasabas, A.A.; Maughan, S.C.; Menges, M.; Braun, N.; Collins, C.; Nieuwland, J.; Prinsen, E.; Sundaresan, V.; et al. Arabidopsis CYCD3 D-type cyclins link cell proliferation and endocycles and are rate-limiting for cytokinin responses. Proc. Natl. Acad. Sci. USA 2007, 104, 14537–14542. [Google Scholar] [CrossRef] [Scilit]
  74. Xu, K.; Wang, Y.; Shi, L.; Sun, F.; Liu, S.; Xi, Y. PvTB1, a Teosinte Branched1 Gene Homolog, Negatively Regulates Tillering in Switchgrass. J. Plant Growth Regul. 2016, 35, 44–53. [Google Scholar] [CrossRef] [Scilit]
  75. Lewis, J.M.; Mackintosh, C.A.; Shin, S.; Gilding, E.; Kravchenko, S.; Baldridge, G.; Zeyen, R.; Muehlbauer, G.J. Overexpression of the maize Teosinte Branched1 gene in wheat suppresses tiller development. Plant Cell Rep. 2008, 27, 1217–1225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  76. Wang, M.; Le Moigne, M.A.; Bertheloot, J.; Crespel, L.; Perez-Garcia, M.D.; Ogé, L.; Demotes-Mainard, S.; Hamama, L.; Davière, J.M.; Sakr, S. BRANCHED1: A Key Hub of Shoot Branching. Front. Plant Sci. 2019, 10, 76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Li, T.; Kang, X.; Lei, W.; Yao, X.; Zou, L.; Zhang, D.; Lin, H. SHY2 as a node in the regulation of root meristem development by auxin, brassinosteroids, and cytokinin. J. Integr. Plant Biol. 2020, 62, 1500–1517. [Google Scholar] [CrossRef] [Scilit]
  78. Wang, M.; Le Gourrierec, J.; Jiao, F.; Demotes-Mainard, S.; Perez-Garcia, M.D.; Ogé, L.; Hamama, L.; Crespel, L.; Bertheloot, J.; Chen, J.; et al. Convergence and Divergence of Sugar and Cytokinin Signaling in Plant Development. Int. J. Mol. Sci. 2021, 22, 1282. [Google Scholar] [CrossRef] [Scilit]
  79. Chapman, E.J.; Estelle, M. Mechanism of Auxin-Regulated Gene Expression in Plants. Annu. Rev. Genet. 2009, 43, 265–285. [Google Scholar] [CrossRef] [Scilit]
  80. Dun, E.A.; de Saint Germain, A.; Rameau, C.; Beveridge, C.A. Antagonistic action of strigolactone and cytokinin in bud outgrowth control. Plant Physiol. 2012, 158, 487–498. [Google Scholar] [CrossRef] [Scilit]
  81. Zha, M.; Zhao, Y.; Wang, Y.; Chen, B.; Tan, Z. Strigolactones and Cytokinin Interaction in Buds in the Control of Rice Tillering. Front. Plant Sci. 2022, 13, 837136. [Google Scholar] [CrossRef] [Scilit]
  82. Stes, E.; Depuydt, S.; De Keyser, A.; Matthys, C.; Audenaert, K.; Yoneyama, K.; Werbrouck, S.; Goormachtig, S.; Vereecke, D. Strigolactones as an auxiliary hormonal defence mechanism against leafy gall syndrome in Arabidopsis thaliana. J. Exp. Bot. 2015, 66, 5123–5134. [Google Scholar] [CrossRef] [Scilit]
  83. Vylíčilová, H.; Husičková, A.; Spíchal, L.; Srovnal, J.; Doležal, K.; Plíhal, O.; Plíhalová, L. C2-substituted aromatic cytokinin sugar conjugates delay the onset of senescence by maintaining the activity of the photosynthetic apparatus. Phytochemistry 2016, 122, 22–33. [Google Scholar] [CrossRef] [Scilit]
  84. Kou, X.; Zhao, X.; Wu, B.; Wang, C.; Wu, C.; Yang, S.; Zhou, J.; Xue, Z. Auxin Response Factors Are Ubiquitous in Plant Growth and Development, and Involved in Crosstalk between Plant Hormones: A Review. Appl. Sci. 2022, 12, 1360. [Google Scholar] [CrossRef] [Scilit]
  85. Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with Tobacco tissue cultures. Physiol. Plant 1962, 15, 473–497. [Google Scholar] [CrossRef] [Scilit]
  86. Valencia-Lozano, E.; Ibarra, J.E.; Herrera-Ubaldo, H.; de Folter, S.; Cabrera-Ponce, J.L. Osmotic stress-induced somatic embryo maturation of coffee Coffea arabica L., shoot and root apical meristems development and robustness. Sci. Rep. 2021, 11, 9661. [Google Scholar] [CrossRef] [Scilit]
  87. Rueden, C.T.; Schindelin, J.; Hiner, M.C.; DeZonia, B.E.; Walter, A.E.; Arena, E.T.; Eliceiri, K.W. ImageJ2: ImageJ for the next generation of scientific image data. BMC Bioinform. 2017, 18, 529. [Google Scholar] [CrossRef] [Scilit]
  88. Meena, S.; Kumar, S.R.; Venkata-Rao, D.K.; Dwivedi, V.; Shilpashree, H.B.; Rastogi, S.; Shasany, A.K.; Nagegowda, D.A. De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses. Front. Plant Sci. 2016, 7, 1129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  89. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Protein–Protein interaction (PPI) network of genes involved in cytokinin (CK) signaling, stem cell maintenance, cell cycle regulation, auxin signaling, auxin repression, CK metabolism, and shoot proliferation/repressor in C. citratus. This PPI network was reconstructed from a gene network with an average confidence of 0.4 in STRING (https://string-db.org/, v11.5).
