Screening of Reference miRNA of Different Early- and Late-Flowering Tree Peony Varieties
Abstract
1. Introduction
2. Results
2.1. miRNAs Quality Analysis
2.2. Primers Specificity Analysis of 16 Candidate miRNAs from Different Tree Peony Varieties
2.3. Ct Value Analysis of 16 Candidate miRNAs of Different Tree Peony Varieties
2.4. The Expression Stability of 16 Candidate Reference miRNAs Analyzed by geNorm
2.5. The Expression Stability of 16 Candidate Reference miRNAs Analyzed by NormFinder
2.6. The Expression Stability of 16 Candidate Reference miRNAs Analyzed by Bestkeeper
2.7. The Expression Stability of 16 Candidate Reference miRNAs Analyzed by RefFinder
2.8. Validation of Reference miRNAs
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Primers Design of Candidate Reference miRNAs
4.3. Isolation of miRNA and Synthesis of cDNA
4.4. Primers Specificity Analysis
4.5. Expression Stability Analysis of 16 Candidate Reference miRNAs
4.6. Validation of Candidate Reference miRNAs
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Zhang, L.; Guo, D.L.; Guo, L.L.; Guo, Q.; Wang, H.F.; Hou, X.G. Construction of a high-density genetic map and QTLs mapping with GBS from the interspecific F1 population of P. ostii ‘Fengdan Bai’ and P. suffruticosa ‘Xin Riyuejin’. Sci. Hortic. 2019, 246, 190–200. [Google Scholar] [CrossRef]
- Guo, L.L.; Guo, D.L.; Zhao, W.; Hou, X.G. Newly developed SSR markers reveal genetic diversity and geographical clustering in Paeonia suffruticosa based on flower colour. J. Hortic. Sci. Biotechnol. 2017, 93, 416–424. [Google Scholar] [CrossRef]
- Wang, C.Y. Identification Phenolic Compounds of Extracts from Roots and Leaves of Peony and Their Application in Cosmetic. Master’s Thesis, North University China, Taiyuan, China, 2022. [Google Scholar]
- Kwek, E.; Zhu, H.Y.; Ding, H.F.; He, Z.Y.; Hao, W.J.; Liu, J.H.; Ma, K.Y.; Chen, Z.Y. Peony seed oil decreases plasma cholesterol and favorably modulates gut microbiota in hypercholesterolemic hamsters. Eur. J. Nutr. 2022, 61, 2341–2356. [Google Scholar] [CrossRef]
- Zhang, Y.; Liu, P.; Gao, J.Y.; Wang, X.S.; Yin, M.; Xue, N.C.; Qu, C.X.; Deng, R.X. Paeonia veitchii seeds as a promising high potential by-product: Proximate composition, phytochemical components, bioactivity evaluation and potential applications. Ind. Crops Prod. 2018, 125, 248–260. [Google Scholar] [CrossRef]
- Wang, X.J.; Liang, H.Y.; Guo, D.L.; Guo, L.L.; Duan, X.G.; Jia, Q.S.; Hou, X.G. Integrated analysis of transcriptomic and proteomic data from tree peony (P. ostii) seeds reveals key developmental stages and candidate genes related to oil biosynthesis and fatty acid metabolism. Hortic. Res. 2019, 6, 111–120. [Google Scholar] [CrossRef]
- Yuan, X. Effect of GA on Autumn Reflowering of Tree Peony. Master’s Thesis, Beijing Forestry University, Beijing, China, 2020. [Google Scholar]
- Chang, Y.T. Research of Re-Blooming Molecular Mechanism in Tree Peony ‘High Noon’. Ph.D. Thesis, Chinese Academy of Forestry, Beijing, China, 2020. [Google Scholar]
- Zhang, W.Q.; Zhang, H.X.; Lian, X.F.; Li, Y.Y.; Guo, L.L.; Hou, X.G. Analisis of DNA methylation related to callus differentiation and rooting induction of Paeonia ostii ‘Fengdan’. Acta Hortic. Sin. 2022, 49, 1735–1746. [Google Scholar]
- Tian, Y.F.; Chang, K.K.; Yang, F.F.; Liu, J.; Sun, C.; Yang, Y.Z. Effects of different cultivation modes on the quality and yield of cortex moutan of Paeonia ostii ‘Fengdan’. Mol. Plant Breed. 2022, 1–9. [Google Scholar]
- Xue, Y.Q.; Liu, R.; Xue, J.Q.; Wang, S.L.; Zhang, X.X. Genetic diversity and relatedness analysis of nine wild species of tree peony based on simple sequence repeats markers. Hortic. Plant J. 2021, 7, 579–588. [Google Scholar] [CrossRef]
- Liu, P.; Zhang, L.N.; Wang, X.S.; Gao, J.Y.; Yi, J.P.; Deng, R.X. Characterization of Paeonia ostii seed and oil sourced from different cultivation areas in China. Ind. Crops Prod. 2019, 133, 63–71. [Google Scholar] [CrossRef]
- Zhang, L.; Wei, Z.Z.; Song, C.W.; Guo, L.L.; Guo, Q.; Hou, X.G.; Wang, H.F. Cloning and expression analysis of PoFD gene from Paeonia ostii ‘Fengdan’. Biotechnol. Bull. 2022, 38, 104. [Google Scholar]
- Luo, X.N.; Sun, D.Y.; Wang, S.; Luo, S.; Fu, Y.Q.; Niu, L.X.; Shi, Q.Q.; Zhang, Y.L. Integrating full-length transcriptomics and metabolomics reveals the regulatory mechanisms underlying yellow pigmentation in tree peony (Paeonia suffruticosa Andr.) flowers. Hortic. Res. 2021, 8, 235–249. [Google Scholar] [CrossRef]
- Zhang, L.; Song, C.W.; Guo, D.L.; Guo, L.L.; Hou, X.G.; Wang, H.F. Identification of differentially expressed miRNAs and their target genes in response to brassinolide treatment on flowering of tree peony (Paeonia ostii). Plant Signal. Behav. 2022, 17, e2056364. [Google Scholar] [CrossRef]
- Chen, C.B.; Wu, J.Y.; Hua, Q.Z.; Tel-Zur, M.; Xie, F.F.; Zhang, Z.K.; Chen, J.Y.; Zhang, R.; Hu, G.B.; Zhao, J.T.; et al. Identification of reliable reference genes for quantitative real-time PCR normalization in pitaya. Plant Methods 2019, 15, 70–81. [Google Scholar] [CrossRef]
- Zhang, J.W.; Long, Y.; Xue, M.D.; Xiao, X.G.; Pei, X.W. Identification of microRNAs in response to drought in common wild rice (Oryza rufipogon Griff.) shoots and roots. PLoS ONE 2017, 12, e0170330. [Google Scholar] [CrossRef]
- Yu, Y.; Sun, F.Y.; Chen, N.; Sun, G.L.; Wang, C.Y.; Wu, D.X. MiR396 regulatory network and its expression during grain development in wheat. Protoplasma 2020, 258, 103–113. [Google Scholar] [CrossRef] [PubMed]
- Kou, X.Y.; Zhang, L.; Yang, S.Z.; Li, G.H.; Ye, J.L. Selection and validation of reference genes for quantitative RT-PCR analysis in peach fruit under different experimental conditions. Sci. Hortic. 2017, 225, 195–203. [Google Scholar] [CrossRef]
- Zhao, J.M.; Yang, J.; Wang, X.Y.; Xiong, Y.L.; Xiong, Y.; Dong, Z.X.; Lei, X.; Yan, L.J.; Ma, X. Selection and validation of reference genes for qRT-PCR gene expression analysis in Kengyilia melanthera. Genes 2022, 13, 1445. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Zhang, Y.C.; Cai, Y.M.; Zhao, B.X.; Fu, C.Q.; Yang, L.Y. Screening of qRT-PCR reference genes in different varieties and tissues of Zantedeschia hybrida. Mol. Plant Breed. 2020, 18, 3971–3979. [Google Scholar]
- Dai, Y.L.; Liu, X.F.; Gan, L.; Lan, C.Z.; Teng, Z.Y.; Yang, X.J. Selection and application of reference genes for quantitative real-time PCR in Exserohilum turcicum. J. Agric. Biotechnol. 2023, 31, 867–882. [Google Scholar]
- Yao, Z.T.; Cao, X.Y.; Xiao, X.; Li, R.F.; Wei, X.M.; Zou, C.W.; Zhu, G.N. Screening of reference genes for RT-qPCR in Neoscytalidium dimidiatum. Biotechnol. Bull. 2023, 39, 92–102. [Google Scholar]
- Wang, Q.Z.; Zhang, X.L.; Han, R.; Tian, J. Screening of garlic reference genes and analysis of AsACO gene response to salt stress and plant growth-promoting rizhobacteria. J. South. Agric. 2022, 53, 3297–3306. [Google Scholar]
- Shang, S.S.; Fan, L.T.; Zhou, S.; Xu, M.Q.; Gao, S.C.; Shi, G.A. Screening of reference genes and expression analysis of petal senescence associated genes in Itoh peony ‘Bartzella’ cut flowers. Plant Physiol. J. 2023, 59, 153–164. [Google Scholar]
- Alexandre, C.M.; Hennig, L. FLC or not FLC: The other side of vernalization. J. Exp. Bot. 2008, 59, 1127–1135. [Google Scholar] [CrossRef] [PubMed]
- Huang, F.Y.; Liu, T.K.; Tang, J.; Duan, W.K.; Hou, X.L. BcMAF2 activates BcTEM1 and represses flowering in Pak-choi (Brassica rapa ssp. chinensis). Plant Mol. Biol. 2019, 100, 19–32. [Google Scholar] [CrossRef] [PubMed]
- Wei, W.H.; Li, G.; Jiang, X.L.; Wang, Y.Q.; Ma, Z.H.; Niu, Z.P.; Wang, Z.W.; Geng, X.X. Small RNA and degradome profiling involved in seed development and oil synthesis of Brassica napus. PLoS ONE 2018, 13, e0204998. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.Y.; Huo, Q.; Yang, H.; Jian, H.J.; Qu, C.M.; Lu, K.; Li, J.N. Joint RNA-Seq and miRNA profiling analyses to reveal molecular mechanisms in regulating thickness of pod canopy in Brassica napus. Genes 2019, 10, 591. [Google Scholar] [CrossRef]
- Spanudakis, E.; Jackson, S. The role of microRNAs in the control of flowering time. J. Exp. Bot. 2014, 65, 365–380. [Google Scholar] [CrossRef]
- Lee, Y.S.; Lee, D.Y.; Cho, L.H.; An, G. Rice miR172 induces flowering by suppressing OsIDS1 and SNB, two AP2 genes that negatively regulate expression of Ehd1 and florigens. Rice 2014, 7, 31–43. [Google Scholar] [CrossRef]
- Chung, M.Y.; Nath, U.K.; Vrebalov, J.; Gapper, N.; Lee, J.M.; Lee, D.J.; Kim, C.K.; Giovannoni, J. Ectopic expression of miRNA172 in tomato (Solanum lycopersicum) reveals novel function in fruit development through regulation of an AP2 transcription factor. BMC Plant Biol. 2020, 20, 283–298. [Google Scholar] [CrossRef]
- Zhang, C.; Xian, Z.Q.; Huang, W.; Li, Z.G. Evidence for the biological function of miR403 in tomato development. Sci. Hortic. 2015, 197, 619–626. [Google Scholar] [CrossRef]
- Zhang, C.J.; Song, C.W.; Chen, L.F.; Ma, H.L.; Zhang, Y.B.; Guo, D.L.; Guo, L.L.; Hou, X.G. Selection and validation of miRNA reference genes by quantitative real-time PCR analysis in Paeonia suffruticosa. Horticulturae 2023, 9, 148. [Google Scholar] [CrossRef]
- Liu, W.C.; Wang, Q.; Zhou, Y.G.; Deng, Y.; Zhao, L.D.; Wang, X.C.; Jin, J.; Dong, Y.Y.; Wang, N.; Wang, F.W.; et al. Selection of reference genes for quantitative polymerase chain reaction of miRNA and mRNA in soybean under drought stress. J. Northwest Agric. For. Univ. 2016, 44, 61–67. [Google Scholar]
- Li, M.Q.; Liu, M.; Zhang, M.; Bai, Y.H.; Li, P.; Wei, H.Y.; Zhou, R.; Jiang, F.L.; Wu, Z. Identification and verification of somatic embryogenesis mRNA and miRNA qPCR reference genes in garlic (Allium sativum). J. Agric. Biotechnol. 2021, 29, 2449–2464. [Google Scholar]
- Zhou, L.; Quan, S.W.; Ma, L.; Xu, H.; Niu, J.X. Screening of reference genes for microRNA real-time quantitative RT-PCR in Juglans regia L. Mol. Plant Breed. 2019, 17, 2270–2278. [Google Scholar]
- Lyu, S.H.; Yu, Y.; Xu, S.R.; Cai, W.W.; Chen, G.X.; Chen, J.J.; Pan, D.M.; She, W.Q. Identification of appropriate reference genes for normalizing miRNA expression in citrus infected by Xanthomonas citri subsp. Citri. Genes 2019, 11, 17. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.F.; Gao, L.X.; Hu, Y.H. Reference genes discovery and selection for quantitative real-time PCR in tree peony seed and petal tissue of different development stages. J. Agric. Biotechnol. 2015, 23, 1639–1648. [Google Scholar]
- Luo, M.; Gao, Z.; Li, H.; Li, Q.; Zhang, C.X.; Xu, W.P.; Song, S.R.; Ma, C.; Wang, S.P. Selection of reference genes for miRNA qRT-PCR under abiotic stress in grapevine. Sci. Rep. 2018, 8, 4444–4454. [Google Scholar] [CrossRef]
- Pei, X.L.; Jing, Z.G.; Tang, Z.; Luo, T.K. Screening of reference genes for fluorescence quantification of miRNA in flower bud development in Brassica oleracea var. italica. Genom. Appl. Biol. 2021, 40, 2201–2207. [Google Scholar]
- Kong, C.Y.; Chen, Y.K.; Wang, S.S.; Hao, D.H.; Yang, Y.; Gong, M. Screening and comparison of reference genes for microRNA quantitative real-time PCR in Jatropha curcas under chilling stress. Biotechnol. Bull. 2019, 35, 25–31. [Google Scholar]
- Wu, S.H.; Zhang, S.X.; Yang, S.G.; Tian, W.M. Selection of miRNA reference for normalization of quantitative real-time PCR analysis in the bark of rubber tree (Hevea brasiliensis Muell. Arg.). Chin. J. Trop. Crops 2022, 43, 2181–2187. [Google Scholar]
- Li, A.L.; Yang, K.; Wen, Z.; Qiu, Z.L.; Wan, X.P. Establishment of qRT-PCR detection system for miRNA expression in Hylocereus polyrhizus. Seed 2019, 38, 6–10+14. [Google Scholar]
- Feng, H.; Huang, X.L.; Zhang, Q.; Wei, G.R.; Wang, X.J.; Kang, Z.S. Selection of suitable inner reference genes for relative quantification expression of microRNA in wheat. Plant Physiol. Biochem. 2012, 51, 116–122. [Google Scholar] [CrossRef] [PubMed]
- Xie, F.L.; Wang, J.Y.; Zhang, B.H. RefFinder: A web-based tool for comprehensively analyzing and identifying reference genes. Funct. Integr. Genomics 2023, 23, 125–129. [Google Scholar] [CrossRef] [PubMed]
- Xie, F.L.; Xiao, P.; Chen, D.L.; Xu, L.; Zhang, B.H. miRDeepFinder: A miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol. Biol. 2012, 80, 75–84. [Google Scholar] [CrossRef]
miRNA | Stability Value | Standard Error | Rank |
---|---|---|---|
PsPC-3p-6660 | 0.37 | 0.03 | 1 |
PsPC-5p-19095 | 0.39 | 0.03 | 2 |
PsMIR319-p5 | 0.40 | 0.03 | 3 |
PsPC-3p-51259 | 0.42 | 0.03 | 4 |
PsPC-5p-9292 | 0.43 | 0.03 | 5 |
PsMIR11609-p5 | 0.44 | 0.03 | 6 |
PsPC-3p-18408 | 0.46 | 0.03 | 7 |
PsmiR159a | 0.48 | 0.03 | 8 |
PsPC-3p-23386 | 0.54 | 0.04 | 9 |
PsPC-3p-70893 | 0.54 | 0.04 | 10 |
PsPC-3p-13662 | 0.60 | 0.04 | 11 |
U6 | 0.62 | 0.04 | 12 |
PsmiR858-3p | 0.64 | 0.04 | 13 |
PsmiR11607 | 0.66 | 0.04 | 14 |
PsPC-3p-15676 | 0.72 | 0.05 | 15 |
PsmiR171k-3p | 0.79 | 0.05 | 16 |
miRNAs | SD | CV | Rank |
---|---|---|---|
PsMIR319-p5 | 0.59 | 2.15 | 1 |
PsPC-3p-6660 | 0.67 | 2.43 | 2 |
PsmiR11607 | 0.75 | 3.91 | 3 |
PsPC-5p-19095 | 0.76 | 2.76 | 4 |
PsMIR11609-p5 | 0.77 | 2.55 | 5 |
PsPC-3p-23386 | 0.77 | 3.04 | 6 |
PsPC-3p-70893 | 0.78 | 2.64 | 7 |
PsPC-5p-9292 | 0.80 | 3.09 | 8 |
PsPC-3p-51259 | 0.80 | 3.21 | 9 |
PsmiR858-3p | 0.82 | 3.26 | 10 |
PsPC-3p-18408 | 0.84 | 2.97 | 11 |
PsPC-3p-13662 | 0.84 | 3.06 | 12 |
PsmiR159a | 0.89 | 5.14 | 13 |
U6 | 0.95 | 5.11 | 14 |
PsPC-3p-15676 | 0.98 | 3.50 | 15 |
PsmiR171k-3p | 1.10 | 4.99 | 16 |
Rank | miRNAs | Geomean of Ranking Values |
---|---|---|
1 | PsPC-3p-6660 | 1.68 |
2 | PsPC-5p-19095 | 2.00 |
3 | PsMIR319-p5 | 2.59 |
4 | PsPC-3p-51259 | 3.36 |
5 | PsPC-5p-9292 | 6.06 |
6 | PsMIR11609-p5 | 6.24 |
7 | PsmiR159a | 7.07 |
8 | PsPC-3p-23386 | 7.98 |
9 | PsPC-3p-18408 | 8.10 |
10 | PsPC-3p-70893 | 8.91 |
11 | PsmiR11607 | 9.53 |
12 | PsPC-3p-13662 | 11.24 |
13 | PsmiR858-3p | 11.93 |
14 | U6 | 12.72 |
15 | PsPC-3p-15676 | 15.00 |
16 | PsmiR171k-3p | 16.00 |
Varieties (Number) | |||
---|---|---|---|
Early-flowering tree peony varieties | Paeonia suffruticosa ‘Taoyanhong’ (1) | ‘Huolianjindan’ (2) | ‘Pinghuqiuyue’ (3) |
‘Jiaohong’ (4) | ‘Dapengzhanchi’ (5) | ‘Cangjiao’ (6) | |
‘Lanju’ (7) | ‘Haibo’ (8) | ‘Lanhudie’ (9) | |
‘Lanyueliang’ (10) | ‘Zhaofen’ (11) | ‘Yuncuicaidie’ (12) | |
‘Jianshifen’ (13) | ‘Xishifen’ (14) | ‘Mantianxing’ (15) | |
‘Jingyu’ (16) | ‘Suxinbai’ (17) | ‘Xueyuanhongxing’ (18) | |
Paeonia rockii ‘Zibanbai’ (19) | ‘Erqiao’ (20) | Paeonia ostii ‘Fengdan’ (21) | |
Late-flowering tree peony varieties | ‘Feiyanhongzhuang’ (22) | ‘Shouanhong’ (23) | ‘Haitangzhengrun’ (24) |
‘Daduolan’ (25) | ‘Doulv’ (26) | ‘Shenheizi’ (27) | |
‘Zihongzhengyan’ (28) | Paeonia rockii ‘Mingmou’ (29) | Paeonia rockii ‘Xianemao’ (30) | |
Paeonia rockii ‘Baizhangbing’ (31) | Paeonia rockii ‘Baiyanwei’ (32) | Paeonia rockii ‘Yubanxiuqiu’ (33) | |
‘Shuixinfenhe’ (34) | Paeonia rockii ‘Fenzouchou’ (35) | ‘Xiuqiuhong’ (36) | |
‘Zilouxiangcui’ (37) | ‘Ziyan’ (38) | ‘Jinge’ (39) | |
‘Jinzhi’ (40) | ‘Baiwangshizi’ (41) | ‘Lianhe’ (42) |
miRNAs | miRNA Sequence (5′-3′) | Primer F Sequence (5′-3′) |
---|---|---|
PsPC-3p-70893 | TTCAACCCAACTTCGTCTCTT | CGCCTTCAACCCAACTTCGTC |
PsPC-3p-18408 | TTACGTTGCCTTTCTTCCTCTG | GGCGTTGCCTTTCTTCCTCTG |
PsmiR159a | TTTGGATTTAAGGGAGCTCTA | GCGGGTTTGGATTGAAGGGAG |
PsPC-5p-19095 | AAAAGTCGGATCGCCAGCAACATC | CGTCGGATCGCCAGCAACAT |
PsPC-3p-51259 | AAATCTCGCCCAGACCCATG | CCAAATCTCGCCCAGACCCAT |
PsmiR858-3p | CTCGTTGTCTGTTCGACCTTG | CCGTGTTGTCTGTCCGACCTTG |
PsMIR11609-p5 | TGAACCCTTTTTCCTACACT | CCGCCTGAACCCTTTTTCCTAC |
PsPC-3p-23386 | TGTGCTCTCCCTCTTCGTCAA | GCCTTGTGCTCTCCCTCTTCGT |
PsPC-3p-13662 | CGCCTCTTCCCTTGATTAAAC | GCCTTCGCCTCTTCCCTTGATT |
PsmiR171k-3p | TTGAGCCGCGCCAATATCACT | CTCAGCCGCGCCAATATCAC |
PsmiR11607 | ACTCGGTTGTCTGACAGAC | GCTTGGCACTCGGTTGTCTGAC |
PsMIR319-p5 | CTGCCATCTCATGCATAAGGT | CGCCTGCCATCTCATCCATAAG |
PsPC-3p-15676 | AATCTCGTCCAGACCTATGGC | CGCCAATCTCGTCCAGACCTAT |
PsPC-3p-6660 | AACACGGGAAGTAGGCATTGCAGC | GGAACACGGGAAGTAGGCATTG |
PsPC-5p-9292 | CAACATCTTCGGCATCTAATCAGA | GCTGGCAACATCTTCGGCATCT |
U6 | ACAGAGAAGATTAGCATGGCC |
miRNAs | miRNA Sequence (5′-3′) | Primer F Sequence (5′-3′) |
---|---|---|
PomiR171 | TTGAGCCGCGTCAATATCTCT | GGTCAGCCGCGTCAATATCTCT |
PomiR414 | TCATCATCGTCATCATCTTCC | CCGCATCATCGTCATCATCTTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shen, J.; Wang, X.; Li, Y.; Guo, L.; Hou, X. Screening of Reference miRNA of Different Early- and Late-Flowering Tree Peony Varieties. Plants 2023, 12, 2629. https://doi.org/10.3390/plants12142629
Shen J, Wang X, Li Y, Guo L, Hou X. Screening of Reference miRNA of Different Early- and Late-Flowering Tree Peony Varieties. Plants. 2023; 12(14):2629. https://doi.org/10.3390/plants12142629
Chicago/Turabian StyleShen, Jiajia, Xiaohui Wang, Yuying Li, Lili Guo, and Xiaogai Hou. 2023. "Screening of Reference miRNA of Different Early- and Late-Flowering Tree Peony Varieties" Plants 12, no. 14: 2629. https://doi.org/10.3390/plants12142629
APA StyleShen, J., Wang, X., Li, Y., Guo, L., & Hou, X. (2023). Screening of Reference miRNA of Different Early- and Late-Flowering Tree Peony Varieties. Plants, 12(14), 2629. https://doi.org/10.3390/plants12142629