Next Article in Journal
Phosphorus Acquisition Efficiency and Transcriptomic Changes in Maize Plants Treated with Two Lignohumates
Previous Article in Journal
Watermelon Rind Mediated Biosynthesis of Bimetallic Selenium-Silver Nanoparticles: Characterization, Antimicrobial and Anticancer Activities
Previous Article in Special Issue
Molecular and Morphological Characterization of Introgression Lines with Resistance to Bacterial Leaf Blight and Blast in Rice
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Association Study of Starch Properties in Local Thai Rice

by
Parama Praphasanobol
1,2,
Putut Rakhmad Purnama
2,3,
Supaporn Junbuathong
4,
Somsong Chotechuen
5,
Peerapon Moung-Ngam
4,
Waraluk Kasettranan
6,
Chanita Paliyavuth
6,
Luca Comai
7,
Monnat Pongpanich
8,
Teerapong Buaboocha
9,10 and
Supachitra Chadchawan
2,10,*
1
Biological Sciences Program, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand
2
Center of Excellence in Environment and Plant Physiology, Department of Botany, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand
3
Bioinformatics and Computational Biology Program, Graduate School, Chulalongkorn University, Bangkok 10330, Thailand
4
Pathum Thani Rice Research Center, Ministry of Agriculture and Cooperatives, Thanyaburi, Pathum Thani 12110, Thailand
5
Division of Rice Research and Development, Rice Department, Ministry of Agriculture and Cooperatives, Bangkok 10900, Thailand
6
Department of Botany, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand
7
Department of Plant Biology and Genome Center, University of California Davis, Davis, CA 95616, USA
8
Department of Mathematics and Computer Science, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand
9
Center of Excellence in Molecular Crop, Department of Biochemistry, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand
10
Omics Sciences and Bioinformatics Center, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand
*
Author to whom correspondence should be addressed.
Plants 2023, 12(18), 3290; https://doi.org/10.3390/plants12183290
Submission received: 16 July 2023 / Revised: 12 September 2023 / Accepted: 14 September 2023 / Published: 17 September 2023
(This article belongs to the Special Issue Functional Genomics and Molecular Breeding of Crops)

Abstract

:
Rice (Oryza sativa L.) is the main source of energy for humans and a staple food of high cultural significance for much of the world’s population. Rice with highly resistant starch (RS) is beneficial for health and can reduce the risk of disease, especially type II diabetes. The identification of loci affecting starch properties will facilitate breeding of high-quality and health-supportive rice. A genome-wide association study (GWAS) of 230 rice cultivars was used to identify candidate loci affecting starch properties. The apparent amylose content (AAC) among rice cultivars ranged from 7.04 to 33.06%, and the AAC was positively correlated with RS (R2 = 0.94) and negatively correlated with rapidly available glucose (RAG) (R2 = −0.73). Three loci responsible for starch properties were detected on chromosomes 1, 6, and 11. On chromosome 6, the most significant SNP corresponded to LOC_Os06g04200 which encodes granule-bound starch synthase I (GBSSI) or starch synthase. Two novel loci associated with starch traits were LOC_Os01g65810 and LOC_Os11g01580, which encode an unknown protein and a sodium/calcium exchanger, respectively. The markers associated with GBSSI and LOC_Os11g01580 were tested in two independent sets of rice populations to confirm their effect on starch properties. The identification of genes associated with starch traits will further the understanding of the molecular mechanisms affecting starch in rice and may be useful in the selection of rice varieties with improved starch.

1. Introduction

Increasing economic and social development during the 20th century has increased aging in the world’s population. This trend will continue [1]. According to the International Diabetic Federation, changes in human lifestyle and dietary preferences have led to an increase in health problems and diseases, as exemplified by the rising prevalence of obesity, type II diabetes, and coronary artery disease [2,3]. Dietary choices are thought to be important for maintaining health. Rice (Oryza sativa L.) is one of the most important crops in the world and a main source of energy for humans, especially in Asia [4]. Starch, the main component of the grain’s endosperm, is the major source of carbohydrates in staple foods. It consists of two types of molecules, amylose and amylopectin [5], whose fractions vary depending on the source of starch. According to the International Rice Research Institute, rice starch can be classified into four groups based on the apparent amylose content (AAC): low or waxy (0–5%), low (5–20%), medium (20–25%), and high (26–33%) AAC [6]. AAC is the main starch factor affecting digestion and absorption in the small intestine. Additionally, starch can be categorized according to its digestion properties by the content of rapidly available glucose (RAG), slowly available glucose (SAG), and resistant starch (RS) [7,8]. RAG refers to glucose available for absorption in the small intestine within 20 min. Eating rice with a high RAG can lead to a rapid increase in blood glucose. SAG refers to glucose that becomes available for absorption in the small intestine within 120 min; rice with high SAG is digested slowly in the small intestine and results in a more gradual release of glucose in the blood. RS refers to the starch that cannot be digested in the small intestine but is beneficial for gut microbes in the large intestine. Moreover, RS can increase the feeling of fullness and decrease calorie intake, which may help reduce the risk of high blood glucose levels [9]. The glycemic index (GI) is an indicator used to measure the effect of carbohydrates on blood glucose levels after digestion. The glycemic response is directly related to digestible starch [10]. Rapidly digestible starch can increase blood glucose levels. Consumption of foods with low GI can reduce the prevalence of type II diabetes, obesity, hyperlipidemia, and cardiovascular disease [11].
Starch is synthesized through the coordinated activities of multiple enzymes, including ADP-glucose pyrophosphorylase (AGPase), starch synthase (SS), and the starch branching enzyme (SBE) [12]. AGPase is the key regulatory enzyme in starch biosynthesis, controlling starch levels in all plants [13,14]. SS can be divided into granule-bound starch synthase (GBSS) or Waxy (Wx), which regulates starch accumulation and is the main enzyme for the synthesis and elongation of amylose. Soluble starch synthase (SSS) is the main enzyme for amylopectin elongation [15,16]. Additionally, SBE is mainly involved in the structure of starch by catalyzing and creating a branch in glucose polymers [17].
A genome-wide association study (GWAS) is an effective method for predicting candidate genes based on the relationship between genetic and phenotypic variants. Presently, many genes are known to be responsible for rice starch properties. GBSSI controls the amount of amylose content [18,19,20] and is associated with the RS content in rice [9,21]. Additionally, it is the major gene responsible for the GI in rice [22,23,24]. Moreover, ADP-glucose pyrophosphorylase small subunit 1 (AGPS1), starch synthase IIa (SSIIa), and isoamylase 1 (ISA1) are also associated with the RS content [9]. However, there is limited knowledge of genetic variants explaining the apparent amylose and digestible starch contents in Thai rice. In this study, we aim to identify candidate genes responsible for the starch property in Thai landrace rice varieties using GWAS and to develop molecular markers for starch traits in a rice breeding program.

2. Results

2.1. Evaluation of Phenotypic Parameters

The value of the starch property (AAC: apparent amylose, RAG: rapidly available glucose, SAG: slowly available glucose, RS: resistant starch, HI: hydrolysis index, and GI: glycemic index) was evaluated in 230 rice cultivars (Supplemented Table S1). The AAC values ranged from 7.04% (Gam Meuang Nan) to 33.06% (Lai Mahk), with an average of 22.17 ± 0.82%. The RAG values ranged from 15.14% (Leb Nok) to 23.05% (Dam Dahng and E-Meud), with an average of 18.97 ± 0.71%. The SAG values ranged from 7.81% (Khao’ Niaw Dam Maw) to 14.44% (Leuang Bahn Sang), with an average of 11.14 ± 0.84%. RS values ranged from 2.11% (Khao’ Gam GS.23113) to 4.50% (Ta Nod), with an average of 3.14 ± 0.20%. Moreover, the HI and GI values ranged from 28.11% (Daw Yuan) to 46.82% (Hawm Nin) and from 55.53% to 65.42%, respectively. These values display significant correlations as shown in Figure 1. The AAC and RS values showed a strong positive correlation but were negatively correlated with the RAG. Additionally, no significant correlation was found in the SAG, the HI, and the GI (Figure 1, Supplementary Table S2).
Based on clustering analysis of starch properties, the 230 rice cultivars were separated into five groups (Supplementary Table S1). Group 1 consisted of 43 cultivars with a low AAC and RS, a medium SAG, a high RAG and a medium to high GI. Group 2 included 16 cultivars of low AAC and RS, a medium to high SAG, a medium to high RAG, and a low GI. Most rice members of groups 1 and 2 were sticky rice or waxy rice. Thus, groups 1 and 2 were divided from the other groups, which have higher values of AAC and RS. Group 3 contained 33 cultivars with low to medium AAC, RS, and SAG and with very high RAG and GI. Group 4 consisted of 88 cultivars with medium to high AAC, RS, and SAG and with medium RAG and GI. The last group (group 5) included 50 cultivars with medium to high AAC, RS, and SAG and with low RAG and GI (Figure 2, Supplementary Table S1). Among these groups, rice varieties in group 5 were the best candidates for the development of healthy food because of their low GI and high RS. These cultivars include ‘Hawm Gulahb Daeng’, ‘Nam Dawk Mai 595′, ‘Sai Bua 59-106-2′, ‘Khao Nahng Mon’, ‘Hawm Mali Daeng’, ‘Nahng Chalawng’, and ‘Leuang Bahn Sang’.