Figure 1. Protein–Protein interaction (PPI) network of genes involved in cytokinin (CK) signaling, stem cell maintenance, cell cycle regulation, auxin signaling, auxin repression, CK metabolism, and shoot proliferation/repressor in C. citratus. This PPI network was reconstructed from a gene network with an average confidence of 0.4 in STRING (https://string-db.org/, v11.5).
Plants 12 03637 g001
Figure 2. Phenotypes of lemongrass plants (C. citratus) grown on medium containing BAP 10 µM, 5% sucrose and 5 g/L gelriteTM (A), compared with plants grown in medium with 2-iP 10 µM, 5% sucrose and 5 g/L gelriteTM (B) (Scale bar = 1 cm). Longitudinal section of axillary meristems (AMs) grown on medium with BAP 10 µM (C) compared with sections derived from plants grown in medium with 2-iP 10 µM (D). Red arrows indicate AMs (Scale bar = 0.7 cm).
Figure 2. Phenotypes of lemongrass plants (C. citratus) grown on medium containing BAP 10 µM, 5% sucrose and 5 g/L gelriteTM (A), compared with plants grown in medium with 2-iP 10 µM, 5% sucrose and 5 g/L gelriteTM (B) (Scale bar = 1 cm). Longitudinal section of axillary meristems (AMs) grown on medium with BAP 10 µM (C) compared with sections derived from plants grown in medium with 2-iP 10 µM (D). Red arrows indicate AMs (Scale bar = 0.7 cm).
Plants 12 03637 g002
Figure 3. Histological analysis of longitudinal sections of C. citratus root tips (RT) developed in 2-iP (A,B) and control (Ctrl) medium without hormones (C,D). (A) Roots developed in MS medium supplemented with 2-iP 10 µM, 5% sucrose and 5 g/L gelriteTM (5/5 2-iP) culture medium (Scale bar = 4 mm). (B) Longitudinal sections of 1 µm of RT from 5/5 2-iP. A prominent root cap (RC) composed by several layers of cells containing statocytes (statenchyma), cortex (CX), protodermis (PD), quiescent center (QC), distal meristem (DM), pith (P), meristem zone (MZ), and elongation zone (EZ) were observed. Longitudinal layers of cells with prominent nuclei were observed (Scale bar = 10 μm). (C) Roots developed from plants without hormones in MS medium supplemented with 5% sucrose and 5 g/L gelriteTM (Scale bar = 4 mm). (D) Longitudinal sections of 1 µm of RT from Ctrl plants without hormones. The MZ is composed by a few layers of cells containing QC, PD, and P. It was not possible to visualize the CX, DM, and EZ (Scale bar = 10 μm).
Figure 3. Histological analysis of longitudinal sections of C. citratus root tips (RT) developed in 2-iP (A,B) and control (Ctrl) medium without hormones (C,D). (A) Roots developed in MS medium supplemented with 2-iP 10 µM, 5% sucrose and 5 g/L gelriteTM (5/5 2-iP) culture medium (Scale bar = 4 mm). (B) Longitudinal sections of 1 µm of RT from 5/5 2-iP. A prominent root cap (RC) composed by several layers of cells containing statocytes (statenchyma), cortex (CX), protodermis (PD), quiescent center (QC), distal meristem (DM), pith (P), meristem zone (MZ), and elongation zone (EZ) were observed. Longitudinal layers of cells with prominent nuclei were observed (Scale bar = 10 μm). (C) Roots developed from plants without hormones in MS medium supplemented with 5% sucrose and 5 g/L gelriteTM (Scale bar = 4 mm). (D) Longitudinal sections of 1 µm of RT from Ctrl plants without hormones. The MZ is composed by a few layers of cells containing QC, PD, and P. It was not possible to visualize the CX, DM, and EZ (Scale bar = 10 μm).
Plants 12 03637 g003
Figure 4. Relative gene expression levels of 13 regulatory genes present in C. citratus plants grown on BAP 10 µM, 5% sucrose and 5 g/L gelriteTM compared to plants grown in medium with 2-iP 10 µM, 5% sucrose, and 5 g/L gelriteTM.
Figure 4. Relative gene expression levels of 13 regulatory genes present in C. citratus plants grown on BAP 10 µM, 5% sucrose and 5 g/L gelriteTM compared to plants grown in medium with 2-iP 10 µM, 5% sucrose, and 5 g/L gelriteTM.
Plants 12 03637 g004
Figure 5. Molecular mechanisms describing proliferation and inhibition of shoots and root development in lemongrass (C. citratus) under BAP- and 2-iP-containing medium. Red indicators represent inhibition effects, and the green arrows represent activations. Green elements are the components of protein interactions, yellow elements represent biological functions, blue elements represent plant hormones, red elements are branching repressors, white elements represent auxin influence, orange elements represent the activation of type-A and -B response regulators (RRs) via CK signaling, and light blue element represents strigolactone (SL).
Figure 5. Molecular mechanisms describing proliferation and inhibition of shoots and root development in lemongrass (C. citratus) under BAP- and 2-iP-containing medium. Red indicators represent inhibition effects, and the green arrows represent activations. Green elements are the components of protein interactions, yellow elements represent biological functions, blue elements represent plant hormones, red elements are branching repressors, white elements represent auxin influence, orange elements represent the activation of type-A and -B response regulators (RRs) via CK signaling, and light blue element represents strigolactone (SL).
Plants 12 03637 g005
Table 1. Nuclei and nucleolus size from root-tip sections of plants derived from 2-iP and controls without hormones.
Table 1. Nuclei and nucleolus size from root-tip sections of plants derived from 2-iP and controls without hormones.
Culture MediumCulture Medium
5/5 2-iP (±SD)5/5 Ctrl (±SD)p-Value
Nucleus (μm)3.76 ± 0.233.2 ± 0.400.023 *
Nucleolus (μm)2.42 ± 0.381.88 ± 0.240.0001 **
Cell area (μm2)107.07 ± 20.9163.36 ± 30.910.0001 **
Morphological differences between organelles of roots of C. citratus regenerated from medium containing 2-iP 10 μM, 5% sucrose and 5 g/L gelrite™ (5/5 2-iP) and medium control (Ctrl) containing 5% sucrose and 5 g/L gelrite™ (5/5 Ctrl) after six months of culture. Sizes Nucleus (p-value = < 0.023 *); Nucleolus (p-value < 0.0001 **), and Cell area (p-value < 0.0001 **). Differences in variables among treatments were tested using factorial analysis of variance (ANOVA). Values are means ± standard deviation and Software ImageJ2. * (p < 0.05) non-significant different.; ** (p > 0.0001) significant different.
Table 2. Primer design of genes that were analyzed during shoot and root induction of lemongrass (C. citratus).
Table 2. Primer design of genes that were analyzed during shoot and root induction of lemongrass (C. citratus).
IDStringFunctionForwardReverse
BRADI1G57607.1STMStem cell
maintenance
TGCACTACAAGTGGCCTTACCCGTTTCCTCTGGTTGATG
BRADI3G28970.1REVStem cell
maintenance
CTAGTTCCTGCACGGGATTTCACCTCCTGAACCACTCAAA
NM_001124926.2CLV3Stem cell
maintenance
CATGATGCTTCTGATCTCACGGGAGCTGAAAGTTGTTTC
NP_001388401.1CKX1CK metabolismCTGATCGCCGCGCTGATCGCCCCAGGACGGCGTCGAACAG
XM_015794058.2AHK3CK signalingGTGAGGGGGAGCCTGGTGGCGCTTCTTGATCGCCCACCCTTG
XM_003558408.4ARR1CK signalingGATTATCCGAGAGGTGCGGGTGGACGAGCATCTGCTTGAG
XM_010240442.3ARR4CK signalingAGGCTCCTCAAGACCTCTTCTCACGTTCACCTCAACATCCTGC
BRADI1G77325.1CDKACell cycle
regulation
CTTCTTGGAGCAAGGCAGTATTCTCAGAATCTCCAGGGAACA
BRADI4G08357.1CYCD3Cell cycle
regulation
TCGCTGACTCGCTCTACTACATGAGCTCCTCCTCCTT
XM_003557426.3ARF5Auxin signalingCTGCGCCTCGGCCCTCCTGGCATATCCCATGGCACGTCTCC
XM_003565937.4SHY2Auxin repressorGCCGCCGGCGGCCGCGCGGACCTCGTCCTTCTCCTCGTACGC
XM_014900703.2BRC1Shoot repressionAGGAGTTGCGGAGAAGTTGCGAGATGATGAGCAACGACA
XM_003581453.4MAX3Shoot repressionGTGGCCAACACGAGCGTGCTCCCGAACATCCTGTGGAAATG
*EF1α TCTCGGAGCTGCTCACCAAGTCGCCATTCTTGAGGAACTTG
*GAPDH CCCGACGAGCCCATCATCTTTTGGTCGAGCACCTTGAC
*ACT GACTACGACCAGGAGATGGAGACTATGACCTGTCCATCAGGAAGCT
* The sequences of the reference genes used were obtained from Meena et al. [88].
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cárdenas-Aquino, M.d.R.; Camas-Reyes, A.; Valencia-Lozano, E.; López-Sánchez, L.; Martínez-Antonio, A.; Cabrera-Ponce, J.L. The Cytokinins BAP and 2-iP Modulate Different Molecular Mechanisms on Shoot Proliferation and Root Development in Lemongrass (Cymbopogon citratus). Plants 2023, 12, 3637. https://doi.org/10.3390/plants12203637

AMA Style

Cárdenas-Aquino MdR, Camas-Reyes A, Valencia-Lozano E, López-Sánchez L, Martínez-Antonio A, Cabrera-Ponce JL. The Cytokinins BAP and 2-iP Modulate Different Molecular Mechanisms on Shoot Proliferation and Root Development in Lemongrass (Cymbopogon citratus). Plants. 2023; 12(20):3637. https://doi.org/10.3390/plants12203637

Chicago/Turabian Style

Cárdenas-Aquino, María del Rosario, Alberto Camas-Reyes, Eliana Valencia-Lozano, Lorena López-Sánchez, Agustino Martínez-Antonio, and José Luis Cabrera-Ponce. 2023. "The Cytokinins BAP and 2-iP Modulate Different Molecular Mechanisms on Shoot Proliferation and Root Development in Lemongrass (Cymbopogon citratus)" Plants 12, no. 20: 3637. https://doi.org/10.3390/plants12203637

APA Style

Cárdenas-Aquino, M. d. R., Camas-Reyes, A., Valencia-Lozano, E., López-Sánchez, L., Martínez-Antonio, A., & Cabrera-Ponce, J. L. (2023). The Cytokinins BAP and 2-iP Modulate Different Molecular Mechanisms on Shoot Proliferation and Root Development in Lemongrass (Cymbopogon citratus). Plants, 12(20), 3637. https://doi.org/10.3390/plants12203637

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop