The Cytokinins BAP and 2-iP Modulate Different Molecular Mechanisms on Shoot Proliferation and Root Development in Lemongrass (Cymbopogon citratus)
Abstract
:1. Introduction
2. Results
2.1. Shoot Proliferation
2.2. Histology of C. citratus Roots
2.3. Gene Expression Analysis
2.3.1. CK Signaling Genes
2.3.2. Stem Cell Maintenance Genes
2.3.3. Cell Cycle Regulation Genes
2.3.4. Auxin Signaling Gene
2.3.5. Auxin Signaling Repressor Gene
2.3.6. CK Metabolism Gene
2.3.7. Shoot Proliferation Repressor Genes
3. Discussion
3.1. Cytokinin Signaling
3.2. Cell Cycle
3.3. BRC1 Shoot Repressor
3.4. SHY2 (IAA3/Short Hypocotyl 2)
3.5. Strigolactone (SL) Biosynthesis
3.6. CK Oxidase/Dehydrogenase
3.7. Auxin Response Factor
4. Materials and Methods
4.1. Shoot Proliferation of Lemongrass (C. citratus)
4.2. Histology of C. citratus Shoots and Roots
4.3. Isolation of RNA and Real Time Gene Expression Analysis
5. Conclusions and Perspectives
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Avoseh, O.; Oyedeji, O.; Rungqu, P.; Nkeh-Chungag, B.; Oyedeji, A. Cymbopogon species; Ethnopharmacology, Phytochemistry and the Pharmacological Importance. Molecules 2015, 20, 7438–7453. [Google Scholar] [CrossRef] [PubMed]
- Skaria, B.P.; Joy, P.P.; Mathew, S.; Mathew, G. 24—Lemongrass. In Handbook of Herbs and Spices; Peter, K.V., Ed.; Woodhead Publishing Series in Food Science, Technology and Nutrition; Woodhead publishing: Cambridge, England, 2006; Volume 3, pp. 400–419. [Google Scholar] [CrossRef]
- Ganjewala, D.; Luthra, R. Essential Oil Biosynthesis and Regulation in the Genus Cymbopogon. Nat. Prod. Commun. 2010, 5, 163–172. [Google Scholar] [CrossRef]
- Camas-Reyes, A.; Vuelvas-Nolasco, R.; Cabrera-Ponce, J.L.; Pereyra-Alférez, B.; Molina-Torres, J.; Martínez-Antonio, A. Effect of Different Cytokinins on Shoot Outgrowth and Bioactive Compounds Profile of Lemograss Essential Oil. Int. J. Plant Biol. 2022, 13, 298–314. [Google Scholar] [CrossRef]
- Khanuja, S.P.S.; Shasany, A.K.; Pawar, A.; Lal, R.K.; Darokar, M.P.; Naqvi, A.A.; Rajkumar, S.; Sundaresan, V.; Lal, N.; Kumar, S. Essential oil constituents and RAPD markers to establish species relationship in Cymbopogon Spreng. (Poaceae). Biochem. Syst. Ecol. 2005, 33, 171–186. [Google Scholar] [CrossRef]
- Aibinu, I.; Adenipekun, T.; Adelowowtan, T.; Ogunsanya, T.; Ogungbemi, T. Evaluation of the antimicrobial properties of different parts of Citrus aurantifolia (lime fruit) as used locally. Afr. J. Tradit. Complement. Altern. Med. 2007, 4, 185–190. [Google Scholar]
- Hawkins, S.M.; Robacker, C.D. Micropropagation of Little Bluestem (Schizachyrium scoparium L.). Hortscience 2019, 54, 348–352. [Google Scholar] [CrossRef]
- Sompornpailin, K.; Khunchuay, C. Synergistic effects of BAP and kinetin media additives on regeneration of vetiver grass (Vetiveria zizanioides L. Nash). Aust. J. Crop Sci. 2016, 10, 726–731. [Google Scholar] [CrossRef]
- Abdelsalam, A.; Mahran, E.; Chowdhury, K.; Boroujerdi, A.; El-Bakry, A. NMR-based metabolomic analysis of wild, greenhouse, and in vitro regenerated shoots of Cymbopogon schoenanthus subsp. proximus with GC-MS assessment of proximadiol. Physiol. Mol. Biol. Pla. 2017, 23, 369–383. [Google Scholar] [CrossRef] [PubMed]
- Alexandrova, K.S.; Denchev, P.D.; Conger, B.V. Micropropagation of switchgrass by node culture. Crop Sci. 1996, 36, 1709–1711. [Google Scholar] [CrossRef]
- Satish, L.; Ceasar, S.A.; Shilpha, J.; Rency, A.S.; Rathinapriya, P.; Ramesh, M. Direct plant regeneration from in vitro-derived shoot apical meristems of finger millet (Eleusine coracana (L.) Gaertn.). In Vitro Cell. Dev. Biol. Plant 2015, 51, 192–200. [Google Scholar] [CrossRef]
- Karasawa, M.M.G.; Pinto, J.E.B.P.; Pereira, A.V.; Pinto, J.C.; Silva, F.G. In Vitro Propagation of Pennisetum purpureum Schum. In International Grassland Congress, Sao Paulo, Brazil, 2021. Available online: https://uknowledge.uky.edu/igc/19/13/11/ (accessed on 1 September 2023).
- Pożoga, M.; Olewnicki, D.; Wójcik-Gront, E.; Latocha, P. An Efficient Method of Pennisetum × advena ‘Rubrum’ Plantlets Production Using the Temporary Immersion Bioreactor Systems and Agar Cultures. Plants 2023, 12, 1534. [Google Scholar] [CrossRef] [PubMed]
- Nautiyal (nee Gairi), A.; Rashid, A.; Agnihotri, A. Induction of multiple shoots in Oryza sativa: Roles of thidiazuron, 6-benzylaminopurine, decapitation, flooding, and Ethrel® treatments. In Vitro Cell. Dev. Biol. Plant 2022, 58, 1126–1137. [Google Scholar] [CrossRef]
- Tanzarella, O.A.; Greco, B. Clonal propagation of Triticum durum DESF. from immature embryos and shoot base explants. Euphytica 1985, 34, 273–277. [Google Scholar] [CrossRef]
- Ganeshan, S.; Chodaparambil, S.V.; Båga, M.; Fowler, D.B.; Hucl, P.; Rossnagel, B.G.; Chibbar, R.N. In vitro regeneration of cereals based on multiple shoot induction from mature embryos in response to thidiazuron. Plant Cell Tissue Organ Cult. 2006, 85, 63–73. [Google Scholar] [CrossRef]
- Pola, S.; Saradamani, N.; Ramana, T. Enhanced shoot regeneration in tissue culture studies of Sorghum bicolor. Int. J. Agr. Technol. 2007, 3, 275–286. Available online: http://www.ijat-aatsea.com/pdf/Nov_V3_no2_07/11-IJAT2007_20-P%20275-286.pdf (accessed on 1 September 2023).
- Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING database in 2021: Customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef]
- Skoog, F.; Miller, C.O. Chemical regulation of growth and organ formation in plant tissues cultured in vitro. Symp. Soc. Exp. Biol. 1957, 11, 118–130. [Google Scholar]
- Mok, D.W.; Mok, M.C. Cytokinin metabolism and action. Annu. Rev. Plant Physiol. Plant Mol. Biol. 2001, 52, 89–118. [Google Scholar] [CrossRef]
- Kieber, J.J.; Schaller, G.E. Cytokinins. Arabidopsis Book 2014, 12, e0168. [Google Scholar] [CrossRef]
- Heyl, A.; Schmülling, T. Cytokinin signal perception and transduction. Curr. Opin. Plant Biol. 2003, 6, 480–488. [Google Scholar] [CrossRef]
- Sakakibara, H. Cytokinins: Activity, biosynthesis, and translocation. Annu. Rev. Plant Biol. 2006, 57, 431–449. [Google Scholar] [CrossRef]
- Müller, B.; Sheen, J. Advances in cytokinin signaling. Science 2007, 318, 68–69. [Google Scholar] [CrossRef] [PubMed]
- Brenner, W.G.; Schmülling, T. Transcript profiling of cytokinin action in Arabidopsis roots and shoots discovers largely similar but also organ-specific responses. BMC Plant Biol. 2012, 12, 112. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Cortijo, S.; Korsbo, N.; Roszak, P.; Schiessl, K.; Gurzadyan, A.; Wightman, R.; Jönsson, H.; Meyerowitz, E. Molecular mechanism of cytokinin-activated cell division in Arabidopsis. Science 2021, 371, 1350–1355. [Google Scholar] [CrossRef] [PubMed]
- Zubo, Y.O.; Blakley, I.C.; Yamburenko, M.V.; Worthen, J.M.; Street, I.H.; Franco-Zorrilla, J.M.; Zhang, W.; Hill, K.; Raines, T.; Solano, R.; et al. Cytokinin induces genome-wide binding of the type-B response regulator ARR10 to regulate growth and development in Arabidopsis. Proc. Natl. Acad. Sci. USA 2017, 114, E5995–E6004. [Google Scholar] [CrossRef] [PubMed]
- Matthysse, A.G.; Abrams, M. A factor mediating interaction of kinins with the genetic material. Biochim. Biophys. Acta Nucleic Acids Protein Synth. 1970, 199, 511–518. [Google Scholar] [CrossRef]
- Klämbt, D. Cytokinin effects on protein synthesis of in vitro systems of higher plants. Plant Cell Physiol. 1976, 17, 73–76. [Google Scholar] [CrossRef]
- Muren, R.C.; Fosket, D.E. Cytokinin-Mediated Translational Control of Protein Synthesis in Cultured Cells of Glycine max. J. Exp. Bot. 1977, 28, 775–784. [Google Scholar] [CrossRef]
- Kulaeva, O.N. Cytokinin Action on Transcription and Translation in Plants. In Metabolism and Molecular Activities of Cytokinins. Proceedings in Life Sciences; Guern, J., Péaud-Lenoël, C., Eds.; Springer: Berlin/Heidelberg, Germany, 1981; pp. 218–227. [Google Scholar] [CrossRef]
- Waliszewska-Wojtkowiak, B.; Schneider, J.; Szweykowska, A. Effect of Kinetin on the Transcription Activity of Chromatin from Cucumber Cotyledons. Biochem. Physiol. Pflanz. 1985, 180, 413–422. [Google Scholar] [CrossRef]
- Crowell, D.N.; Kadlecek, A.T.; John, M.C.; Amasino, R.M. Cytokinin-induced mRNAs in cultured soybean cells. Proc. Natl. Acad. Sci. USA 1990, 87, 8815–8819. [Google Scholar] [CrossRef]
- Gaudino, R.J.; Pikaard, C.S. Cytokinin induction of RNA polymerase I transcription in Arabidopsis thaliana. J. Biol. Chem. 1997, 272, 6799–6804. [Google Scholar] [CrossRef] [PubMed]
- Hallmark, H.T.; Rashotte, A.M. Cytokinin isopentenyladenine and its glucoside isopentenyladenine-9G delay leaf senescence through activation of cytokinin-associated genes. Plant Direct 2020, 4, e00292. [Google Scholar] [CrossRef]
- Werner, T.; Schmülling, T. Cytokinin action in plant development. Curr. Opin. Plant Biol. 2009, 12, 527–538. [Google Scholar] [CrossRef] [PubMed]
- Mason, M.G.; Mathews, D.E.; Argyros, D.A.; Maxwell, B.B.; Kieber, J.J.; Alonso, J.M.; Ecker, J.R.; Schaller, G.E. Multiple type-B response regulators mediate cytokinin signal transduction in Arabidopsis. Plant Cell 2005, 17, 3007–3018. [Google Scholar] [CrossRef]
- Yokoyama, A.; Yamashino, T.; Amano, Y.-I.; Tajima, Y.; Imamura, A.; Sakakibara, H.; Mizuno, T. Type-B ARR transcription factors, ARR10 and ARR12, are implicated in cytokinin-mediated regulation of protoxylem differentiation in roots of Arabidopsis thaliana. Plant Cell Physiol. 2007, 48, 84–96. [Google Scholar] [CrossRef] [PubMed]
- Ishida, K.; Yamashino, T.; Yokoyama, A.; Mizuno, T. Three type-B response regulators, ARR1, ARR10 and ARR12, play essential but redundant roles in cytokinin signal transduction throughout the life cycle of Arabidopsis thaliana. Plant Cell Physiol. 2008, 49, 47–57. [Google Scholar] [CrossRef]
- Argyros, R.D.; Mathews, D.E.; Chiang, Y.H.; Palmer, C.M.; Thibault, D.M.; Etheridge, N.; Argyros, D.A.; Mason, M.G.; Kieber, J.J.; Schaller, G.E. Type B response regulators of Arabidopsis play key roles in cytokinin signaling and plant development. Plant Cell 2008, 20, 2102–2116. [Google Scholar] [CrossRef]
- Chang, H.; Chen, D.; Kam, J.; Richardson, T.; Drenth, J.; Guo, X.; McIntyre, C.L.; Chai, S.; Rae, A.L.; Xue, G.P. Abiotic stress upregulated TaZFP34 represses the expression of type-B response regulator and SHY2 genes and enhances root to shoot ratio in wheat. Plant Sci. 2016, 252, 88–102. [Google Scholar] [CrossRef]
- Worthen, J.M.; Yamburenko, M.V.; Lim, J.; Nimchuk, Z.L.; Kieber, J.J.; Schaller, G.E. Type-B response regulators of rice play key roles in growth, development and cytokinin signaling. Development 2019, 146, dev174870. [Google Scholar] [CrossRef]
- Li, C.; Gong, C.; Wu, J.; Yang, L.; Zhou, L.; Wu, B.; Gao, L.; Ling, F.; You, A.; Li, C.; et al. Improvement of Rice Agronomic Traits by Editing Type-B Response Regulators. Int. J. Mol. Sci. 2022, 23, 14165. [Google Scholar] [CrossRef]
- Wan, Q.; Zhai, N.; Xie, D.; Liu, W.; Xu, L. WOX11: The founder of plant organ regeneration. Cell Regen. 2023, 12, 1. [Google Scholar] [CrossRef] [PubMed]
- Qi, H.; Cai, H.; Liu, X.; Liu, S.; Ding, C.; Xu, M. The cytokinin type-B response regulator PeRR12 is a negative regulator of adventitious rooting and salt tolerance in poplar. Plant Sci. 2022, 325, 111456. [Google Scholar] [CrossRef] [PubMed]
- Ramírez-Carvajal, G.A.; Morse, A.M.; Dervinis, C.; Davis, J.M. The cytokinin type-B response regulator PtRR13 is a negative regulator of adventitious root development in Populus. Plant Physiol. 2009, 150, 759–771. [Google Scholar] [CrossRef]
- Ren, B.; Liang, Y.; Deng, Y.; Chen, Q.; Zhang, J.; Yang, X.; Zuo, J. Genome-wide comparative analysis of type-A Arabidopsis response regulator genes by overexpression studies reveals their diverse roles and regulatory mechanisms in cytokinin signaling. Cell Res. 2009, 19, 1178–1190. [Google Scholar] [CrossRef]
- Gao, B.; Fan, L.; Li, X.; Yang, H.; Liu, F.; Wang, L.; Xi, L.; Ma, N.; Zhao, L. RcRR1, a Rosa canina type-A response regulator gene, is involved in cytokinin-modulated rhizoid organogenesis. PLoS One 2013, 8, e72914. [Google Scholar] [CrossRef]
- Mazri, M.A. Role of cytokinins and physical state of the culture medium to improve in vitro shoot multiplication, rooting and acclimatization of date palm (Phoenix dactylifera L.) cv. Boufeggous. J. Plant Biochem. Biotechnol. 2015, 24, 268–275. [Google Scholar] [CrossRef]
- Zakizadeh, S.; Kaviani, B.; Onsinejad, R. In vitro rooting of amaryllis (Hippeastrum johnsonii), a bulbous plant, via NAA and 2-iP. Ann. Biol. Res. 2013, 4, 69–71. [Google Scholar]
- Ružić, D.V.; Vujović, T.I. The effects of cytokinin types and their concentration on in vitro multiplication of sweet cherry cv. Lapins (Prunus avium L.). Hortic. Sci. 2008, 35, 12–21. [Google Scholar] [CrossRef]
- De Klerk, G.J.; Hanecakova, J.; Jasik, J. The role of cytokinins in rooting of stem slices cut from apple microcuttings. Plant Biosyst. 2001, 135, 79–84. [Google Scholar] [CrossRef]
- Jaakola, L.; Tolvanen, A.; Laine, K.; Hohtola, A. Effect of N6-isopentenyladenine concentration on growth initiation in vitro and rooting of bilberry and lingonberry microshoots. Plant Cell Tissue Organ Cult. 2001, 66, 73–77. [Google Scholar] [CrossRef]
- Bishopp, A.; Lehesranta, S.; Vatén, A.; Help, H.; El-Showk, S.; Scheres, B.; Helariutta, K.; Mähönen, A.P.; Sakakibara, H.; Helariutta, Y. Phloem-transported cytokinin regulates polar auxin transport and maintains vascular pattern in the root meristem. Curr. Biol. 2011, 21, 927–932. [Google Scholar] [CrossRef]
- Barton, M.K. Twenty years on: The inner workings of the shoot apical meristem, a developmental dynamo. Dev. Biol. 2010, 341, 95–113. [Google Scholar] [CrossRef]
- Sussex, I.M.; Kerk, N.M. The evolution of plant architecture. Curr. Opin. Plant Biol. 2001, 4, 33–37. [Google Scholar] [CrossRef] [PubMed]
- Shi, B.; Vernoux, T. Patterning at the shoot apical meristem and phyllotaxis. Curr. Top. Dev. Biol. 2019, 131, 81–107. [Google Scholar] [CrossRef] [PubMed]
- Barton, M.K.; Poethig, R.S. Formation of the shoot apical meristem in Arabidopsis thaliana: An analysis of development in the wild type and in the shoot meristemless mutant. Development 1993, 119, 823–831. [Google Scholar] [CrossRef]
- Clark, S.E. Organ formation at the vegetative shoot meristem. Plant Cell 1997, 9, 1067–1076. [Google Scholar] [CrossRef] [PubMed]
- Endrizzi, K.; Moussian, B.; Haecker, A.; Levin, J.Z.; Laux, T. The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE. Plant J. 1996, 10, 967–979. [Google Scholar] [CrossRef] [PubMed]
- Long, J.A.; Barton, M.K. The development of apical embryonic pattern in Arabidopsis. Development 1998, 125, 3027–3035. [Google Scholar] [CrossRef] [PubMed]
- Aida, M.; Ishida, T.; Tasaka, M. Shoot apical meristem and cotyledon formation during Arabidopsis embryogenesis: Interaction among the CUP-SHAPED COTYLEDON and SHOOT MERISTEMLESS genes. Development 1999, 126, 1563–1570. [Google Scholar] [CrossRef]
- Wang, J.; Tian, C.; Zhang, C.; Shi, B.; Cao, X.; Zhang, T.Q.; Zhao, Z.; Wang, J.W.; Jiao, Y. Cytokinin Signaling Activates WUSCHEL Expression during Axillary Meristem Initiation. Plant Cell 2017, 29, 1373–1387. [Google Scholar] [CrossRef]
- Teo, W.L.; Kumar, P.; Goh, C.J.; Swarup, S. The expression of Brostm, a KNOTTED1-like gene, marks the cell type and timing of in vitro shoot induction in Brassica oleracea. Plant Mol. Biol. 2001, 46, 567–580. [Google Scholar] [CrossRef]
- Greb, T.; Clarenz, O.; Schafer, E.; Muller, D.; Herrero, R.; Schmitz, G.; Theres, K. Molecular analysis of the LATERAL SUPPRESSOR gene in Arabidopsis reveals a conserved control mechanism for axillary meristem formation. Genes Dev. 2003, 17, 1175–1187. [Google Scholar] [CrossRef]
- Long, J.; Barton, M.K. Initiation of axillary and floral meristems in Arabidopsis. Dev. Biol. 2000, 218, 341–353. [Google Scholar] [CrossRef] [PubMed]
- Shi, B.; Zhang, C.; Tian, C.; Wang, J.; Wang, Q.; Xu, T.; Xu, Y.; Ohno, C.; Sablowski, R.; Heisler, M.G.; et al. Two-Step Regulation of a Meristematic Cell Population Acting in Shoot proliferation in Arabidopsis. PLoS Genet. 2016, 12, e1006168. [Google Scholar] [CrossRef] [PubMed]
- Hirakawa, Y. Evolution of meristem zonation by CLE gene duplication in land plants. Nat. Plants 2022, 8, 735–740. [Google Scholar] [CrossRef]
- Hong, S.-Y.; Botterweg-Paredes, E.; Doll, J.; Eguen, T.; Blaakmeer, A.; Matton, S.; Xie, Y.; Lunding, B.S.; Zentgraf, U.; Guan, C.; et al. Multi-level analysis of the interactions between REVOLUTA and MORE AXILLARY BRANCHES 2 in controlling plant development reveals parallel, independent and antagonistic functions. Development 2020, 147, dev183681. [Google Scholar] [CrossRef] [PubMed]
- Riou-Khamlichi, C.; Huntley, R.; Jacqmard, A.; Murray, J.A. Cytokinin activation of Arabidopsis cell division through a D-type cyclin. Science 1999, 283, 1541–1544. [Google Scholar] [CrossRef]
- Gaamouche, T.; Manes, C.L.; Kwiatkowska, D.; Berckmans, B.; Koumproglou, R.; Maes, S.; Beeckman, T.; Vernoux, T.; Doonan, J.H.; Traas, J.; et al. Cyclin-dependent kinase activity maintains the shoot apical meristem cells in an undifferentiated state. Plant J. 2010, 64, 26–37. [Google Scholar] [CrossRef] [PubMed]
- Scofield, S.; Dewitte, W.; Nieuwland, J.; Murray, J.A.H. The Arabidopsis homeobox gene SHOOT MERISTEMLESS has cellular and meristem-organisational roles with differential requirements for cytokinin and CYCD3 activity. Plant J. 2013, 75, 53–66. [Google Scholar] [CrossRef] [PubMed]
- Dewitte, W.; Scofield, S.; Alcasabas, A.A.; Maughan, S.C.; Menges, M.; Braun, N.; Collins, C.; Nieuwland, J.; Prinsen, E.; Sundaresan, V.; et al. Arabidopsis CYCD3 D-type cyclins link cell proliferation and endocycles and are rate-limiting for cytokinin responses. Proc. Natl. Acad. Sci. USA 2007, 104, 14537–14542. [Google Scholar] [CrossRef]
- Xu, K.; Wang, Y.; Shi, L.; Sun, F.; Liu, S.; Xi, Y. PvTB1, a Teosinte Branched1 Gene Homolog, Negatively Regulates Tillering in Switchgrass. J. Plant Growth Regul. 2016, 35, 44–53. [Google Scholar] [CrossRef]
- Lewis, J.M.; Mackintosh, C.A.; Shin, S.; Gilding, E.; Kravchenko, S.; Baldridge, G.; Zeyen, R.; Muehlbauer, G.J. Overexpression of the maize Teosinte Branched1 gene in wheat suppresses tiller development. Plant Cell Rep. 2008, 27, 1217–1225. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Le Moigne, M.A.; Bertheloot, J.; Crespel, L.; Perez-Garcia, M.D.; Ogé, L.; Demotes-Mainard, S.; Hamama, L.; Davière, J.M.; Sakr, S. BRANCHED1: A Key Hub of Shoot Branching. Front. Plant Sci. 2019, 10, 76. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Kang, X.; Lei, W.; Yao, X.; Zou, L.; Zhang, D.; Lin, H. SHY2 as a node in the regulation of root meristem development by auxin, brassinosteroids, and cytokinin. J. Integr. Plant Biol. 2020, 62, 1500–1517. [Google Scholar] [CrossRef]
- Wang, M.; Le Gourrierec, J.; Jiao, F.; Demotes-Mainard, S.; Perez-Garcia, M.D.; Ogé, L.; Hamama, L.; Crespel, L.; Bertheloot, J.; Chen, J.; et al. Convergence and Divergence of Sugar and Cytokinin Signaling in Plant Development. Int. J. Mol. Sci. 2021, 22, 1282. [Google Scholar] [CrossRef]
- Chapman, E.J.; Estelle, M. Mechanism of Auxin-Regulated Gene Expression in Plants. Annu. Rev. Genet. 2009, 43, 265–285. [Google Scholar] [CrossRef]
- Dun, E.A.; de Saint Germain, A.; Rameau, C.; Beveridge, C.A. Antagonistic action of strigolactone and cytokinin in bud outgrowth control. Plant Physiol. 2012, 158, 487–498. [Google Scholar] [CrossRef]
- Zha, M.; Zhao, Y.; Wang, Y.; Chen, B.; Tan, Z. Strigolactones and Cytokinin Interaction in Buds in the Control of Rice Tillering. Front. Plant Sci. 2022, 13, 837136. [Google Scholar] [CrossRef]
- Stes, E.; Depuydt, S.; De Keyser, A.; Matthys, C.; Audenaert, K.; Yoneyama, K.; Werbrouck, S.; Goormachtig, S.; Vereecke, D. Strigolactones as an auxiliary hormonal defence mechanism against leafy gall syndrome in Arabidopsis thaliana. J. Exp. Bot. 2015, 66, 5123–5134. [Google Scholar] [CrossRef]
- Vylíčilová, H.; Husičková, A.; Spíchal, L.; Srovnal, J.; Doležal, K.; Plíhal, O.; Plíhalová, L. C2-substituted aromatic cytokinin sugar conjugates delay the onset of senescence by maintaining the activity of the photosynthetic apparatus. Phytochemistry 2016, 122, 22–33. [Google Scholar] [CrossRef]
- Kou, X.; Zhao, X.; Wu, B.; Wang, C.; Wu, C.; Yang, S.; Zhou, J.; Xue, Z. Auxin Response Factors Are Ubiquitous in Plant Growth and Development, and Involved in Crosstalk between Plant Hormones: A Review. Appl. Sci. 2022, 12, 1360. [Google Scholar] [CrossRef]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with Tobacco tissue cultures. Physiol. Plant 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Valencia-Lozano, E.; Ibarra, J.E.; Herrera-Ubaldo, H.; de Folter, S.; Cabrera-Ponce, J.L. Osmotic stress-induced somatic embryo maturation of coffee Coffea arabica L., shoot and root apical meristems development and robustness. Sci. Rep. 2021, 11, 9661. [Google Scholar] [CrossRef]
- Rueden, C.T.; Schindelin, J.; Hiner, M.C.; DeZonia, B.E.; Walter, A.E.; Arena, E.T.; Eliceiri, K.W. ImageJ2: ImageJ for the next generation of scientific image data. BMC Bioinform. 2017, 18, 529. [Google Scholar] [CrossRef]
- Meena, S.; Kumar, S.R.; Venkata-Rao, D.K.; Dwivedi, V.; Shilpashree, H.B.; Rastogi, S.; Shasany, A.K.; Nagegowda, D.A. De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses. Front. Plant Sci. 2016, 7, 1129. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]





| Culture Medium | Culture Medium | ||
|---|---|---|---|
| 5/5 2-iP (±SD) | 5/5 Ctrl (±SD) | p-Value | |
| Nucleus (μm) | 3.76 ± 0.23 | 3.2 ± 0.40 | 0.023 * |
| Nucleolus (μm) | 2.42 ± 0.38 | 1.88 ± 0.24 | 0.0001 ** |
| Cell area (μm2) | 107.07 ± 20.91 | 63.36 ± 30.91 | 0.0001 ** |
| ID | String | Function | Forward | Reverse |
|---|---|---|---|---|
| BRADI1G57607.1 | STM | Stem cell maintenance | TGCACTACAAGTGGCCTTAC | CCGTTTCCTCTGGTTGATG |
| BRADI3G28970.1 | REV | Stem cell maintenance | CTAGTTCCTGCACGGGATTT | CACCTCCTGAACCACTCAAA |
| NM_001124926.2 | CLV3 | Stem cell maintenance | CATGATGCTTCTGATCTCAC | GGGAGCTGAAAGTTGTTTC |
| NP_001388401.1 | CKX1 | CK metabolism | CTGATCGCCGCGCTGATCGC | CCCAGGACGGCGTCGAACAG |
| XM_015794058.2 | AHK3 | CK signaling | GTGAGGGGGAGCCTGGTGGCG | CTTCTTGATCGCCCACCCTTG |
| XM_003558408.4 | ARR1 | CK signaling | GATTATCCGAGAGGTGCGGG | TGGACGAGCATCTGCTTGAG |
| XM_010240442.3 | ARR4 | CK signaling | AGGCTCCTCAAGACCTCTTCT | CACGTTCACCTCAACATCCTGC |
| BRADI1G77325.1 | CDKA | Cell cycle regulation | CTTCTTGGAGCAAGGCAGTAT | TCTCAGAATCTCCAGGGAACA |
| BRADI4G08357.1 | CYCD3 | Cell cycle regulation | TCGCTGACTCGCTCTACT | ACATGAGCTCCTCCTCCTT |
| XM_003557426.3 | ARF5 | Auxin signaling | CTGCGCCTCGGCCCTCCTGG | CATATCCCATGGCACGTCTCC |
| XM_003565937.4 | SHY2 | Auxin repressor | GCCGCCGGCGGCCGCGCGGAC | CTCGTCCTTCTCCTCGTACGC |
| XM_014900703.2 | BRC1 | Shoot repression | AGGAGTTGCGGAGAAGTTG | CGAGATGATGAGCAACGACA |
| XM_003581453.4 | MAX3 | Shoot repression | GTGGCCAACACGAGCGTGCTC | CCGAACATCCTGTGGAAATG |
| * | EF1α | TCTCGGAGCTGCTCACCAA | GTCGCCATTCTTGAGGAACTTG | |
| * | GAPDH | CCCGACGAGCCCATCAT | CTTTTGGTCGAGCACCTTGAC | |
| * | ACT | GACTACGACCAGGAGATGGAGACT | ATGACCTGTCCATCAGGAAGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cárdenas-Aquino, M.d.R.; Camas-Reyes, A.; Valencia-Lozano, E.; López-Sánchez, L.; Martínez-Antonio, A.; Cabrera-Ponce, J.L. The Cytokinins BAP and 2-iP Modulate Different Molecular Mechanisms on Shoot Proliferation and Root Development in Lemongrass (Cymbopogon citratus). Plants 2023, 12, 3637. https://doi.org/10.3390/plants12203637
Cárdenas-Aquino MdR, Camas-Reyes A, Valencia-Lozano E, López-Sánchez L, Martínez-Antonio A, Cabrera-Ponce JL. The Cytokinins BAP and 2-iP Modulate Different Molecular Mechanisms on Shoot Proliferation and Root Development in Lemongrass (Cymbopogon citratus). Plants. 2023; 12(20):3637. https://doi.org/10.3390/plants12203637
Chicago/Turabian StyleCárdenas-Aquino, María del Rosario, Alberto Camas-Reyes, Eliana Valencia-Lozano, Lorena López-Sánchez, Agustino Martínez-Antonio, and José Luis Cabrera-Ponce. 2023. "The Cytokinins BAP and 2-iP Modulate Different Molecular Mechanisms on Shoot Proliferation and Root Development in Lemongrass (Cymbopogon citratus)" Plants 12, no. 20: 3637. https://doi.org/10.3390/plants12203637
APA StyleCárdenas-Aquino, M. d. R., Camas-Reyes, A., Valencia-Lozano, E., López-Sánchez, L., Martínez-Antonio, A., & Cabrera-Ponce, J. L. (2023). The Cytokinins BAP and 2-iP Modulate Different Molecular Mechanisms on Shoot Proliferation and Root Development in Lemongrass (Cymbopogon citratus). Plants, 12(20), 3637. https://doi.org/10.3390/plants12203637

