Investigating the Origin and Evolution of Polyploid Trifolium medium L. Karyotype by Comparative Cytogenomic Methods
Abstract
:1. Introduction
2. Results
2.1. Cytogenetic Variability in T. medium Ecotypes and Varieties
2.2. T. medium var. sarosiense
2.3. Diploid Relatives of T. medium–T. alpestre, T. rubens and T. pignantii
2.4. RepeatExplorer rDNA Cluster Analysis
3. Discussion
4. Materials and Methods
4.1. Plant Material and Chromosome Preparation
4.2. Probe DNA Isolation and Labelling
4.3. Fluorescence In Situ Hybridization
4.4. RepeatExplorer rDNA Clustering Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Taylor, N.L.; Quesenberry, K.H. Red Clover Science; Kluwer Academic: Dordrecht, The Netherland, 1996; p. 28. [Google Scholar]
- Kintl, A.; Elbl, J.; Lošák, T.; Vaverková, M.; Nedělník, J. Mixed intercropping of wheat and white clover to enhance the sustainability of the conventional cropping system: Effects on biomass production and leaching of mineral nitrogen. Sustainability 2018, 10, 3367. [Google Scholar] [CrossRef] [Green Version]
- Hyslop, M.G.; Kemp, P.D.; Hodgson, J. Vegetatively reproductive red clovers (Trifolium pratense L.): An overview. Proc. N. Z. Grassl. Assoc. 1999, 121–126. [Google Scholar] [CrossRef]
- Řepková, J.; Nedělník, J. Modern methods for genetic improvement of trifolium pratense. Czech J. Genet. Plant Breed 2014, 50, 92–99. [Google Scholar] [CrossRef] [Green Version]
- Abberton, M.T. Interspecific hybridization in the genus trifolium. Plant Breed 2007, 126, 337–342. [Google Scholar] [CrossRef]
- Řepková, J.; Jungmannová, B.; Jakešová, H. Identification of barriers to interspecific crosses in the genus trifolium. Euphytica 2006, 151, 39–48. [Google Scholar] [CrossRef]
- Řepková, J.; Jungmannová, B.; Jakešová, H. Interspecific hybridisation prospects in the genus trifolium. Czech J. Genet. Plant Breed 2003, 39, 306–308. [Google Scholar]
- Dluhošová, J.; Řepková, J.; Jakešová, H.; Nedělník, J. Impact of interspecific hybridization of T. pratense × T. medium and backcrossing on genetic variability of progeny. Czech J. Genet. Plant Breed 2016, 52, 125–131. [Google Scholar] [CrossRef] [Green Version]
- Jakešová, H.; Řepková, J.; Hampel, D.; Čechová, L.; Hofbauer, J. Variation of morphological and agronomic traits in hybrids of Trifolium pratense × T. medium and a comparison with the parental species. Czech J. Genet. Plant Breed 2011, 47, 28–36. [Google Scholar] [CrossRef] [Green Version]
- Jakešová, H.; Hampel, D.; Řepková, J.; Nedělník, J. Evaluation of feeding characteristics in variety Pramedi–interspecific hybrid Trifolium pratense × Trifolium medium. Úroda 2014, 12, 183–186. [Google Scholar]
- Isobe, S.; Sawai, A.; Yamaguchi, H.; Gau, M.; Uchiyama, K. Breeding potential of the backcross progenies of a hybrid between Trifolium medium × T. pratense to T. pratense. Can. J. Plant Sci. 2002, 82, 395–399. [Google Scholar]
- Renny-Byfield, S.; Wendel, J.F. Doubling down on genomes: Polyploidy and crop plants. Am. J. Bot. 2014, 101, 1711–1725. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dluhošová, J.; Ištvánek, J.; Nedělník, J.; Řepková, J. Red clover (Trifolium pratense) and zigzag clover (T. medium)–A picture of genomic similarities and differences. Front. Plant Sci. 2018, 9, 724. [Google Scholar] [CrossRef]
- Vižintin, L.; Javornik, B.; Bohanec, B. Genetic characterization of selected Trifolium species as revealed by nuclear DNA content and ITS rDNA region analysis. Plant Sci. 2006, 170, 859–866. [Google Scholar] [CrossRef]
- Sato, S.; Isobe, S.; Asamizu, E.; Ohmido, N.; Kataoka, R.; Nakamura, Y.; Kaneko, T.; Sakurai, N.; Okumura, K.; Klimenko, I.; et al. Comprehensive structural analysis of the genome of red clover (Trifolium pratense L.). DNA Res. 2005, 12, 301–364. [Google Scholar] [CrossRef] [Green Version]
- Kataoka, R.; Hara, M.; Kato, S.; Isobe, S.; Sato, S.; Tabata, S.; Ohmido, N. Integration of linkage and chromosome maps of red clover (Trifolium pratense L.). Cytogenet. Genome. Res. 2012, 137, 60–69. [Google Scholar] [CrossRef] [PubMed]
- Ištvánek, J.; Jaroš, M.; Křenek, A.; Řepková, J. Genome assembly and annotation for red clover (Trifolium pratense; Fabaceae). Am. J. Bot. 2014, 101, 327–337. [Google Scholar] [CrossRef]
- De Vega, J.J.; Ayling, S.; Hegarty, M.; Kudrna, D.; Goicoechea, J.L.; Ergon, Å.; Rognli, O.A.; Jones, C.; Swain, M.; Geurts, R.; et al. Red clover (Trifolium pratense L.) draft genome provides a platform for trait Improvement. Nature 2015, 5, 17394. [Google Scholar] [CrossRef] [Green Version]
- Salimpour, F.; Sharifnia, F.; Mostafavi, G.; Hajrasoliha, S.; Ukhneh, E. Chromosome counts and determination of ploid levels in Iranian species of Trifolium. Chromosome Bot. 2008, 3, 53–63. [Google Scholar] [CrossRef] [Green Version]
- Ellison, N.W.; Liston, A.; Steiner, J.J.; Williams, W.M.; Taylor, N.L. Molecular phylogenetics of the clover genus (Trifolium—Leguminosae). Mol. Phylogenet. Evol. 2006, 39, 688–705. [Google Scholar] [CrossRef]
- Vozárová, R.; Macková, E.; Vlk, D.; Řepková, J. Variation in ribosomal DNA in the genus Trifolium (Fabaceae). Plants 2021, 10, 1771. [Google Scholar] [CrossRef]
- Chromosome Counts Database. Available online: http://ccdb.tau.ac.il/ (accessed on 10 October 2022).
- Kobayashi, T.; Ganley, A.R.D. Recombination regulation by transcription-induced cohesin dissociation in rDNA repeats. Science 2005, 309, 1581–1584. [Google Scholar] [CrossRef] [PubMed]
- Raskina, O.; Barber, J.C.; Nevo, E.; Belyayev, A. Repetitive DNA and chromosomal rearrangements: Speciation-related events in plant genomes. Cytogenet. Genome Res. 2008, 120, 351–357. [Google Scholar] [CrossRef]
- Rosato, M.; Moreno-Saiz, J.C.; Galián, J.A.; Rosselló, J.A. Evolutionary site-number changes of ribosomal DNA loci during speciation: Complex scenarios of ancestral and more recent polyploid events. AoB Plants 2015, 7, 135. [Google Scholar] [CrossRef] [PubMed]
- Su, D.; Chen, L.; Sun, J.; Zhang, L.; Gao, R.; Li, Q.; Han, Y.; Li, Z. Comparative chromosomal localization of 45S and 5S rDNA sites in 76 purple-fleshed sweet potato cultivars. Plants 2020, 9, 865. [Google Scholar] [CrossRef]
- He, J.; Zhao, Y.; Zhang, S.; He, Y.; Jiang, J.; Chen, S.; Fang, W.; Guan, Z.; Liao, Y.; Wang, Z.; et al. Uneven levels of 5S and 45S rDNA site number and loci variations across wild chrysanthemum accessions. Genes 2022, 13, 894. [Google Scholar] [CrossRef]
- Yue, M.; Gautam, M.; Chen, Z.; Hou, J.; Zheng, X.; Hou, H.; Li, L. Histone acetylation of 45S rDNA correlates with disrupted nucleolar organization during heat stress response in Zea mays L. Physiol. Plant. 2021, 172, 2079–2089. [Google Scholar] [CrossRef]
- Macháčková, P.; Majeský, Ľ.; Hroneš, M.; Bílková, L.; Hřibová, E.; Vašut, R.J. New insights into ribosomal DNA variation in apomictic and sexual Taraxacum (Asteraceae). Bot. J. Linn. Soc. 2022, 199, 790–815. [Google Scholar] [CrossRef]
- Huang, M.; Li, H.; Zhang, L.; Gao, F.; Wang, P.; Hu, Y.; Yan, S.; Zhao, L.; Zhang, Q.; Tan, J.; et al. Plant 45S rDNA clusters are fragile sites and their instability is associated with epigenetic alterations. PLoS ONE 2012, 7, e35139. [Google Scholar] [CrossRef] [Green Version]
- Hanson, R.E.; Nurul Islam-Faridi, M.; Percival, E.A.; Crane, C.F.; Ji, Y.; McKnight, T.D.; Stelly, D.M.; Price, H.J. Distribution of 5S and 18S–28S rDNA loci in a tetraploid cotton (Gossypium hirsutum L.) and its putative diploid ancestors. Chromosoma 1996, 105, 55–61. [Google Scholar] [CrossRef]
- Breda, E.; Wolny, E.; Hasterok, R. Intraspecific polymorphism of ribosomal DNA loci number and morphology in Brachypodium pinnatum and Brachypodium sylvaticum. Cell. Mol. Biol. 2012, 17. [Google Scholar] [CrossRef] [Green Version]
- Chung, M.-C.; Lee, Y.-I.; Cheng, Y.-Y.; Chou, Y.-J.; Lu, C.-F. Chromosomal polymorphism of ribosomal genes in the genus Oryza. Theor. Appl. Genet. 2008, 116, 745–753. [Google Scholar] [CrossRef] [Green Version]
- Pedrosa, A.; Vallejos, C.; Bachmair, A.; Schweizer, D. Integration of common bean (Phaseolus vulgaris L.) linkage and chromosomal maps. Theor. Appl. Genet. 2003, 106, 205–212. [Google Scholar] [CrossRef]
- Lan, T.; Albert, V.A. Dynamic distribution patterns of ribosomal DNA and chromosomal evolution in Paphiopedilum, a Lady’s Slipper Orchid. BMC Plant Biol. 2011, 11, 126. [Google Scholar] [CrossRef]
- Shcherban, A.B.; Sergeeva, E.M.; Badaeva, E.D.; Salina, E.A. Analysis of 5S rdna changes in synthetic allopolyploids Triticum × Aegilops. Mol. Biol. 2008, 42, 536–542. [Google Scholar] [CrossRef]
- Książczyk, T.; Taciak, M.; Zwierzykowski, Z. Variability of ribosomal DNA sites in festuca pratensis, lolium perenne, and their intergeneric hybrids, revealed by FISH and GISH. J. Appl. Genet. 2010, 51, 449–460. [Google Scholar] [CrossRef]
- Malinska, H.; Tate, J.A.; Matyasek, R.; Leitch, A.R.; Soltis, D.E.; Soltis, P.S.; Kovarik, A. Similar patterns of rDNA evolution in synthetic and recently formed natural populations of Tragopogon (Asteraceae) allotetraploids. BMC Evol. Biol. 2010, 10, 291. [Google Scholar] [CrossRef] [Green Version]
- Garrido-Ramos, M. Satellite DNA: An evolving topic. Genes 2017, 8, 230. [Google Scholar] [CrossRef]
- Ávila Robledillo, L.; Neumann, P.; Koblížková, A.; Novák, P.; Vrbová, I.; Macas, J. Extraordinary sequence diversity and promiscuity of centromeric satellites in the legume tribe Fabeae. Mol. Biol. Evol. 2020, 37, 2341–2356. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.-R.; Zhang, W.; Langdon, T.; Jin, W.; Yan, H.; Cheng, Z.; Jiang, J. Chromatin immunoprecipitation cloning reveals rapid evolutionary patterns of centromeric DNA in Oryza species. Proc. Natl. Acad. Sci. USA 2005, 102, 11793–11798. [Google Scholar] [CrossRef] [Green Version]
- Lermontova, I.; Sandmann, M.; Demidov, D. Centromeres and kinetochores of Brassicaceae. Chromosome Res. 2014, 22, 135–152. [Google Scholar] [CrossRef]
- Yu, F.; Dou, Q.; Liu, R.; Wang, H. A Conserved repetitive DNA element located in the centromeres of chromosomes in Medicago genus. Genes Genom. 2017, 39, 903–911. [Google Scholar] [CrossRef]
- Neumann, P.; Navrátilová, A.; Schroeder-Reiter, E.; Koblížková, A.; Steinbauerová, V.; Chocholová, E.; Novák, P.; Wanner, G.; Macas, J. Stretching the rules: Monocentric chromosomes with multiple centromere domains. PLoS Genet. 2012, 8, e1002777. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Macas, J.; Novák, P.; Pellicer, J.; Čížková, J.; Koblížková, A.; Neumann, P.; Fuková, I.; Doležel, J.; Kelly, L.J.; Leitch, I.J. In depth characterization of repetitive DNA in 23 plant genomes reveals sources of genome size variation in the legume tribe Fabeae. PLoS ONE 2015, 10, e0143424. [Google Scholar] [CrossRef]
- Ávila Robledillo, L.; Koblížková, A.; Novák, P.; Böttinger, K.; Vrbová, I.; Neumann, P.; Schubert, I.; Macas, J. Satellite DNA in Vicia faba is characterized by remarkable diversity in its sequence composition, association with centromeres, and replication timing. Sci. Rep. 2018, 8, 5838. [Google Scholar] [CrossRef] [Green Version]
- Gong, Z.; Wu, Y.; Koblížková, A.; Torres, G.A.; Wang, K.; Iovene, M.; Neumann, P.; Zhang, W.; Novák, P.; Buell, C.R.; et al. repeatless and repeat-based centromeres in potato: Implications for centromere evolution. Plant Cell 2012, 24, 3559–3574. [Google Scholar] [CrossRef] [Green Version]
- Huang, Y.; Ding, W.; Zhang, M.; Han, J.; Jing, Y.; Yao, W.; Hasterok, R.; Wang, Z.; Wang, K. The formation and evolution of centromeric satellite repeats in Saccharum species. Plant J. 2021, 106, 616–629. [Google Scholar] [CrossRef]
- Iwata-Otsubo, A.; Radke, B.; Findley, S.; Abernathy, B.; Vallejos, C.E.; Jackson, S.A. Fluorescence In Situ Hybridization (FISH)-based karyotyping reveals rapid evolution of centromeric and subtelomeric repeats in common bean (Phaseolus vulgaris) and Relatives. G3-Genes Genom. Genet. 2016, 6, 1013–1022. [Google Scholar] [CrossRef] [Green Version]
- Henikoff, S.; Ahmad, K.; Malik, H.S. The centromere paradox: Stable inheritance with rapidly evolving DNA. Science 2001, 293, 1098–1102. [Google Scholar] [CrossRef] [Green Version]
- Kirov, I.V.; Van Laere, K.; Van Roy, N.; Khrustaleva, L.I. Towards a FISH-based karyotype of Rosa L. (Rosaceae). Comp. Cytogenet. 2016, 10, 543–554. [Google Scholar] [CrossRef]
- Wang, G.; He, Q.; Macas, J.; Novák, P.; Neumann, P.; Meng, D.; Zhao, H.; Guo, N.; Han, S.; Zong, M.; et al. Karyotypes and distribution of tandem repeat sequences in Brassica Nigra determined by fluorescence in Situ Hybridization. Cytogenet. Genome Res. 2017, 152, 158–165. [Google Scholar] [CrossRef]
- Kadluczka, D.; Grzebelus, E. Using carrot centromeric repeats to study karyotype relationships in the genus Daucus (Apiaceae). BMC Genomics 2021, 22, 508. [Google Scholar] [CrossRef]
- Zhao, H.; Li, S.; Yang, C.; Li, G.; Wang, Y.; Peng, J.; Yan, Z.; Li, R.; Wang, Y.; Zhang, L. FISH-based karyotype analyses of four Dracaena species. Cytogenet. Genome Res. 2021, 161, 272–277. [Google Scholar] [CrossRef]
- Borowska-Zuchowska, N.; Senderowicz, M.; Trunova, D.; Kolano, B. Tracing the evolution of the angiosperm genome from the cytogenetic point of view. Plants 2022, 11, 784. [Google Scholar] [CrossRef]
- Rosato, M.; Galián, J.A.; Rosselló, J.A. Amplification, contraction and genomic spread of a satellite DNA family (E180) in Medicago (Fabaceae) and allied genera. Ann. Bot.-Lond. 2012, 109, 773–782. [Google Scholar] [CrossRef] [Green Version]
- Pellerin, R.J.; Waminal, N.E.; Kim, H.H. FISH mapping of rDNA and telomeric repeats in 10 Senna Species. Hortic. Environ. Biote. 2019, 60, 253–260. [Google Scholar] [CrossRef]
- Nguyen, T.H.; Waminal, N.E.; Lee, D.S.; Pellerin, R.J.; Ta, T.D.; Campomayor, N.B.; Kang, B.Y.; Kim, H.H. Comparative triple-color FISH mapping in eleven Senna species using rDNA and telomeric repeat probes. Hortic. Environ. Biotechnol. 2021, 62, 927–935. [Google Scholar] [CrossRef]
- Du, P.; Li, L.; Zhang, Z.; Liu, H.; Qin, L.; Huang, B.; Dong, W.; Tang, F.; Qi, Z.; Zhang, X. Chromosome painting of telomeric repeats reveals new evidence for genome evolution in peanut. J. Integ. Agr. 2016, 15, 2488–2496. [Google Scholar] [CrossRef] [Green Version]
- She, C.-W.; Wei, L.; Jiang, X.-H. Molecular cytogenetic characterization and comparison of the two cultivated Canavalia species (Fabaceae). Comp. Cytogenet. 2017, 11, 579–600. [Google Scholar] [CrossRef] [Green Version]
- Susek, K.; Bielski, W.K.; Hasterok, R.; Naganowska, B.; Wolko, B. A first glimpse of wild lupin karyotype variation as revealed by comparative cytogenetic mapping. Front. Plant Sci. 2016, 7, 1152. [Google Scholar] [CrossRef] [Green Version]
- Yurkevich, O.Y.; Samatadze, T.E.; Levinskikh, M.A.; Zoshchuk, S.A.; Signalova, O.B.; Surzhikov, S.A.; Sychev, V.N.; Amosova, A.V.; Muravenko, O.V. Molecular Cytogenetics of Pisum sativum L. grown under spaceflight-related stress. BioMed Res. Int. 2018, 2018, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Li, W.; Challa, G.S.; Zhu, H.; Wei, W. Recurrence of chromosome rearrangements and reuse of DNA breakpoints in the evolution of the Triticeae genomes. G3-Genes Genom. Genet. 2016, 6, 3837–3847. [Google Scholar] [CrossRef] [Green Version]
- Garcia, S.; Wendel, J.F.; Borowska-Zuchowska, N.; Aïnouche, M.; Kuderova, A.; Kovarik, A. The utility of graph clustering of 5s ribosomal dna homoeologs in plant allopolyploids, homoploid hybrids, and cryptic introgressants. Front. Plant Sci. 2020, 11, 41. [Google Scholar] [CrossRef] [Green Version]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Lysák, M.A.; Mandáková, T. Analysis of plant meiotic chromosomes by chromosome painting. Methods Mol. Biol. 2013, 990, 13–24. [Google Scholar]
- Kirov, I.; Divashuk, M.; Van Laere, K.; Soloviev, A.; Khrustaleva, L. An easy “steamdrop” method for high quality plant chromosome preparation. Mol. Cytogenet. 2014, 7, 21. [Google Scholar] [CrossRef] [Green Version]
- Novák, P.; Neumann, P.; Pech, J.; Steinhaisl, J.; Macas, J. RepeatExplorer: A galaxy-based web server for genome-wide characterization of eukaryotic repetitive elements from next-generation sequence reads. Bioinformatics 2013, 29, 792–793. [Google Scholar] [CrossRef]
Number of Chromosomes | 5S rDNA | 26S rDNA | 26S rDNA Position | TrM378 Loci | TrM300 loci | TrM300 Position | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Co-Localized with 5S | Separately | Co-Localized with TrM378 | Separately | |||||||||
Ecotypes | T. medium 1 | 74 | 18 | 9 | 4 | 5 | 28 | 12 | 2 | 10 | ||
19 | 9 | 7 | 2 | 28 | 10 | 4 | 6 | |||||
64 | 16 | 10 | 3 | 7 | ||||||||
T. medium 2 | 64 | 8 | 8 | 0 | all | 24 | 8 | 0 | all | |||
26 | 8 | 0 | all | |||||||||
16 | 10 | 0 | all | |||||||||
T. medium 3 | 64 | 15 | 8 | all | 0 | 22 | 20 | 11 | 9 | |||
12 | 7 | 5 | 2 | 18 | 10 | 0 | all | |||||
16 | 9 | 0 | all | |||||||||
T. medium 4 | 64 | 13 | 7 | 1 | 6 | 18 | 8 | 0 | all | |||
16 | 6 | 0 | all | |||||||||
16 | 10 | 2 | 8 | |||||||||
T. medium 5 | 64 | 16 | 8 | all | 0 | 24 | 8 | all | 0 | |||
28 | 22 | all | 0 | |||||||||
T. medium 6 | 64 | 14 | 8 | 5 | 3 | 28 | 23 | 16 | 7 | |||
10 | 8 | 4 | 4 | 20 | 7 | 4 | 3 | |||||
12 | 10 | 3 | 7 | |||||||||
T. medium 7 | 70 | 14 | 10 | 5 | 5 | 22 | 10 | 8 | 2 | |||
14 | 10 | 7 | 3 | 22 | 9 | 2 | 7 | |||||
18 | 8 | 7 | 1 | 24 | 12 | 0 | all | |||||
Varieties | T. medium 8/40 | 64 | 10 | 7 | 0 | all | 38 | 18 | 6 | 12 | ||
14 | 11 | 0 | all | 20 | 9 | 3 | 6 | |||||
10 | 10 | 0 | all | 32 | 9 | 0 | all | |||||
T. medium 8/41 | 64 | 8 | 6 | 0 | all | 28 | 8 | 6 | 2 | |||
10 | 13 | 5 | 8 | 28 | 12 | 6 | 6 | |||||
10 | 8 | 0 | all | |||||||||
T. medium Melot | 76 | 10 | 12 | 0 | all | 32 | 10 | 0 | all | |||
12 | 12 | 0 | all | 30 | 12 | 4 | 8 | |||||
32 | 8 | 2 | 6 | |||||||||
T. medium Ruža | 64 | 8 | 8 | 0 | all | 26 | 12 | 6 | 6 | |||
24 | 12 | 4 | 8 |
Acquired from | Origin | Accession Number | |
---|---|---|---|
T. medium 1 | GRIN, CZ | CZ | 13T0500049 |
T. medium 2 | GRIN, CZ | CZ | 13T0500437 |
T. medium 3 | GRIN, CZ | SRB | 13T0500062 |
T. medium 4 | GRIN, CZ | SRB | 13T0500110 |
T. medium 5 | GRIN, CZ | SRB | 13T0500108 |
T. medium 6 | GRIN, CZ | CZ | 13T0500116 |
T. medium 7 | GRIN, CZ | CZ | 13T0500113 |
T. medium 8/40 1 | RCGB, CZ | CZ | - |
T. medium 8/41 1 | RCBG, CZ | CZ | - |
T. medium Melot 2 | RIFC, Ltd., CZ | CZ | - |
T. medium Ruža 3 | RCGB, CZ | CZ | - |
T. medium var. sarosiense | IPK, DE | - | TRIF 179 |
T. alpestre | IPK, DE | - | TRIF 210 |
T. pignantii | IPK, DE | - | TRIF 277 |
T. rubens | IPK, DE | GRE | TRIF 211 |
Probe | Forward Primer | Reverse Primer | PCR Product Length (bp) |
---|---|---|---|
26S rDNA | TTCCCACTGTCCCTGTCTACTAT | GAACGGACTTAGCCAACGACA | 899 |
5S rDNA | GGTGCGATCATACCAGCACTAA | GAGGTGCAACACAAGGACTTC | 117 |
TrM378 | ACTTTTGATCTGGTTATCTCT | ACTGTATATGAATCGAGAAGCA | 378 |
TrM300 | CTGTTAGTAAGCTATTAGAAGT | ATTTAACTTATCTGCACTATCTT | 300 |
TrM179 | CTCTACGTATTTCGGTAGTGCCC | TCATTGTTTTTACCCGACGAACG | 132 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lukjanová, E.; Hanulíková, A.; Řepková, J. Investigating the Origin and Evolution of Polyploid Trifolium medium L. Karyotype by Comparative Cytogenomic Methods. Plants 2023, 12, 235. https://doi.org/10.3390/plants12020235
Lukjanová E, Hanulíková A, Řepková J. Investigating the Origin and Evolution of Polyploid Trifolium medium L. Karyotype by Comparative Cytogenomic Methods. Plants. 2023; 12(2):235. https://doi.org/10.3390/plants12020235
Chicago/Turabian StyleLukjanová, Eliška, Alžběta Hanulíková, and Jana Řepková. 2023. "Investigating the Origin and Evolution of Polyploid Trifolium medium L. Karyotype by Comparative Cytogenomic Methods" Plants 12, no. 2: 235. https://doi.org/10.3390/plants12020235