2.2. Genome Wide Association of Starch Traits in Thai Rice Populations

These cultivars were used for entire genome sequencing. The SNPs were distributed across the genome. The density of the SNPs in 12 chromosomes of Oryza sativa is shown in Figure 3. In total, 346,448 high-quality SNPs were genotyped across the rice population.

2.2.1. Association Mapping

To identify the genetic loci responsible for the variation in the starch properties of the 230 rice cultivars, GWAS was conducted based on genomic SNP, and Manhattan plots were generated to determine loci significantly associated with starch properties (Figure 4). Based on these GWAS, 156 SNPs located on 32 causative loci were identified (Figure 4, Table 1), suggesting the involvement of these genes in starch characteristics and the amylose content in rice. At least three significant peaks on the GWA mapping for AAC, RAG, and RS were detected on chromosomes 1, 6, and 11 with a threshold of −log(p) = 6.84. Although other SNPs occurred on chromosomes 2 and 7, their significance level was lower. No significant SNPs were determined by the association of SAG, HI, and GI (Figure 4).
There were 15 loci that were consistently identified based on the association of three traits: AAC, RAG, and RS, while 5 loci were identified by the AAC trait only (Figure 5, Table 1). These findings demonstrate that the analysis of the AAC trait can reveal more causative loci.
Based on the AAC trait, the causative loci with the most significant (the lowest p value) SNPs are on chromosomes 1, 6, and 11 (Figure 4A). On chromosome 1, the significant SNPs are in LOC_Os01g65810, which encodes a putative unknown protein, while on chromosome 6, the significant SNPs are in several loci (Table 1), with the most significant SNPs in LOC_Os06g04200, encoding starch synthase or granule-bound starch synthase I (GBSSI). Within this gene, the analysis detected a total of 14 SNPs located in 5′ UTR, exon 1, intron 9, and 3′end regions (Supplementary Table S3). On chromosome 11, the most significant SNPs were in LOC_Os11g01580, encoding a sodium/calcium exchanger protein. This is the first report associating an ion transporter to starch traits in rice.
To investigate the linked segments, we determined pairwise linkage disequilibrium (LD) between the most significant AAC-associated SNPs on chromosomes 1, 6, and 11 (Figure 6). SNP100443 on chromosome 1 was associated with the AAC trait at the lowest p value (Figure 6A). There were five close LD blocks. LD blocks 1, 4, and 5 contained the uncharacterized gene (expressed proteins), while block 2, which is 16 kb long, contained the SNPs in LOC_Os01g65780, encoding the glycosyl transferase protein. LD block 3 contained two genes, LOC_Os01g65790 and LOC_Os01g65800, encoding pectin esterase and the powdery mildew resistant protein 5, respectively (Figure 6B and Supplementary Table S4). Pairwise LD with SNP516807 on chromosome 6 demonstrated one large 33kb block and three smaller ones. LOC_Os06g04200, encoding starch synthase, is in all four blocks, with the most significant SNP in this region, SNP516807, located in block 1 (Figure 6C and Supplementary Table S5). SNP902089 is the most significant SNP on chromosome 11 (Figure 6A) and it is in block 6 as shown in Figure 6D and Supplementary Table S6. Block 1 contains the LOC_Os11g01510 gene encoding the ubiquitin-activating enzyme, while LOC_Os11g01530, which encodes ferritin-1, lays over blocks 2 and 3. PMR5 (LOC_Os11g01570) is in block 5.
To demonstrate the association between alternative alleles in each locus with the AAC trait, the AAC and alleles found in 230 rice cultivars in each position of the causative genes, LOC_Os01g65810, LOC_Os06g04200, and LOC_Os11g01580, are shown in Figure 7. A single SNP was detected in LOC_Os01g65810 (Figure 7A). The heterozygous allele (C/T) in Chr1:38218116 represents high AAC, while the homozygous allele (CC) represents low AAC (Figure 7A). On chromosome 6 (Figure 7B–O), SNPs in the 5′ UTR region, Chr6:1765761 (Figure 7B), Chr6:1765887 (Figure 7C), and Chr6:1766058 (Figure 7D) showed alternative alleles (different from reference genome), causing high AAC. These show that the alternative SNP in Chr6:1765761, the insertion at Chr6:1765887, and the deletion at Chr6:1766058 are associated with a high AAC. An insertion at position 1767006 in exon 1 of LOC_Os06g04200 resulted in the highest significant SNP (−log(p) = 41.77) at this position (Figure 4A). Two different allelic patterns, G and GCCACGGGTTCCAGGGCCTCAA, were found. The insertion was well associated with low AAC (Figure 7E). Also, SNPs on chromosome 6 at position 1769158 (Figure 7F), 1769205 (Figure 7G), and 1769256 (Figure 7H) are in intron 9 of LOC_Os06g04200. The alternative alleles, which are the deletion in position Chr6:1769158, the SNP in position Chr6:1769205, and Chr6:1769256 led to an increase in AAC (Figure 7F–H). Moreover, the alternative alleles of SNPs in the 3′end region of LOC_Os06g04200 located at positions 1770672 (Figure 7I), 1770763 (Figure 7J), 1770890 (Figure 7K), 1770909 (Figure 7L), 1770964 (Figure 7M), 1771095 (Figure 7M), and 1771117 (Figure 7O) resulted in higher AAC. In addition, many loci on chromosome 6, which were associated with starch properties, affected an expressed protein and were located close to GBSSI. These genes are LOC_Os06g04195, LOC_Os06g04210, LOC_Os06g04220, LOC_Os06g04230, and LOC_Os06g04240 (Table 1). The other loci on chromosome 6, LOC_Os06g04080 and LOC_Os06g04169, were also associated with AAC, RAG, and RS contents. LOC_Os06g04080 and LOC_Os06g04169 encoded glycosyl hydrolases and alpha/beta hydrolase, respectively, which catalyze the hydrolysis of starch. Furthermore, three SNPs on chromosome 11 which were positions 334302 (Figure 7P), 334530 (Figure 7Q), and 334582 (Figure 7R) were in exon 2 of LOC_Os11g01580, encoding the sodium/calcium exchanger protein. High AAC was associated with the heterozygous alleles in all positions, namely Chr11:334302 (Figure 7P), Chr11:334530 (Figure 7Q), and Chr11:334582 (Figure 7R), suggesting that the duplication in this gene had occurred and led to a high AAC.

2.2.2. Molecular Marker Analysis

We designed markers to detect genetic variation in starch-controlling loci. Two molecular markers were developed to genotype loci affecting AAC, RAG, and RS in the rice population. The first molecular marker (marker I) was targeted to SNPs of exon 1 in LOC_Os06g04200 (GBSSI). The second molecular marker (marker II) was developed to genotype LOC_Os11g01580 (sodium/calcium exchanger protein). Two independent rice populations, each containing 100 cultivars, were used to study the correlation between the markers and the starch traits. The rice cultivar lists are shown in Supplementary Tables S7 and S8. For the first molecular marker (marker I), the amplified PCR product was digested with restriction enzyme BpuEI. Two patterns were obtained. The first pattern consisted of double bands of 360 and 257 bp, and the second pattern consisted of three bands: 380, 360, and 257 bp (Supplementary Figure S1A). A higher % AAC, a lower % RAG, and a higher % RS associate with the double band pattern in both rice populations (Figure 8A–D). A second molecular marker (marker II) was developed to detect SNPs in LOC_Os11g01580 (sodium/calcium exchanger protein). After amplification, two patterns, including a single band of 530 bp and triple bands of 570, 530, and 480 bp, were detected (Supplementary Figure S1B). The triple pattern was associated with higher % AAC and % RS and a lower % RAG (Figure 8E–H).
Both markers can explain % AAC ranging from 0.50 to 0.85 R2. They were also correlated to the RS trait in both populations. Interestingly, for the RAG trait, both markers showed a much lower R2 in rice population I than in population II. It explained only 4–6% of the variation in population I, while it accounted for more than 30% of the RAG in population II. Neither marker could explain the SAG trait (Table 2).

3. Discussion

3.1. Evaluation of Rice Phenotypes

Thai rice varieties displayed a wide variation in the apparent amylose content (AAC). The AAC of 230 rice cultivars ranged from 7.04 to 33.06% (Supplementary Table S1). All cultivars are indica rice. Most of them are Thai landrace, collected from various parts of Thailand (Figure 9) and do not have genetic relationships. They were selected for the study based on the variation in AAC. Only some cultivars were genetically related: ‘Tab Tim Chumpae (RD 69)’ whose parental cultivars are ‘KDML105’ and ‘Sang Yod’ and ‘RD 43’ whose parents are ‘Supanburi 1’ and ‘Hawm Supanburi’. According to Juliano [6], the rice in this study can be classified into four groups, as follows: Rice with very low AAC (<10%) ranged from 7.04 to 9.06 % and contained mostly sticky rice or glutinous rice. Rice with low AAC (10–20%) showed AAC values ranging from 11.19 to 20.12%. Rice with medium AAC (20–25%) displayed AAC values from 21.16 to 25.98%, and rice with high AAC (>25%) ranged from 26.09 to 33.06% (Supplementary Table S1). However, in this study, by combining AAC and digestible starch, we demonstrated five clusters: Group 1 is low to medium amylose and resistant starch (RS), medium slow available glucose (SAG), high rapidly available glucose (RAG), and medium to high (GI); group 2 is low to medium amylose and RS, medium to high SAG, medium to high RAG, and low GI; group 3 is low to medium amylose, RS, and SAG and very high RAG and GI; group 4 is medium to high amylose, RS, and SAG, medium RAG and GI; and the last group (group 5) is medium to high amylose, RS, and SAG and low RAG and GI (Figure 2; Supplementary Table S1). ‘RD 69’ and their parental cultivars are clustered in group 1. This is consistent with the purpose of the breeding program of ‘RD 69’, i.e., to develop soft texture rice seeds with high antioxidants. Both ‘KDML105’ and ‘Sang Yod’ have low AAC, leading to the soft texture of the seeds and the high antioxidant traits, which were contributed from Sang Yod, the colored rice with high antioxidant properties. ‘RD 43’ is also clustered in group 1, but its parental cultivar, ‘Supanburi 1’, is clustered in group 4, which has medium to high amylose, RS, and SAG. Unfortunately, we did not have the phenotypes of ‘Hawm Supanburi’ in this study to discuss the possibility of a genetic contribution for ‘RD 43’ phenotypes. It may be assumed that the difference in AAC between ‘RD43’ and its parental cultivar ‘Supanburi 1’ came from ‘Hawm Supanburi’.
When compared, the clustered group with the original location of the cultivars, group 1 and group 2, were mostly originally located in the north and northeastern part of Thailand. Most of group 4 and group 5, which contain a higher level of AAC, were originally from central Thailand (Figure 9). These are consistent with the consumption behavior of Thai people. Sticky rice (low AAC) is more popular in the north and northeastern part of Thailand, while it is less popular in the central part of Thailand.
Among these five groups, the rice in group 5 has the most desirable nutritional characteristics as indicated by the high RS and the low RAG/GI. The AAC was positively correlated with the RS content, suggesting that AAC may be the main factor determining the RS content in rice. Rice starch with a high AAC resulted in a high RS content in various rice varieties, consistent with the previous study [9,21,23,32]. Several studies found a correlation between the amylose content and the digestibility of starch [22,33,34]. Li et al. [33] showed that the indica subspecies with the highest AAC had a slower digestion rate than the japonica subspecies [34]. Anacleto et al. [22] found that the AAC had a weakly negative correlation with GI, but we could not detect this correlation in this rice population in our study. Zhang et al. [34] also found a negative correlation between AAC and RDS (slowly digestible starch). The RAG and RS were measured using in vitro starch digestion. The RAG reflected the rate of glucose available for absorption in the small intestine within 20 min, which is a key determinant of the glycemic response [7,35,36]. Foods with high AAC and RS and a low RAG have considerable health benefits due to the slower release of glucose and correspondingly lower glycemic response. Similarly, we observed a negative correlation between the AAC and the RAG and no correlation among the AAC/RS and the SAG and the GI (Figure 2, Supplementary Table S2).

3.2. Association Mapping and Molecular Marker Analysis

In the present study, a total of 18 SNP positions on chromosomes 1, 6, and 11 contained the highest significant loci responsible for the starch property (Supplementary Table S3). On chromosome 1, the SNP was in LOC_Os01g65810, which encodes an unknown protein. When compared to the reference japonica rice genome (Oryza sativa cv. Nipponbare), the selected indica rice cultivars in this study have SNPs and INDEL predicted to result in a truncated protein (Supplementary Figure S2). This may be the cause of the different starch textures and properties between the japonica and the indica rice. Moreover, in the high AAC cultivar, the C to T SNP at Chr1:38218116 led to an increase in the AAC’s value (Figure 7A). The heterozygous allele, C/T, at this position, suggests that duplication of this region led to the higher % AAC. This SNP was also responsible for the RAG and RS variations in rice. Therefore, the allelic variation at this locus allowed the identification of allelic patterns associated with the different AAC groups of rice. On the LD block, there are many SNPs located on block 2 (Figure 6B, Table S4), which included LOC_Os01g65780 and LOC_Os01g65790; these two loci encode glycosyl transferase and pectin esterase, respectively. Although LOC_Os01g65810 encoded an unidentified protein in rice, it was found near LOC_Os01g65780, which has a clear orthologous gene in Arabidopsis (AT3G18660) and encodes plant glycogenin-like starch initiation proteins (PGSIPs). PGSIPs are predicted to be chloroplast localized, and a knockout of PGSIP1 in Arabidopsis decreased starch accumulation in the leaves [37]. Moreover, LOC_Os01g65790 encoded pectin esterase. Pectin is one of the main components of the plant cell wall, controls cell wall porosity, and constitutes the major adhesive material between cells [38]. In plants, pectin esterases are hydrolytic enzymes that play a role in cell wall metabolism. It is likened to LOC_Os01g65810, as it showed up in the high LD, indicating that they might be inherited together. This result suggests that this protein may play a role in starch biosynthesis and possibly amylose/amylopectin initiation in rice grains.
We identified multiple loci related to starch properties on chromosome 6. As expected, the most significant SNPs were in LOC_Os06g04200, which encodes starch synthase or granule-bound starch synthase I (GBSSI). This locus affected AAC, RAG, and RS contents. Previous studies showed a significant correlation between SNPs in the intron 1 (G/T), in the coding regions exon 6 (A/C) and exon 10 (C/T), and the AAC of GBSSI [18,19,39]. However, the present study identified SNPs located in the 5′UTR, exon 1, intron 9, and 3′end regions (Supplementary Table S3). A major effect on starch properties may be caused by an INDEL in exon 1 (G/GCCACGGGTTCCAGGGCCTCAA) at position 1767006 bp (Figure 7E), which causes the change from proline codon (Pro) to stop codon (Supplementary Figure S3). Thus, this suggests that the insertion in exon 1 results in a reduction in the GBSSI affecting the amount of amylose in the endosperm. Another SNP on the 5’ UTR (T/G) at position 1765761 bp had a strong effect (Figure 7B); the altered allele G resulted in an increase in the AAC value, which could explain rice AAC differences. This position was in the first LD block in this region (Figure 6C). This LD block includes other linked loci, namely LOC_Os06g04150, LOC_Os06g04169, and LOC_Os06g04190 (Supplementary Table S5). Previous studies identified the GBSSI as the enzyme responsible for AAC variation in rice. The GBSSI controlled the amount of RS and was correlated with the AAC content in rice grains [9,22,25,26,27,28,29,30]. This result is supported by the fact that RS was positively correlated with the AAC. In addition, the AAC was also negatively correlated with the RAG; therefore, it is possible that the RAG is also controlled by the GBSSI. Other loci on chromosome 6, LOC_Os06g04080 encoding glycosyl hydrolases and LOC_Os06g04169 encoding alpha/beta hydrolase, were also associated with AAC, RAG, and RS contents (Table 1). Glycosyl hydrolases and alpha/beta hydrolases hydrolyze the glycosidic bond in polysaccharides of the cell wall, likely affecting cell wall architecture [40]. This finding is reinforced by the fact that many SNPs are located on block 1, which included LOC_Os06g04169, and they are near LOC_Os06g04200, which is in high LD, indicating that they are most likely to be inherited together (Figure 6C, Supplementary Table S5). Although there is no evidence that hydrolase enzymes play a direct role in starch biosynthesis, these enzymes affect starch hydrolysis. Taken together, it is possible that these enzymes may influence starch properties by affecting digestible starch.
Furthermore, significant SNPs (p = 6.91 × 10−17) on chromosome 11 were in LOC_Os11g01580, which encoded the sodium/calcium exchanger protein (NCX). Interestingly, at this locus, the SNPs associated with % AAC are heterozygous (Figure 7P–R). Positions Chr11:334302 and Chr11:334530 show an INDEL allele, while Chr11:334582 shows an SNP allele. This suggests that the duplication of the NCX gene occurred in these haplotypes and that it may be related to the increase in % AAC. This is also supported by the pattern of the PCR-RFLP marker II, which was designed to detect the variation in this gene. This marker showed either a single amplified band or triple amplified bands (Figure 8E–H). In the previous study, the NCX protein in both Arabidopsis and rice was found to play a role in salt stress and controlling Ca2+ in cell [41,42]. In this study, they are not linked to other genomic locations nearby, and no specific gene has been conclusively implicated in starch properties (Figure 6D, Supplementary Table S6). Little is known about the involvement of the NCX protein in starch biosynthesis. Interestingly, no other candidate genes were discovered near LOC_Os01g65810 and LOC_Os11g01580, suggesting that they represent novel candidates for the starch property in rice. The function of these genes in relation to starch properties should be investigated in the future.
Based on the results of marker analysis, rice in groups 1 and 2 was associated with triple bands of marker I and a single band of marker II, while rice in groups 4 and 5 tended to associate with double and triple bands of marker I and marker II, respectively (Supplementary Table S7).
New molecular markers were developed from the highest significant SNPs associated with starch property traits, which are in exon 1 of LOC_Os06g04200 and exon 2 of LOC_Os11g01580. After screening the 100 rice cultivars in two independent populations (Supplementary Tables S7 and S8) with these molecular markers, they could be used to discriminate the rice variation between low and high AACs; it showed a high correlation (Figure 8). Accordingly, the AAC showed a positive correlation with the RS while the RAG showed a negative correlation with the AAC and the RS. Thus, these markers from this study provide efficient markers for predicting the starch property based on the AAC, the RAG, and the RS contents of rice.

4. Materials and Methods

4.1. Plant Materials and DNA Extraction

The rice population used in this study comprised 230 rice varieties (Supplementary Table S1) grown at the Pathum Thani Rice Research Center, Rice Department, Ministry of Agriculture. The experiment used a completely randomized design with five replicates. This experiment was conducted during in-season rice cultivation from August to December 2017. DNA was extracted from young leaf tissue using the Genomic DNA Mini Kit (Plant; Geneaid Biotech Ltd., Taiwan) according to the manufacturer’s protocol. Genomic DNA (gDNA) was quantified using a NanodropTM spectrophotometer and confirmed using agarose gel electrophoresis. Genomic DNA was sequenced using a Genome Analyzer (Illumina, Inc., San Diego, CA, USA).

4.2. Evaluation of Phenotypic Parameters

4.2.1. Apparent Amylose Content (AAC)

The rice samples were dehulled into brown rice. Subsequently, they were ground and sieved through a 100-mesh sieve to measure the AAC, which was determined colorimetrically, measuring the amylose–iodine complex according to the modified method of Juliano [43]. A total of 20 mg of rice powder was weighed, placed in a 25 mL volumetric flask, and dispersed by adding 200 µL of 95% ethanol. Further, 1.8 mL of 1 M NaOH was added and incubated at 100 °C for 10 min. An aliquot (1 mL) was collected and mixed with 200 µL of 1M acetic acid and 400 µL of iodine solution. Distilled water was added to a final volume of 20 mL. The mixture was then incubated in the dark for 20 min. The absorbance of each sample was measured at 620 nm against a reagent blank using a microplate reader (SpectraMax®M3, San Jose, CA, USA). The percentage of apparent amylose content was calculated from the absorbance using the standard curve of amylose from potatoes (Sigma-Aldrich, Co., Darmstadt, Germany).

4.2.2. Digestible Starch Measurement

Analyses of digestible starch, including RAG, SAG, total glucose (TG), and RS were performed according to the modified method of Englyst et al. [7]. Thirty milligrams of milled brown rice were weighed into two Eppendorf tubes. Each tube was digested with 1 mL of an enzyme solution consisting of 40 U/mL pancreatin (Sigma–Aldrich, Co., Darmstadt, Germany) and 3 U/mL amyloglucosidase (AMG) (Megazyme, Bray, Ireland), and two glass beads (5 mm diameter) were added to an Eppendorf tube. Both tubes were incubated at 37 °C with shaking at 250 rpm. After 20 min, an aliquot of 0.1 mL was taken from the first tube and mixed with 900 µL of absolute ethanol to end enzymatic hydrolysis for the determination of RAG, and for the second tube, the enzyme activity was ended using the same protocol after 120 min for SAG determination. For the remaining solution from the second tube (0.8 mL), the reaction was stopped using boiling in water at 100 °C for 30 min and then cooling on ice for 10 min. Subsequently, 430 µL of 7 M KOH was added and incubated on ice for 30 min. To a 0.2 mL aliquot, 2000 µL of 0.5 M acetic acid and 5.5 µL of AMG (3260 U/mL) were added, and the mixture was incubated at 70 °C for 30 min. The solution was placed in a boiling water bath for 10 min and then cooled to room temperature to obtain the TG. Glucose oxidase peroxidase or GOPOD reagent (Megazyme, Bray, Ireland) was used to estimate the glucose concentration at 20 min (G20), 120 min (G120), and TG. Aliquots of 50 µL of each solution were incubated with 1.5 mL of GOPOD at 50 °C for 10 min. The absorbance was read at 510 nm against a reagent blank. The starch fractions were calculated as follows:
RAG = G20,
SAG = G120 − G20,
RS = (TG − G120) × 0.9.

4.2.3. Glycemic Index

In vitro methods were used to measure the HI and the GI. The protocol was based on a modified method described by Kumar et al. [44]. A total of 20 mg of rice powder was added to distilled water and boiled in water at 100 °C for 2 min. The solution was incubated with 5 mL of 0.1 M phosphate buffer (pH 6.9) and 200 µL of pepsin (250 mg/mL), adjusting the pH to 2.5 with 10% o-phosphoric acid at 37 °C and shaking at 200 rpm for 60 min. The solution was mixed with 200 µL of α-amylase (125 mg/mL) before being transferred to a dialysis tube (Spectra/Por® Dialysis Tubing, 12–14 kD MWCO, Repligen, Waltham, MA, USA). The dialysis tube was placed in a beaker containing 40 mL of 0.1 M phosphate buffer (pH 6.9) and incubated at 37 °C at 150 rpm for 240 min. Aliquots (0.4 mL) were collected from each sample after 30, 60, 120, 180, and 240 min. A total of 1.2 mL of 0.4 M sodium acetate buffer (pH 4.75) was added to each aliquot, and 24 µL of AMG (3260 U/mL) was added to hydrolyze the digested starch and incubated at 50 °C for 30 min. Duplicate aliquots of 150 µL each of timing solution were incubated with glucose oxidase peroxidase reagent at 50 °C for 20 min, and the absorbance was measured at 510 nm using a microplate reader. Maltose was used as the standard carbohydrate. The HI was calculated by dividing the area under the curve of each sample by that of maltose. HI was converted into a glycemic index using the formula given by Goni et al., as shown in Equation (4) [45]:
GI = 39.71 + (0.549 × HI).

4.3. Analysis of Genome-Wide Association and Molecular Markers

4.3.1. Association Mapping and Candidate Gene Analysis

Short reads obtained from the Illumina Genome Analyzer (Illumina, San Diego, CA, USA) were demultiplexed and mapped onto the rice reference genome sequence downloaded from the Plant Ensemble database (version IRGSP-1.0) (https://plants.ensembl.org/index.html, accessed on 8 February 2020) using the Burrows–Wheeler Aligner (BWA version 0.7.1). Variants were called using the Genome Analysis Toolkit (GATK; version 4.1). Variants were filtered using the following criteria: minimum coverage was 6 or 3 if positions with the minimum coverage of 6 were found in at least 10 accessions for a position to be called homozygous; and minimum coverage and minimum percentage of each of the two observed major base calls were 5 and 20, respectively, and minimum total coverage was 10 for a position to be called heterozygous. Identification of candidate genes underlying the genetic regulation of phenotypic traits using genome-wide association (GWA) mapping was performed using GEMMA Software (https://github.com/genetics-statistics/GEMMA) [1] based on the SNP (single nucleotide polymorphism) data and the phenotypic data. We selected SNPs in promoter and exon regions to perform association. SNPs were removed from the analysis by PLINK 1.07 [2] if they were not found in all accessions or their minor allele frequency (MAF) was less than 5%. To identify significant SNP, this study used the Bonferroni correction, where the significant threshold at 5% level was divided by the total number of SNP positions. The threshold level to declare an SNP as associated was −log(p) = 6.84. The association results were visualized using the quantile–quantile (Q–Q) plots and Manhattan plots using the CMplot packages. The MSU Rice Genome Annotation Project (http://rice.plantbiology.msu.edu) was used to search for the corresponding gene to each SNP. The linkage disequilibrium (LD) blocks were used to identify candidate gene regions using the Haploview software 4.2 [30]. The SNPs with highly significant associations in the block were identified and used as a measure of candidate genes between each locus because of their preference in association studies.

4.3.2. Molecular Marker Analysis

The genotyping data for at least ten rice cultivars, including five rice cultivars with a low AAC and five with a high AAC (Supplementary Table S9), were used to develop two molecular markers from significant SNPs related to starch properties, which were visualized using the IGV software 2.3 to select the region that showed the most difference in expected sizes of amplified fragments for marker development. The primer was designed in the homozygous regions in all cultivars, and INDEL were located between the forward and reverse primers, when compared with the sequence of the low AAC and high AAC rice cultivars. Primers to detect the significant SNP on chromosome 1 could not be developed because it was a single SNP, which could not be detected by this method. Primers were designed using Primer blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/), based on GWAS results. Marker I was located on LOC_O06g04200; RSM1-F: 5′ AGCTTCAAATTCTAATCCCCAA, 3′ RSM2-R, 5′ TTACACATCCATCCAATGCG 3.’ Marker II was located on LOC_Os11g01580; RSM3-F: 5′ AACTTCGTCTCTGCTACGTT 3′, RSM4-R: 5′ CTCGTCG TGCTGTTCTAC 3′. The PCR was performed using a PCR reaction mixture of 20 µL containing 1 μg of DNA template, primers (0.5 μM each of forward and reverse primers), 0.5 μL of 10 mM dNTPs, 2 µL of 10X Taq buffer, 1 μL of 25 mM MgCl2, and 0.2 µL of Taq DNA polymerase (Thermo Fisher Scientific, Waltham, Waltham, USA). The PCR conditions were performed on a thermal cycler (Thermal cycler, Applied Biosystems, USA) as follows: an initial denaturation at 95 °C for 3 min; 34 cycles of denaturation at 95 °C for 30 s; annealing at 57.5 °C for primer 1 and 53.8 °C for primer 2 for 30 s and extension at 72 °C for 1 min; and a final extension at 72 °C for 5 min. The PCR product of primer set 1 (marker I) was digested with BpuEI enzyme (New England BioLabs, Ipswich, MA, USA) according to the manufacturer’s instructions. Next, the amplified PCR products of markers I and II were run on a 1% agarose gel and used to assess the band size with a 100 bp ladder marker (Enzynomics, Daejeon, South Korea). The designed markers were used to detect the AAC variations in two sets of 100 rice cultivars (Supplementary Tables S7 and S8), each consisting of 50 rice cultivars with low AAC and 50 with high AAC. Regression analysis between the starch phenotype and electrophoretic banding patterns was performed using Excel 2021 software.

4.4. Statistical Analysis

An analysis of variance was performed to detect differences among the means of each parameter in five replicates, and Tukey’s range test was used to detect significant differences between each mean at p < 0.05 using IBM SPSS Statistical Software version 22 (IBM Corp., Armonk, USA). Pearson correlation analysis was used to determine the relationships among the starch properties, and the correlation plots were constructed using the R “corrplot” package. All results are presented as mean ± standard error of the mean. Hierarchical cluster analysis using the Euclidean distance was used to draw relationships among rice cultivars based on the starch properties, and a dendrogram was generated based on Ward’s method using JMP Software version 9 (SAS Institute Inc., Cary, NC, USA). Box plots were created using the R ‘ggplot2′ package.

5. Conclusions

This study showed that the apparent amylose content displayed a strong positive correlation with the resistant starch and a negative correlation with the rapidly available glucose. Furthermore, the rapidly available glucose was negatively correlated with the resistant starch. Using a GWAS, three loci, namely LOC_Os01g65810, LOC_Os06g04200, and LOC_Os11g01580, contained the most significant SNPs and were identified as the determinants of starch properties in rice grains. These loci were used to develop molecular markers that could be used to predict starch properties and improve rice quality.

6. Patents

Chadchawan, S.; Buaboocha, T.; Pongpanich, M.; Praphasanobol, P. Rice Starch Marker 1 (RSM1) Rice Starch Marker 2 (RSM2). TH patent 2,203,000,528, 27 February 2022.
Chadchawan, S.; Buaboocha, T.; Pongpanich, M.; Praphasanobol, P. Rice Starch Marker 3 (RSM3) Rice Starch Marker 4 (RSM4). TH patent 2,203,000,529, 27 February 2022.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/plants12183290/s1, Figure S1: Banding pattern of product from marker I with BpuEI digestion (A); and banding pattern of product from marker II (B); Figure S2: Sequence alignment of LOC_Os01g65810 in 10 rice cultivars with high and low AAC; Figure S3: Sequence alignment of LOC_Os06g04200 in 10 rice cultivars with high and low AAC; Table S1: List of 230 rice cultivars and phenotypic data used for association mapping; Table S2: Pearson correlation of 230 rice accessions associated with starch properties; Table S3: List of some highly significant SNPs from GWA mapping for various traits associated starch properties; Table S4: List of candidate genes from LD Blocks near LOC_Os01g65810; Table S5: List of candidate gene from LD Block near LOC_Os06g04200; Table S6: List of candidate gene from LD Block near LOC_Os11g01580; Table S7: List of 100 rice cultivars (Population I) used for validation of molecular markers; Table S8: List of 100 rice cultivars (Population II) used for validation of molecular markers; Table S9: List of entire rice population used for analysis of developed molecular markers.

Author Contributions

Conceptualization, S.C. (Supachitra Chadchawan), T.B. and L.C.; Methodology, S.C. (Supachitra Chadchawan), T.B., L.C., M.P. and P.P.; Software, M.P., P.P. and P.R.P.; Validation, P.P; Formal Analysis, P.P., M.P., P.R.P. and W.K.; Investigation, P.P.; Resources, S.J., S.C. (Somsong Chotechuenand), P.M.-N., C.P. and W.K.; Data Curation, S.C. (Supachitra Chadchawan) and T.B.; Writing—Original Draft Preparation, P.P.; Writing—Review and Editing, S.C. (Supachitra Chadchawan), L.C., T.B. and M.P.; Visualization, P.P. and P.R.P.; Supervision, S.C. (Supachitra Chadchawan) and T.B.; Project Administration, S.C. (Supachitra Chadchawan); Funding Acquisition, S.C. (Supachitra Chadchawan). All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Agricultural Research Development Agency grant (grant number PRP6105020640) and 90th Anniversary of Chulalongkorn University Fund (Ratchadaphiseksomphot Endowment Fund). P.P. was supported by the SAST. P.R.P. was supported by a CU-NSTDA doctoral scholarship.

Data Availability Statement

The data for this study are available from the corresponding author upon request.

Acknowledgments

We would like to thank CEEPP and Luca Comai’s laboratory members and Angsutorn Wasusun for their technical support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Williams, R.; Karuranga, S.; Malanda, B.; Saeedi, P.; Basit, A.; Besançon, S.; Bommer, C.; Esteghamati, A.; Ogurtsova, K.; Zhang, P.; et al. Global and regional estimates and projections of diabetes-related health expenditure: Results from the international diabetes federation diabetes atlas, 9th edition. Diabetes Res. Clin. Pract. 2020, 162, 108072. [Google Scholar] [CrossRef] [PubMed]
  2. Keenan, M.J.; Zhou, J.; Hegsted, M.; Pelkman, C.; Durham, H.A.; Coulon, D.B.; Martin, R.J. Role of resistant starch in improving gut health, adiposity, and insulin resistance. Adv. Nutr. 2015, 6, 198–205. [Google Scholar] [CrossRef]
  3. Nishida, C.; Uauy, R.; Kumanyika, S.; Shetty, P. The joint WHO/FAO expert consultation on diet, nutrition and the prevention of chronic diseases: Process, product and policy implications. Public Health Nutr. 2004, 7, 245–250. [Google Scholar] [CrossRef]
  4. Li, Q.; Liu, X.; Zhang, C.; Jiang, L.; Jiang, M.; Zhong, M.; Fan, X.; Gu, M.; Liu, Q. Rice soluble starch synthase I: Allelic variation, expression, function, and interaction with Waxy. Front. Plant Sci. 2018, 9, 1591. [Google Scholar] [CrossRef] [PubMed]
  5. Juliano, B.O. Rice in Human Nutrition; FAO Food and Nutrition Series, No.26; The International Rice Research Institute (IRRI): Los Baños, Philippines, 1993; pp. 43–44. [Google Scholar]
  6. Juliano, B.O. Rice starch properties and grain quality. J. Jpn. Soc. Starch Sci. 1992, 39, 11–21. [Google Scholar] [CrossRef]
  7. Englyst, H.; Kingman, S.; Cummings, J. Classification and measurement of nutritionally important starch fractions. Eur. J. Clin. Nutr. 1992, 46 (Suppl. 2), S33–S50. [Google Scholar] [PubMed]
  8. Englyst, H.N.; Veenstra, J.; Hudson, G.J. Measurement of rapidly available glucose (RAG) in plant foods: A potential in vitro predictor of the glycaemic response. Br. J. Nutr. 1996, 75, 327–337. [Google Scholar] [CrossRef] [PubMed]
  9. Bao, J.; Xu, F.; Park, Y.; Zhou, X.; He, Q. Genome-wide association study of the resistant starch content in rice grains. Starch 2017, 69, 1600343. [Google Scholar] [CrossRef]
  10. Kumar, A.; Panda, P.A.; Lal, M.K.; Ngangkham, U.; Sahu, C.; Soren, K.R.; Subudhi, H.N.; Samantaray, S.; Sharma, S. Addition of pulses, cooking oils, and vegetables enhances resistant starch and lowers the glycemic index of rice (Oryza sativa L.). Starch Stärke 2020, 72, 1900081. [Google Scholar] [CrossRef]
  11. Kaur, B.; Ranawana, V.; Henry, J. The glycemic index of rice and rice products: A review and table of GI values. Crit. Rev. Food Sci. Nutr. 2016, 56, 215–236. [Google Scholar] [CrossRef]
  12. Qu, J.; Xu, S.; Zhang, Z.; Chen, G.; Zhong, Y.; Liu, L.; Zhang, R.; Xue, J.; Guo, D. Evolutionary, structural and expression analysis of core genes involved in starch synthesis. Sci. Rep. 2018, 8, 12736. [Google Scholar] [CrossRef] [PubMed]
  13. Laughlin, M.J.; Chantler, S.E.; Okita, T.W. N- and C-terminal peptide sequences are essential for enzyme assembly, allosteric, and/or catalytic properties of ADP-glucose pyrophosphorylase. Plant J. 1998, 14, 159–168. [Google Scholar] [CrossRef] [PubMed]
  14. Siedlecka, A.; Ciereszko, I.; Mellerowicz, E.; Martz, F.; Chen, J.; Kleczkowski, L.A. The small subunit ADP-glucose pyrophosphorylase (ApS) promoter mediates okadaic acid-sensitive uidA expression in starch-synthesizing tissues and cells in Arabidopsis. Planta 2003, 217, 184–192. [Google Scholar] [CrossRef] [PubMed]
  15. Han, H.; Yang, C.; Zhu, J.; Zhang, L.; Bai, Y.; Li, E.; Gilbert, R.G. Competition between granule bound starch synthase and starch branching enzyme in starch biosynthesis. Rice 2019, 12, 96. [Google Scholar] [CrossRef] [PubMed]
  16. Wang, X.; Feng, B.; Xu, Z.; Sestili, F.; Zhao, G.; Xiang, C.; Lafiandra, D.; Wang, T. Identification and characterization of granule bound starch synthase I (GBSSI) gene of tartary buckwheat (Fagopyrum tataricum Gaertn.). Gene 2014, 534, 229–235. [Google Scholar] [CrossRef]
  17. Tetlow, I.J.; Emes, M.J. A review of starch-branching enzymes and their role in amylopectin biosynthesis. IUBMB Life 2014, 66, 546–558. [Google Scholar] [CrossRef]
  18. Biselli, C.; Cavalluzzo, D.; Perrini, R.; Gianinetti, A.; Bagnaresi, P.; Urso, S.; Orasen, G.; Desiderio, F.; Lupotto, E.; Cattivelli, L.; et al. Improvement of marker-based predictability of apparent amylose content in japonica rice through GBSSI allele mining. Rice 2014, 7, 1. [Google Scholar] [CrossRef]
  19. Dobo, M.; Ayres, N.; Walker, G.; Park, W.D. Polymorphism in the GBSS gene affects amylose content in US and European rice germplasm. J. Cereal Sci. 2010, 52, 450–456. [Google Scholar] [CrossRef]
  20. Zhang, C.; Zhu, J.; Chen, S.; Fan, X.; Li, Q.; Lu, Y.; Wang, M.; Yu, H.; Yi, C.; Tang, S.; et al. Wxlv, the ancestral allele of rice Waxy gene. Mol. Plant. 2019, 12, 1157–1166. [Google Scholar] [CrossRef]
  21. Kong, X.; Chen, Y.; Zhu, P.; Sui, Z.; Corke, H.; Bao, J. Relationships among genetic, structural, and functional properties of rice starch. J. Agric. Food Chem. 2015, 63, 6241–6248. [Google Scholar] [CrossRef]
  22. Anacleto, R.; Badoni, S.; Parween, S.; Butardo, V.M., Jr.; Misra, G.; Cuevas, R.P.; Kuhlmann, M.; Trinidad, T.P.; Mallillin, A.C.; Acuin, C.; et al. Integrating a genome-wide association study with a large-scale transcriptome analysis to predict genetic regions influencing the glycaemic index and texture in rice. Plant Biotechnol. J. 2019, 17, 1261–1275. [Google Scholar] [CrossRef] [PubMed]
  23. Biselli, C.; Volante, A.; Desiderio, F.; Tondelli, A.; Gianinetti, A.; Finocchiaro, F.; Taddei, F.; Gazza, L.; Sgrulletta, D.; Cattivelli, L.; et al. GWAS for starch-related parameters in Japonica rice (Oryza sativa L.). Plants 2019, 8, 292. [Google Scholar] [CrossRef]
  24. Fitzgerald, M.A.; Rahman, S.; Resurreccion, A.P.; Concepcion, J.; Daygon, V.D.; Dipti, S.S.; Kabir, K.A.; Klingner, B.; Morell, M.K.; Bird, A.R. Identification of a major genetic determinant of glycaemic index in rice. Rice 2011, 4, 66–74. [Google Scholar] [CrossRef]
  25. Jiang, C.; Rashid, M.; Zhang, Y.; Zhao, Y.; Pan, Y. Genome wide association study on development and evolution of glutinous rice. BMC Genom. Data 2022, 23, 33. [Google Scholar] [CrossRef] [PubMed]
  26. Butardo, V.M., Jr.; Anacleto, R.; Parween, S.; Samson, I.; de Guzman, K.; Alhambra, C.M.; Misra, G.; Sreenivasulu, N. Systems genetics identifies a novel regulatory domain of amylose synthesis. Plant Physiol. 2017, 173, 887–906. [Google Scholar] [CrossRef] [PubMed]
  27. Misra, G.; Badoni, S.; Domingo, C.J.; Cuevas, R.P.O.; Llorente, C.; Mbanjo, E.G.N.; Sreenivasulu, N. Deciphering the genetic architecture of cooked rice texture. Front. Plant Sci. 2018, 9, 1405. [Google Scholar] [CrossRef]
  28. Deng, Z.; Liu, Y.; Gong, C.; Chen, B.; Wang, T. Waxy is an important factor for grain fissure resistance and head rice yield as revealed by a genome-wide association study. J. Exp. Bot. 2022, 73, 6942–6954. [Google Scholar] [CrossRef] [PubMed]
  29. Quero, G.; Gutiérrez, L.; Monteverde, E.; Blanco, P.; Pérez de Vida, F.; Rosas, J.; Fernández, S.; Garaycochea, S.; McCouch, S.; Berberian, N.; et al. Genome-wide association study using historical breeding populations discovers genomic regions involved in high-quality rice. Plant Genome 2018, 11. [Google Scholar] [CrossRef]
  30. Yang, X.; Xia, X.; Zeng, Y.; Nong, B.; Zhang, Z.; Wu, Y.; Xiong, F.; Zhang, Y.; Liang, H.; Deng, G.; et al. Identification of candidate genes for gelatinization temperature, gel consistency and pericarp color by GWAS in rice based on SLAF-sequencing. PLoS ONE 2018, 13, 196690. [Google Scholar] [CrossRef]
  31. Barrett, J.C.; Fry, B.; Maller, J.; Daly, M.J. Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics 2005, 21, 263–265. [Google Scholar] [CrossRef]
  32. Chung, H.-J.; Liu, Q.; Lee, L.; Wei, D. Relationship between the structure, physicochemical properties and in vitro digestibility of rice starches with different amylose contents. Food Hydrocoll. 2011, 25, 968–975. [Google Scholar] [CrossRef]
  33. Li, N.; Guo, Y.; Zhao, S.; Kong, J.; Qiao, D.; Lin, L.; Lin, Q.; Zhang, B. Amylose content and molecular-order stability synergistically affect the digestion rate of indica rice starches. Int. J. Biol. Macromol. 2020, 144, 373–379. [Google Scholar] [CrossRef]
  34. Zhang, N.; Wang, M.; Fu, J.; Shen, Y.; Ding, Y.; Wu, D.; Shu, X.; Song, W. Identifying genes for resistant starch, slowly digestible starch, and rapidly digestible starch in rice using genome-wide association studies. Genes Genomics. 2020, 42, 1227–1238. [Google Scholar] [CrossRef]
  35. Chelliah, R.; Chandrashekar, S.; Saravanakumar, K.; Ramakrishnan, S.R.; Rubab, M.; Daliri, E.B.; Barathikannan, K.; Tyagi, A.; Kwame Ofosu, F.; Chen, X.; et al. Effect of rice processing towards lower rapidly available glucose (RAG) favors Idli, a South Indian fermented food suitable for diabetic patients. Nutrients 2019, 11, 1497. [Google Scholar] [CrossRef]
  36. Englyst, K.N.; Englyst, H.N.; Hudson, G.J.; Cole, T.J.; Cummings, J.H. Rapidly available glucose in foods: An in vitro measurement that reflects the glycemic response. Am. J. Clin. Nutr. 1999, 69, 448–454. [Google Scholar] [CrossRef]
  37. Chatterjee, M.; Berbezy, P.; Vyas, D.; Coates, S.; Barsby, T. Reduced expression of a protein homologous to glycogenin leads to reduction of starch content in Arabidopsis leaves. Plant Sci. 2005, 168, 501–509. [Google Scholar] [CrossRef]
  38. Willats, W.G.; Orfila, C.; Limberg, G.; Buchholt, H.C.; van Alebeek, G.J.; Voragen, A.G.; Marcus, S.E.; Christensen, T.M.; Mikkelsen, J.D.; Murray, B.S.; et al. Modulation of the degree and pattern of methylesterification of pectic homogalacturonan in plant cell walls. Implications for pectin methyl esterase action, matrix properties, and cell adhesion. J. Biol. Chem. 2001, 276, 19404–19413. [Google Scholar] [CrossRef] [PubMed]
  39. Ayres, N.M.; McClung, A.M.; Larkin, P.D.; Bligh, H.F.J.; Jones, C.A.; Park, W.D. Microsatellites and a single-nucleotide polymorphism differentiate apparent amylose classes in an extended pedigree of US rice germ plasm. Theor. Appl. Genet. 1997, 94, 773–781. [Google Scholar] [CrossRef]
  40. Sharma, R.; Cao, P.; Jung, K.H.; Sharma, M.K.; Ronald, P.C. Construction of a rice glycoside hydrolase phylogenomic database and identification of targets for biofuel research. Front. Plant Sci. 2013, 4, 330. [Google Scholar] [CrossRef] [PubMed]
  41. Singh, A.K.; Kumar, R.; Tripathi, A.K.; Gupta, B.K.; Pareek, A.; Singla-Pareek, S.L. Genome-wide investigation and expression analysis of sodium/calcium exchanger gene family in rice and Arabidopsis. Rice 2015, 8, 54. [Google Scholar] [CrossRef] [PubMed]
  42. Wang, P.; Li, Z.; Wei, J.; Zhao, Z.; Sun, D.; Cui, S. A Na+/Ca2+ exchanger-like protein (AtNCL) involved in salt stress in Arabidopsis. J. Biol. Chem. 2012, 287, 44062–44070. [Google Scholar] [CrossRef] [PubMed]
  43. Juliano, B.O. A simplified assay for milled-rice amylose. Cereal Sci. Today 1971, 16, 334–360. [Google Scholar]
  44. Kumar, A.; Sahoo, U.; Baisakha, B.; Okpani, O.A.; Ngangkham, U.; Parameswaran, C.; Basak, N.; Kumar, G.; Sharma, S.G. Resistant starch could be decisive in determining the glycemic index of rice cultivars. J. Cereal Sci. 2018, 79, 348–353. [Google Scholar] [CrossRef]
  45. Goni, I.; Garcia-Alonso, A.; Saura-Calixto, F. A starch hydrolysis procedure to estimate glycemic index. Nutr. Res. 1997, 17, 427–437. [Google Scholar] [CrossRef]
Figure 1. Pearson correlation of the starch property traits of 230 rice accessions. Positive correlations are displayed as blue circles and negative correlations as orange circles. The sizes of the circles are proportional to the correlation coefficients. Cells with insignificant correlation values (p < 0.05) are left blank.
Figure 1. Pearson correlation of the starch property traits of 230 rice accessions. Positive correlations are displayed as blue circles and negative correlations as orange circles. The sizes of the circles are proportional to the correlation coefficients. Cells with insignificant correlation values (p < 0.05) are left blank.
Plants 12 03290 g001
Figure 2. Hierarchical cluster analysis of the starch property in 230 rice accessions. Five cluster groups are shown with different color branches and the numbers represent the group numbers.
Figure 2. Hierarchical cluster analysis of the starch property in 230 rice accessions. Five cluster groups are shown with different color branches and the numbers represent the group numbers.
Plants 12 03290 g002
Figure 3. SNP density plot across the 12 chromosomes of rice representing the number of SNPs within a 1 Mb window size. The horizontal axis shows the chromosome length (Mb), while the different colors depict SNP densities. SNP: single nucleotide polymorphism.
Figure 3. SNP density plot across the 12 chromosomes of rice representing the number of SNPs within a 1 Mb window size. The horizontal axis shows the chromosome length (Mb), while the different colors depict SNP densities. SNP: single nucleotide polymorphism.
Plants 12 03290 g003
Figure 4. Manhattan plot (left) displaying the single nucleotide polymorphisms (SNPs) in a population of 230 rice cultivars associated with the following starch traits: (A) AAC, (B) RAG, (C) SAG, (D) RS, (E) HI, and (F) GI. The locations of SNPs on the chromosome and the association test (−log10(p)) are plotted on the x-axis and y-axis, respectively. The red line indicates the Bonferroni correction at p < 0.05. The chart (right) presents the quantile–quantile (Q–Q) plot of the observed and expected p-values from the association analyses.
Figure 4. Manhattan plot (left) displaying the single nucleotide polymorphisms (SNPs) in a population of 230 rice cultivars associated with the following starch traits: (A) AAC, (B) RAG, (C) SAG, (D) RS, (E) HI, and (F) GI. The locations of SNPs on the chromosome and the association test (−log10(p)) are plotted on the x-axis and y-axis, respectively. The red line indicates the Bonferroni correction at p < 0.05. The chart (right) presents the quantile–quantile (Q–Q) plot of the observed and expected p-values from the association analyses.
Plants 12 03290 g004
Figure 5. Venn diagram demonstrating the number of loci based on the SNPs associated with starch properties.
Figure 5. Venn diagram demonstrating the number of loci based on the SNPs associated with starch properties.
Plants 12 03290 g005
Figure 6. Manhattan plot of SNPs associated with the AAC trait with the most significant SNPs on chromosomes 1, 6, and 11 (A) and pairwise LD between the significant SNPs on each chromosome region (BD), which are indicated as standard color scheme of Haploview [31], representing the values of D’/LOD. SNP: single nucleotide polymorphism, AAC: apparent amylose content; LD: linkage disequilibrium.
Figure 6. Manhattan plot of SNPs associated with the AAC trait with the most significant SNPs on chromosomes 1, 6, and 11 (A) and pairwise LD between the significant SNPs on each chromosome region (BD), which are indicated as standard color scheme of Haploview [31], representing the values of D’/LOD. SNP: single nucleotide polymorphism, AAC: apparent amylose content; LD: linkage disequilibrium.
Plants 12 03290 g006
Figure 7. Boxplot of AAC based on the significance of the single nucleotide polymorphism of (A) Chr1: 38218116, (B) Chr6: 1765761, (C) Chr6: 1765887, (D) Chr6: 1766058, (E) Chr6: 1767006, (F) Chr6: 1769158, (G) Chr6: 1769205, (H) Chr6: 1769256, (I) Chr6: 1770672, (J) Chr6: 1770763, (K) Chr6: 1770890, (L) Chr6: 1770909, (M) Chr6: 1770964, (N) Chr6: 1771095, (O) Chr6: 1771117, (P) Chr11: 334302, (Q) Chr11: 334530, and (R) Chr11: 334582. The black horizontal lines represent the median values, the boxes represent the middle quartiles, and the whiskers are the range of data. Reference allele is on the rightmost column in each figure. * or the different letters above the bars represent the significant difference between the means of the alleles at p < 0.05 by DMRT or t-test, respectively.
Figure 7. Boxplot of AAC based on the significance of the single nucleotide polymorphism of (A) Chr1: 38218116, (B) Chr6: 1765761, (C) Chr6: 1765887, (D) Chr6: 1766058, (E) Chr6: 1767006, (F) Chr6: 1769158, (G) Chr6: 1769205, (H) Chr6: 1769256, (I) Chr6: 1770672, (J) Chr6: 1770763, (K) Chr6: 1770890, (L) Chr6: 1770909, (M) Chr6: 1770964, (N) Chr6: 1771095, (O) Chr6: 1771117, (P) Chr11: 334302, (Q) Chr11: 334530, and (R) Chr11: 334582. The black horizontal lines represent the median values, the boxes represent the middle quartiles, and the whiskers are the range of data. Reference allele is on the rightmost column in each figure. * or the different letters above the bars represent the significant difference between the means of the alleles at p < 0.05 by DMRT or t-test, respectively.
Plants 12 03290 g007
Figure 8. Box plots show the distribution of PCR-RFLP patterns of marker I (AD) and marker II (EH) and their starch properties, % AAC (A,E), % RAG (B,F), % SAG (C,G), and % RS (D,H). A hundred rice cultivars from population II (Supplementary Table S8) were used for this evaluation. * above the bars represents the significant difference between two PCR-RFLP patterns at p < 0.05 analyzed using a t-test.
Figure 8. Box plots show the distribution of PCR-RFLP patterns of marker I (AD) and marker II (EH) and their starch properties, % AAC (A,E), % RAG (B,F), % SAG (C,G), and % RS (D,H). A hundred rice cultivars from population II (Supplementary Table S8) were used for this evaluation. * above the bars represents the significant difference between two PCR-RFLP patterns at p < 0.05 analyzed using a t-test.
Plants 12 03290 g008
Figure 9. Distribution of rice cultivars in Thailand used in this study. The numbers of cultivars were indicated as shown in Supplementary Table S1. The color of each number represents the clustered groups in Figure 1, group 1: red, group 2: green, group 3: blue, group 4: orange, group 5: turquoise. * means that only the regional in the south of Thailand is known for this cultivar. ** means no information about the location of the cultivars.
Figure 9. Distribution of rice cultivars in Thailand used in this study. The numbers of cultivars were indicated as shown in Supplementary Table S1. The color of each number represents the clustered groups in Figure 1, group 1: red, group 2: green, group 3: blue, group 4: orange, group 5: turquoise. * means that only the regional in the south of Thailand is known for this cultivar. ** means no information about the location of the cultivars.
Plants 12 03290 g009
Table 1. List of genes identified by GWAS and p-value of the significant SNPs related to starch property traits.
Table 1. List of genes identified by GWAS and p-value of the significant SNPs related to starch property traits.
ChrLocusPositionp-ValueDescriptionParameterPublication
1LOC_Os01g65810382181164.04 × 10−22expressed proteinAAC, RAG, RS-
2LOC_Os02g52950323806862.16 × 10−9expressed proteinAAC-
6LOC_Os06g0396016022997.05 × 10−9expressed proteinAAC, RS[25]
6LOC_Os06g0397016119713.55 × 10−9receptor-like protein kinase 5 precursorAAC, RS[22,25]
6LOC_Os06g0398016164447.82 × 10−10expressed proteinAAC, RS[22,25]
6LOC_Os06g0399016296521.96 × 10−10aminotransferase, classes I and II, domain-containing proteinAAC, RS[22,25]
6LOC_Os06g0401016386281.85 × 10−10GAGA-binding proteinAAC, RS[22,25,26]
6LOC_Os06g0402016414731.96 × 10−10histone H1AAC, RS[22,25]
6LOC_Os06g0403016447801.96 × 10−10histone H3AAC, RS[22,25]
6LOC_Os06g0404016504991.96 × 10−10WD domain, G-beta repeat domain-containing proteinAAC, RS[22,25]
6LOC_Os06g0407016773642.97 × 10−9pyridoxal-dependent decarboxylase proteinAAC, RS[22]
6LOC_Os06g0408016911527.83 × 10−10glycosyl hydrolases family 17, putative, expressedAAC, RS[22,26]
6LOC_Os06g0409017025328.59 × 10−14no apical meristem proteinAAC, RS[22]
6LOC_Os06g0413017303351.32 × 10−15lung seven transmembrane domain-containing proteinAAC, RAG, RS[22,25]
6LOC_Os06g0414017316292.30 × 10−11expressed proteinAAC, RAG, RS[22]
6LOC_Os06g0415017339974.88 × 10−15magnesium-protoporphyrin O-methyltransferaseAAC, RAG, RS[22,25]
6LOC_Os06g0416917401673.56 × 10−15hydrolase, alpha/beta fold family domain-containing proteinAAC, RAG, RS[22,25,26,27]
6LOC_Os06g0419017556451.89 × 10−20rad1AAC, RAG, RS[22,25]
6LOC_Os06g0419517612701.44 × 10−20expressed proteinAAC, RAG, RS[25]
6LOC_Os06g0420017670061.69 × 10−42starch synthaseAAC, RAG, RS[22,25,26,27,28,29,30]
6LOC_Os06g0421017766823.89 × 10−19expressed proteinAAC, RAG, RS[28]
6LOC_Os06g0422017835124.81 × 10−26expressed proteinAAC, RAG, RS[22,26,28]
6LOC_Os06g0423017841131.63 × 10−27expressed proteinAAC, RAG, RS[22,25,28]
6LOC_Os06g0424017863442.83 × 10−24expressed proteinAAC, RAG, RS[22,25,28]
6LOC_Os06g0425017912002.29 × 10−13phosphate-induced protein 1 conserved region domain-containing proteinAAC, RAG, RS[22,28]
6LOC_Os06g0427018125429.66 × 10−12transketolase, chloroplast precursorAAC, RAG, RS[25]
6LOC_Os06g0428018164278.21 × 10−123-phosphoshikimate 1-carboxyvinyltransferase, chloroplast precursorAAC, RAG, RS[22]
6LOC_Os06g0430018222373.86 × 10−9tRNA 2-phosphotransferase 1AAC[22,25]
6LOC_Os06g23530137289224.94 × 10−9pre-mRNA-splicing factor ATP-dependent RNA helicaseAAC-
7LOC_Os07g1278073146855.56 × 10−9cyclinAAC-
11LOC_Os11g015803345306.91 × 10−17sodium/calcium exchanger proteinAAC, RS-
11LOC_Os11g0313011290931.04 × 10−10E2F-related proteinAAC-
GWAS: Genome-wide association studies, SNP: single nucleotide polymorphism, AAC: apparent amylose content, RAG: rapidly available glucose, and RS: resistant starch.
Table 2. Regression analysis for marker I (GBSSI) and marker II (LOC_Os11g01580) in 2 rice populations, each consisting of 100 cultivars.
Table 2. Regression analysis for marker I (GBSSI) and marker II (LOC_Os11g01580) in 2 rice populations, each consisting of 100 cultivars.
% AAC% RAG% SAG% RS
R2p-ValueR2p-ValueR2p-ValueR2p-Value
Pop. I
(Table S7)
Marker I0.821.4 × 10−380.044.7 × 10−20.000.690.701.1 × 10−26
Marker II0.852.8 × 10−420.061.6 × 10−20.000.960.811.3 × 10−16
Pop. II
(Table S8)
Marker I0.502.9 × 10−160.362.9 × 10−110.000.710.577.0 × 10−20
Marker II0.542.5 × 10−180.342.0 × 10−100.000.600.551.5 × 10−18
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Praphasanobol, P.; Purnama, P.R.; Junbuathong, S.; Chotechuen, S.; Moung-Ngam, P.; Kasettranan, W.; Paliyavuth, C.; Comai, L.; Pongpanich, M.; Buaboocha, T.; et al. Genome-Wide Association Study of Starch Properties in Local Thai Rice. Plants 2023, 12, 3290. https://doi.org/10.3390/plants12183290

AMA Style

Praphasanobol P, Purnama PR, Junbuathong S, Chotechuen S, Moung-Ngam P, Kasettranan W, Paliyavuth C, Comai L, Pongpanich M, Buaboocha T, et al. Genome-Wide Association Study of Starch Properties in Local Thai Rice. Plants. 2023; 12(18):3290. https://doi.org/10.3390/plants12183290

Chicago/Turabian Style

Praphasanobol, Parama, Putut Rakhmad Purnama, Supaporn Junbuathong, Somsong Chotechuen, Peerapon Moung-Ngam, Waraluk Kasettranan, Chanita Paliyavuth, Luca Comai, Monnat Pongpanich, Teerapong Buaboocha, and et al. 2023. "Genome-Wide Association Study of Starch Properties in Local Thai Rice" Plants 12, no. 18: 3290. https://doi.org/10.3390/plants12183290

APA Style

Praphasanobol, P., Purnama, P. R., Junbuathong, S., Chotechuen, S., Moung-Ngam, P., Kasettranan, W., Paliyavuth, C., Comai, L., Pongpanich, M., Buaboocha, T., & Chadchawan, S. (2023). Genome-Wide Association Study of Starch Properties in Local Thai Rice. Plants, 12(18), 3290. https://doi.org/10.3390/plants12183290

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop