Response to Cadmium Toxicity: Orchestration of Polyamines and microRNAs in Maize Plant
Abstract
:1. Introduction
2. Results
2.1. Inhibitory Effect of Cd on Photosynthesis Functionality of Maize Plant
2.2. Expression Pattern of Peroxisomal and Apoplastic PAOs under Cd Toxicity
2.3. PAs Levels in Response to Cd Toxicity
2.4. Differential Expression of PAs Biosynthesis-Related Genes by Cd Exposure
2.5. Regulated Expression Pattern of miRNAs by Cd Application
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Plant Material and Growth Condition
5.2. Determination of Plant Growth Parameters
5.3. Cd Determination
5.4. Transient and Slow Induction of Chlorophyll Fluorescence
5.5. Measurement of H2O2 Content
5.6. PAs Determination
5.7. Total RNA Extraction
5.8. miRNA Expression Analysis via Stem-Loop Reverse Transcription
5.9. Gene Expression Analysis by RT-qPCR
5.10. Real-Time Quantitative PCR
5.11. Statistical Analysis
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Benáková, M.; Ahmadi, H.; Dučaiová, Z.; Tylová, E.; Clemens, S.; Tůma, J. Effects of Cd and Zn on physiological and anatomical properties of hydroponically grown Brassica napus plants. Environ. Sci. Pollut. Res. 2017, 24, 20705–20716. [Google Scholar] [CrossRef]
- Rizwan, M.; Ali, S.; Adrees, M.; Rizvi, H.; Zia-ur-Rehman, M.; Hannan, F.; Qayyum, M.F.; Hafeez, F.; Ok, Y.S. Cadmium stress in rice: Toxic effects, tolerance mechanisms, and management: A critical review. Environ. Sci. Pollut. Res. 2016, 23, 17859–17879. [Google Scholar] [CrossRef]
- Hussain, S.; Rengel, Z.; Qaswar, M.; Amir, M.; Zafar-ul-Hye, M. Arsenic and heavy metal (cadmium, lead, mercury and nickel) contamination in plant-based foods. In Plant and Human Health; Springer: Berlin/Heidelberg, Germany, 2019; Volume 2, pp. 447–490. [Google Scholar]
- Huybrechts, M.; Cuypers, A.; Deckers, J.; Iven, V.; Vandionant, S.; Jozefczak, M.; Hendrix, S. Cadmium and plant development: An agony from seed to seed. Int. J. Mol. Sci. 2019, 20, 3971. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kohli, S.K.; Khanna, K.; Bhardwaj, R.; Abd_Allah, E.F.; Ahmad, P.; Corpas, F.J. Assessment of subcellular ROS and NO metabolism in higher plants: Multifunctional signaling molecules. Antioxidants 2019, 8, 641. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mansoor, S.; Ali Wani, O.; Lone, J.K.; Manhas, S.; Kour, N.; Alam, P.; Ahmad, P. Reactive oxygen species in plants: From source to sink. Antioxidants 2022, 11, 225. [Google Scholar] [CrossRef]
- Shomali, A.; Aliniaeifard, S. Overview of Signal Transduction in Plants Under Salt and Drought Stresses. In Salt and Drought Stress Tolerance in Plants: Signaling Networks and Adaptive Mechanisms; Hasanuzzaman, M., Tanveer, M., Eds.; Springer International Publishing: Cham, Switzerland, 2020; pp. 231–258. [Google Scholar]
- Aliniaeifard, S.; Shomali, A.; Seifikalhor, M.; Lastochkina, O. Calcium Signaling in Plants Under Drought. In Salt and Drought Stress Tolerance in Plants: Signaling Networks and Adaptive Mechanisms; Hasanuzzaman, M., Tanveer, M., Eds.; Springer International Publishing: Cham, Switzerland, 2020; pp. 259–298. [Google Scholar]
- Seifikalhor, M.; Aliniaeifard, S.; Shomali, A.; Azad, N.; Hassani, B.; Lastochkina, O.; Li, T. Calcium signaling and salt tolerance are diversely entwined in plants. Plant Signal. Behav. 2019, 14, 1665455. [Google Scholar] [CrossRef] [PubMed]
- Seifikalhor, M.; Aliniaeifard, S.; Bernard, F.; Seif, M.; Latifi, M.; Hassani, B.; Didaran, F.; Bosacchi, M.; Rezadoost, H.; Li, T. γ-Aminobutyric acid confers cadmium tolerance in maize plants by concerted regulation of polyamine metabolism and antioxidant defense systems. Sci. Rep. 2020, 10, 3356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seifikalhor, M.; Aliniaeifard, S.; Hassani, B.; Niknam, V.; Lastochkina, O. Diverse role of γ-aminobutyric acid in dynamic plant cell responses. Plant Cell Rep. 2019, 38, 847–867. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.; Jia, D.; Liu, T. Polyamine Oxidases Play Various Roles in Plant Development and Abiotic Stress Tolerance. Plants 2019, 8, 184. [Google Scholar] [CrossRef] [Green Version]
- Shah, A.A.; Ahmed, S.; Ali, A.; Yasin, N.A. 2-Hydroxymelatonin mitigates cadmium stress in cucumis sativus seedlings: Modulation of antioxidant enzymes and polyamines. Chemosphere 2020, 243, 125308. [Google Scholar] [CrossRef]
- Benavides, M.P.; Groppa, M.D.; Recalde, L.; Verstraeten, S.V. Effects of polyamines on cadmium-and copper-mediated alterations in wheat (Triticum aestivum L.) and sunflower (Helianthus annuus L.) seedling membrane fluidity. Arch Biochem Biophys 2018, 654, 27–39. [Google Scholar] [CrossRef] [PubMed]
- Groppa, M.a.D.; Tomaro, M.a.L.; Benavides, M.a.P. Polyamines as protectors against cadmium or copper-induced oxidative damage in sunflower leaf discs. Plant Sci. 2001, 161, 481–488. [Google Scholar] [CrossRef]
- Alcázar, R.; Marco, F.; Cuevas, J.C.; Patron, M.; Ferrando, A.; Carrasco, P.; Altabella, T. Involvement of polyamines in plant response to abiotic stress. Biotechnol. Lett. 2006, 28, 1867–1876. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Shi, G.; Wang, H.; Xu, Q. Involvement of polyamines in adaptation of Potamogeton crispus L. to cadmium stress. Aquat. Toxicol. 2010, 100, 282–288. [Google Scholar] [CrossRef] [PubMed]
- Wi, S.J.; Park, K.Y. Antisense expression of carnation cDNA encoding ACC synthase or ACC oxidase enhances polyamine content and abiotic stress tolerance in transgenic tobacco plants. Mol. Cells 2002, 13, 209–220. [Google Scholar] [PubMed]
- Groppa, M.D.; Tomaro, M.L.; Benavides, M.P. Polyamines and heavy metal stress: The antioxidant behavior of spermine in cadmium-and copper-treated wheat leaves. Biometals 2007, 20, 185–195. [Google Scholar] [CrossRef]
- Mendoza-Soto, A.B.; Sánchez, F.; Hernández, G. MicroRNAs as regulators in plant metal toxicity response. Front. Plant Sci. 2012, 3, 105. [Google Scholar] [CrossRef] [Green Version]
- Pál, M.; Szalai, G.; Gondor, O.K.; Janda, T. Unfinished story of polyamines: Role of conjugation, transport and light-related regulation in the polyamine metabolism in plants. Plant Sci. 2021, 308, 110923. [Google Scholar] [CrossRef]
- Baxter, A.; Mittler, R.; Suzuki, N. ROS as key players in plant stress signalling. J. Exp. Bot. 2013, 65, 1229–1240. [Google Scholar] [CrossRef]
- Golldack, D.; Li, C.; Mohan, H.; Probst, N. Tolerance to drought and salt stress in plants: Unraveling the signaling networks. Front. Plant Sci. 2014, 5, 151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, S.-H.; Li, C.-W.; Koh, K.W.; Chuang, H.-Y.; Chen, Y.-R.; Lin, C.-S.; Chan, M.-T. MSRB7 reverses oxidation of GSTF2/3 to confer tolerance of Arabidopsis thaliana to oxidative stress. J. Exp. Bot. 2014, 65, 5049–5062. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, W.; Liu, D.; Zhang, X.; Chen, D.; Cheng, Y.; Shen, F. Plant microRNAs in cross-kingdom regulation of gene expression. Int. J. Mol. Sci. 2018, 19, 2007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chaloner, T.; van Kan, J.A.; Grant-Downton, R.T. RNA ‘Information Warfare’in pathogenic and mutualistic interactions. Trends Plant Sci. 2016, 21, 738–748. [Google Scholar] [CrossRef] [PubMed]
- Niu, D.; Wang, Z.; Wang, S.; Qiao, L.; Zhao, H. Profiling of small RNAs involved in plant–pathogen interactions. Plant Gene Silencing Methods Protoc. 2015, 61–79. [Google Scholar]
- Zhang, T.; Zhao, Y.-L.; Zhao, J.-H.; Wang, S.; Jin, Y.; Chen, Z.-Q.; Fang, Y.-Y.; Hua, C.-L.; Ding, S.-W.; Guo, H.-S. Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen. Nat. Plants 2016, 2, 16153. [Google Scholar] [CrossRef]
- Zhu, J.-K. Abiotic stress signaling and responses in plants. Cell 2016, 167, 313–324. [Google Scholar] [CrossRef] [Green Version]
- Shriram, V.; Kumar, V.; Devarumath, R.M.; Khare, T.S.; Wani, S.H. MicroRNAs as potential targets for abiotic stress tolerance in plants. Front. Plant Sci. 2016, 7, 817. [Google Scholar] [CrossRef] [Green Version]
- Pegler, J.L.; Oultram, J.M.; Nguyen, D.Q.; Grof, C.P.; Eamens, A.L. MicroRNA-mediated responses to cadmium stress in Arabidopsis thaliana. Plants 2021, 10, 130. [Google Scholar] [CrossRef]
- Srivastava, S.; Suprasanna, P. MicroRNAs: Tiny, powerful players of metal stress responses in plants. Plant Physiol. Biochem. 2021, 166, 928–938. [Google Scholar] [CrossRef]
- Jamla, M.; Patil, S.; Joshi, S.; Khare, T.; Kumar, V. MicroRNAs and Their Exploration for Developing Heavy Metal-tolerant Plants. J. Plant Growth Regul. 2021, 41, 1–17. [Google Scholar] [CrossRef]
- Zhou, Z.S.; Huang, S.Q.; Yang, Z.M. Bioinformatic identification and expression analysis of new microRNAs from Medicago truncatula. Biochem. Biophys Res. Commun. 2008, 374, 538–542. [Google Scholar] [CrossRef]
- Xie, F.L.; Huang, S.Q.; Guo, K.; Xiang, A.L.; Zhu, Y.Y.; Nie, L.; Yang, Z.M. Computational identification of novel microRNAs and targets in Brassica napus. FEBS Lett. 2007, 581, 1464–1474. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, S.Q.; Xiang, A.L.; Che, L.L.; Chen, S.; Li, H.; Song, J.B.; Yang, Z.M. A set of miRNAs from Brassica napus in response to sulphate deficiency and cadmium stress. Plant Biotechnol. J. 2010, 8, 887–899. [Google Scholar] [CrossRef]
- Huang, S.Q.; Peng, J.; Qiu, C.X.; Yang, Z.M. Heavy metal-regulated new microRNAs from rice. J. Inorg. Biochem. 2009, 103, 282–287. [Google Scholar] [CrossRef]
- Ding, Y.; Chen, Z.; Zhu, C. Microarray-based analysis of cadmium-responsive microRNAs in rice (Oryza sativa). J. Exp. Bot. 2011, 62, 3563–3573. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Luo, M.; Peng, H.; Chen, F.; Li, W. Characterization of cadmium-responsive microRNAs and their target genes in maize (Zea mays) roots. BMC Mol. Biol. 2019, 20, 1–9. [Google Scholar] [CrossRef]
- Gielen, H.; Remans, T.; Vangronsveld, J.; Cuypers, A. MicroRNAs in metal stress: Specific roles or secondary responses? Int. J. Mol. Sci. 2012, 13, 15826–15847. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wallace, D.R.; Taalab, Y.M.; Heinze, S.; Tariba Lovaković, B.; Pizent, A.; Renieri, E.; Tsatsakis, A.; Farooqi, A.A.; Javorac, D.; Andjelkovic, M. Toxic-Metal-Induced Alteration in miRNA Expression Profile as a Proposed Mechanism for Disease Development. Cells 2020, 9, 901. [Google Scholar] [CrossRef] [Green Version]
- Aliniaeifard, S.; Hajilou, J.; Tabatabaei, S.J.; Sifi-Kalhor, M. Effects of ascorbic acid and reduced glutathione on the alleviation of salinity stress in olive plants. Int. J. Fruit Sci. 2016, 16, 395–409. [Google Scholar] [CrossRef]
- Aliniaeifard, S.; Hajilou, J.; Tabatabaei, S.J. Photosynthetic and growth responses of olive to proline and salicylic acid under salinity condition. Not. Bot. Horti Agrobot. Cluj-Napoca 2016, 44, 579–585. [Google Scholar] [CrossRef] [Green Version]
- Balla, K.; Karsai, I.; Bónis, P.; Kiss, T.; Berki, Z.; Horváth, Á.; Mayer, M.; Bencze, S.; Veisz, O. Heat stress responses in a large set of winter wheat cultivars (Triticum aestivum L.) depend on the timing and duration of stress. PloS ONE 2019, 14, e0222639. [Google Scholar] [CrossRef] [PubMed]
- Benavides, M.P.; Gallego, S.M.; Tomaro, M.L. Cadmium toxicity in plants. Braz. J. Plant Physiol. 2005, 17, 21–34. [Google Scholar] [CrossRef] [Green Version]
- Dias, M.C.; Monteiro, C.; Moutinho-Pereira, J.; Correia, C.; Gonçalves, B.; Santos, C. Cadmium toxicity affects photosynthesis and plant growth at different levels. Acta Physiol. Plant 2013, 35, 1281–1289. [Google Scholar] [CrossRef]
- Liu, L.; Sun, H.; Chen, J.; Zhang, Y.; Li, D.; Li, C. Effects of cadmium (Cd) on seedling growth traits and photosynthesis parameters in cotton (Gossypium hirsutum L.). Plant Omics 2014, 7, 284. [Google Scholar]
- Kubier, A.; Pichler, T. Cadmium in groundwater—A synopsis based on a large hydrogeochemical data set. Sci. Total Environ. 2019, 689, 831–842. [Google Scholar] [CrossRef] [PubMed]
- Haider, F.U.; Liqun, C.; Coulter, J.A.; Cheema, S.A.; Wu, J.; Zhang, R.; Wenjun, M.; Farooq, M. Cadmium toxicity in plants: Impacts and remediation strategies. Ecotoxicol. Environ. Saf. 2021, 211, 111887. [Google Scholar] [CrossRef]
- Hasan, S.A.; Fariduddin, Q.; Ali, B.; Hayat, S.; Ahmad, A. Cadmium: Toxicity and tolerance in plants. J. Environ. Biol. 2009, 30, 165–174. [Google Scholar]
- Moschou, P.; Wu, J.; Cona, A.; Tavladoraki, P.; Angelini, R.; Roubelakis-Angelakis, K. The polyamines and their catabolic products are significant players in the turnover of nitrogenous molecules in plants. J. Exp. Bot. 2012, 63, 5003–5015. [Google Scholar] [CrossRef] [Green Version]
- Planas-Portell, J.; Gallart, M.; Tiburcio, A.F.; Altabella, T. Copper-containing amine oxidases contribute to terminal polyamine oxidation in peroxisomes and apoplast of Arabidopsis thaliana. BMC Plant Biol. 2013, 13, 109. [Google Scholar] [CrossRef] [Green Version]
- Wang, W.; Paschalidis, K.; Feng, J.-C.; Song, J.; Liu, J.-H. Polyamine catabolism in plants: A universal process with diverse functions. Front. Plant Sci. 2019, 10, 561. [Google Scholar] [CrossRef] [Green Version]
- Brikis, C.J.; Zarei, A.; Chiu, G.Z.; Deyman, K.L.; Liu, J.; Trobacher, C.P.; Hoover, G.J.; Subedi, S.; DeEll, J.R.; Bozzo, G.G. Targeted quantitative profiling of metabolites and gene transcripts associated with 4-aminobutyrate (GABA) in apple fruit stored under multiple abiotic stresses. Hortic. Res. 2018, 5, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Zarza, X.; Atanasov, K.E.; Marco, F.; Arbona, V.; Carrasco, P.; Kopka, J.; Fotopoulos, V.; Munnik, T.; Gómez-Cadenas, A.; Tiburcio, A.F.; et al. Polyamine oxidase 5 loss-of-function mutations in Arabidopsis thaliana trigger metabolic and transcriptional reprogramming and promote salt stress tolerance. Plant Cell Environ. 2016, 40, 527–542. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sagor, G.H.M.; Zhang, S.; Kojima, S.; Simm, S.; Berberich, T.; Kusano, T. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression. Front. Plant Sci. 2016, 7, 214. [Google Scholar] [CrossRef] [Green Version]
- Bouchereau, A.; Aziz, A.; Larher, F.; Martin-Tanguy, J. Polyamines and environmental challenges: Recent development. Plant Sci. 1999, 140, 103–125. [Google Scholar] [CrossRef]
- Groppa, M.D.; Benavides, M.P. Polyamines and abiotic stress: Recent advances. Amino Acids 2008, 34, 35–45. [Google Scholar] [CrossRef]
- Kusano, T.; Berberich, T.; Tateda, C.; Takahashi, Y. Polyamines: Essential factors for growth and survival. Planta 2008, 228, 367–381. [Google Scholar] [CrossRef]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef]
- Cuevas, J.C.; López-Cobollo, R.; Alcázar, R.; Zarza, X.; Koncz, C.; Altabella, T.; Ferrando, A. Putrescine as a signal to modulate the indispensable ABA increase under cold stress. Plant Signal. Behav. 2009, 4, 219–220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alcázar, R.; Altabella, T.; Marco, F.; Bortolotti, C.; Reymond, M.; Koncz, C.; Tiburcio, A.F. Polyamines: Molecules with regulatory functions in plant abiotic stress tolerance. Planta 2010, 231, 1237–1249. [Google Scholar] [CrossRef]
- Kasinathan, V.; Wingler, A. Effect of reduced arginine decarboxylase activity on salt tolerance and on polyamine formation during salt stress in Arabidopsis thaliana. Physiol. Plant. 2004, 121, 101–107. [Google Scholar] [CrossRef]
- Kusano, T.; Yamaguchi, K.; Berberich, T.; Takahashi, Y. Advances in polyamine research in 2007. J. Plant Res. 2007, 120, 345–350. [Google Scholar] [CrossRef] [PubMed]
- Barrera-Figueroa, B.E.; Gao, L.; Diop, N.N.; Wu, Z.; Ehlers, J.D.; Roberts, P.A.; Close, T.J.; Zhu, J.-K.; Liu, R. Identification and comparative analysis of drought-associated microRNAs in two cowpea genotypes. BMC Plant Biol. 2011, 11, 127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Budak, H.; Akpinar, A. Dehydration stress-responsive miRNA in Brachypodium distachyon: Evident by genome-wide screening of microRNAs expression. Omics A J. Integr. Biol. 2011, 15, 791–799. [Google Scholar] [CrossRef]
- Chen, L.; Wang, T.; Zhao, M.; Tian, Q.; Zhang, W.-H. Identification of aluminum-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing. Planta 2012, 235, 375–386. [Google Scholar] [CrossRef]
- Ding, Y.; Ye, Y.; Jiang, Z.; Wang, Y.; Zhu, C. MicroRNA390 is involved in cadmium tolerance and accumulation in rice. Front. Plant Sci. 2016, 7, 235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, J.-H.; Wang, W.; Wu, H.; Gong, X.; Moriguchi, T. Polyamines function in stress tolerance: From synthesis to regulation. Front. Plant Sci. 2015, 6, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Rangan, P.; Subramani, R.; Kumar, R.; Singh, A.K.; Singh, R. Recent advances in polyamine metabolism and abiotic stress tolerance. BioMed Res. Int. 2014, 2014, 239621. [Google Scholar] [CrossRef] [Green Version]
- Mattoo, A.K.; Minocha, S.C.; Minocha, R.; Handa, A.K. Polyamines and cellular metabolism in plants: Transgenic approaches reveal different responses to diamine putrescine versus higher polyamines spermidine and spermine. Amino Acids 2010, 38, 405–413. [Google Scholar] [CrossRef]
- Pegg, A.E. Regulation of ornithine decarboxylase. J. Biol. Chem. 2006, 281, 14529–14532. [Google Scholar] [CrossRef] [Green Version]
- Pathak, M.R.; Teixeira da Silva, J.A.; Wani, S.H. Polyamines in response to abiotic stress tolerance through transgenic approaches. GM Crops Food 2014, 5, 87–96. [Google Scholar] [CrossRef]
- Zhou, L.; Liu, Y.; Liu, Z.; Kong, D.; Duan, M.; Luo, L. Genome-wide identification and analysis of drought-responsive microRNAs in Oryza sativa. J. Exp. Bot. 2010, 61, 4157–4168. [Google Scholar] [CrossRef]
- Liu, H.-H.; Tian, X.; Li, Y.-J.; Wu, C.-A.; Zheng, C.-C. Microarray-based analysis of stress-regulated microRNAs in Arabidopsis thaliana. Rna 2008, 14, 836–843. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, D.; Zhang, L.; Wang, H.; Liu, Z.; Zhang, Z.; Zheng, Y. Differential expression of miRNAs in response to salt stress in maize roots. Ann. Bot. 2009, 103, 29–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jia, X.; Wang, W.-X.; Ren, L.; Chen, Q.-J.; Mendu, V.; Willcut, B.; Dinkins, R.; Tang, X.; Tang, G. Differential and dynamic regulation of miR398 in response to ABA and salt stress in Populustremula and Arabidopsisthaliana. Plant Mol. Biol. 2009, 71, 51–59. [Google Scholar] [CrossRef]
- Li, W.; Cui, X.; Meng, Z.; Huang, X.; Xie, Q.; Wu, H.; Jin, H.; Zhang, D.; Liang, W. Transcriptional regulation of Arabidopsis MIR168a and argonaute1 homeostasis in abscisic acid and abiotic stress responses. Plant Physiol. 2012, 158, 1279–1292. [Google Scholar] [CrossRef] [Green Version]
- Hasan, M.K.; Ahammed, G.J.; Sun, S.; Li, M.; Yin, H.; Zhou, J. Melatonin inhibits cadmium translocation and enhances plant tolerance by regulating sulfur uptake and assimilation in Solanum lycopersicum L. J. Agric. Food Chem. 2019, 67, 10563–10576. [Google Scholar] [CrossRef] [PubMed]
- Amarnath, K.; Bennett, D.I.; Schneider, A.R.; Fleming, G.R. Multiscale model of light harvesting by photosystem II in plants. Proc. Natl. Acad. Sci. USA 2016, 113, 1156–1161. [Google Scholar] [CrossRef] [Green Version]
- Croce, R.; Nicol, L. Light harvesting in higher plants and green algae. In Light Harvesting in Photosynthesis; CRC Press: Boca Raton, FL, USA, 2018; pp. 73–90. [Google Scholar]
- Melis, A. Photosystem-II damage and repair cycle in chloroplasts: What modulates the rate of photodamage in vivo? Trends Plant Sci. 1999, 4, 130–135. [Google Scholar] [CrossRef]
- Krause, G.H. Photoinhibition of photosynthesis. An evaluation of damaging and protective mechanisms. Physiol. Plant 1988, 74, 566–574. [Google Scholar] [CrossRef]
- Weis, E.; Berry, J.A. Quantum efficiency of photosystem II in relation to ‘energy’-dependent quenching of chlorophyll fluorescence. Biochim. Et Biophys. Acta (BBA)-Bioenerg. 1987, 894, 198–208. [Google Scholar] [CrossRef]
- Strasser, R.J.; Tsimilli-Michael, M.; Srivastava, A. Analysis of the chlorophyll a fluorescence transient. In Chlorophyll A Fluoresc: A Signature of Photosynthesis; Springer: New York, NY, USA, 2004; pp. 321–362. [Google Scholar]
- Müller, P.; Li, X.-P.; Niyogi, K.K. Non-Photochemical Quenching. A response to excess light energy. Plant Physiol. 2001, 125, 1558–1566. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Collins, T.J. ImageJ for microscopy. Biotechniques 2007, 43, S25–S30. [Google Scholar] [CrossRef] [PubMed]
- Woodis Jr, T.; Hunter, G.; Johnson, F. Statistical studies of matrix effects on the determination of cadmium and lead in fertilizer materials and plant tissue by flameless atomic absorption spectrometry. Anal. Chim. Acta 1977, 90, 127–136. [Google Scholar] [CrossRef]
- Mattina, M.I.; Lannucci-Berger, W.; Musante, C.; White, J.C. Concurrent plant uptake of heavy metals and persistent organic pollutants from soil. Environ. Pollut. 2003, 124, 375–378. [Google Scholar] [CrossRef]
- Genty, B.; Briantais, J.-M.; Baker, N.R. The relationship between the quantum yield of photosynthetic electron transport and quenching of chlorophyll fluorescence. Biochim. Et Biophys. Acta (BBA)-Gen. Subj. 1989, 990, 87–92. [Google Scholar] [CrossRef]
- Aliniaeifard, S.; van Meeteren, U. Natural variation in stomatal response to closing stimuli among Arabidopsis thaliana accessions after exposure to low VPD as a tool to recognize the mechanism of disturbed stomatal functioning. J. Exp. Bot. 2014, 65, 6529–6542. [Google Scholar] [CrossRef] [PubMed]
- Aliniaeifard, S.; Malcolm Matamoros, P.; van Meeteren, U. Stomatal malfunctioning under low Vapor Pressure Deficit (VPD) conditions: Induced by alterations in stomatal morphology and leaf anatomy or in the ABA signaling? Physiol. Plant 2014, 152, 688–699. [Google Scholar] [CrossRef]
- Velikova, V.; Yordanov, I.; Edreva, A. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: Protective role of exogenous polyamines. Plant Sci. 2000, 151, 59–66. [Google Scholar] [CrossRef]
- Hassannejad, S.; Bernard, F.; Mirzajani, F.; Gholami, M. SA improvement of hyperhydricity reversion in Thymus daenensis shoots culture may be associated with polyamines changes. Plant Physiol. Biochem. 2012, 51, 40–46. [Google Scholar] [CrossRef]
- Jazi, M.M.; Rajaei, S.; Seyedi, S.M. Isolation of high quality RNA from pistachio (Pistacia vera L.) and other woody plants high in secondary metabolites. Physiol. Mol. Biol. Plants 2015, 21, 597–603. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.; Ridzon, D.A.; Broomer, A.J.; Zhou, Z.; Lee, D.H.; Nguyen, J.T.; Barbisin, M.; Xu, N.L.; Mahuvakar, V.R.; Andersen, M.R. Real-time quantification of microRNAs by stem–loop RT–PCR. Nucleic Acids Res. 2005, 33, e179. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Kumari, S.; Zhang, L.; Zheng, Y.; Ware, D. Characterization of miRNAs in response to short-term waterlogging in three inbred lines of Zea mays. PloS ONE 2012, 7, e39786. [Google Scholar] [CrossRef]
- Wu, F.; Shu, J.; Jin, W. Identification and validation of miRNAs associated with the resistance of maize (Zea mays L.) to Exserohilum turcicum. PloS ONE 2014, 9, e87251. [Google Scholar] [CrossRef] [PubMed]
- Manoli, A.; Sturaro, A.; Trevisan, S.; Quaggiotti, S.; Nonis, A. Evaluation of candidate reference genes for qPCR in maize. J. Plant Physiol. 2012, 169, 807–815. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
miRNA | Sequence (5′-3′) |
---|---|
Mir390 | AAGCUCAGGAGGGAUAGCGCC |
Mir168 | UCGCUUGGUGCAGAUCGGGAC |
Mir528 | UGGAAGGGGCAUGCAGAGGAG |
miRNA (miRBase Accession Number) | Stem-Loop RT Primer Sequence (5′-3′) | qPCR Primer Sequence (5′-3′) |
---|---|---|
MiR390 (MIMAT0014033) | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCGCT | Forward: CGACTGAAGCTCAGGAGGGAT |
Universal Reverse: GTGCAGGGTCCGAGGT | ||
MiR168 (MIMAT0001726) | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTCCCG | Forward: CGACTGTCGCTTGGTGCAGAT |
Universal reverse: GTGCAGGGTCCGAGGT | ||
MiR528 (MIMAT0014029) | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCCTC | Forward: CGACTGTGGAAGGGGCATGCA |
Universal reverse: GTGCAGGGTCCGAGGT | ||
U6 | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC | Forward: TGCGGGTGCTCGCTTCGGCAGC |
Reverse: GGGCAGCCAAGGATGACT |
Gene | Accession No. (NCBI Gene Bank or Phytozome) | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|---|
ARGDC | GRMZM2G100920 (NM_001365614.1) | CTAATATGCCCGTATCCACC | GGCAATCATCATAAGTCGCAC |
ORDC | NM_001148682.1 | CATGGACCACAAGGCTCC | GTCGAAGACGAGCCAGTC |
SPDS | AY730048.1 | CGAAAGAATCAGTGTCAGAACC | GTGCGGTGTCAGCAAAAGC |
PAO1 | GRMZM2G034152 (NM_001111636.2) | GCAAGTACCATGTCCAGGG | CGAGGGAACATGGCTGTCA |
PAO2 | GRMZM2G000052_T01 | TGGAGATGTGCCACCCTG | GGCAATCAGTGGGATGTCC |
PAO3 | GRMZM2G396856_T02 | GACGAAAGCCCTGTCTCC | CGAAGAGGGAGAAGCAAGG |
PAO4 | GRMZM2G150248_T01 | TCCTACTCGTGCGACCTG | CGATGCCTGACGAGTAAGC |
PAO5 | GRMZM2G035994_T01 | CAGCACTACGCTTAGGTTGC | TAGCACACAGCAAGAACACAG |
PAO6 | GRMZM2G078033_T01 | GATTTGCAGGACCTGAGTGAG | CAAGACACAACGGCCTTCAAG |
MEP | GRMZM2G018103 T01 | TGTACTCGGCAATGCTCTTG | TTTGATGCTCCAGGCTTACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hassani, S.B.; Latifi, M.; Aliniaeifard, S.; Sohrabi Bonab, S.; Nasiri Almanghadim, N.; Jafari, S.; Mohebbifar, E.; Ahangir, A.; Seifikalhor, M.; Rezadoost, H.; et al. Response to Cadmium Toxicity: Orchestration of Polyamines and microRNAs in Maize Plant. Plants 2023, 12, 1991. https://doi.org/10.3390/plants12101991
Hassani SB, Latifi M, Aliniaeifard S, Sohrabi Bonab S, Nasiri Almanghadim N, Jafari S, Mohebbifar E, Ahangir A, Seifikalhor M, Rezadoost H, et al. Response to Cadmium Toxicity: Orchestration of Polyamines and microRNAs in Maize Plant. Plants. 2023; 12(10):1991. https://doi.org/10.3390/plants12101991
Chicago/Turabian StyleHassani, Seyedeh Batool, Mojgan Latifi, Sasan Aliniaeifard, Shabnam Sohrabi Bonab, Neda Nasiri Almanghadim, Sara Jafari, Elham Mohebbifar, Anahita Ahangir, Maryam Seifikalhor, Hassan Rezadoost, and et al. 2023. "Response to Cadmium Toxicity: Orchestration of Polyamines and microRNAs in Maize Plant" Plants 12, no. 10: 1991. https://doi.org/10.3390/plants12101991
APA StyleHassani, S. B., Latifi, M., Aliniaeifard, S., Sohrabi Bonab, S., Nasiri Almanghadim, N., Jafari, S., Mohebbifar, E., Ahangir, A., Seifikalhor, M., Rezadoost, H., Bosacchi, M., Rastogi, A., & Bernard, F. (2023). Response to Cadmium Toxicity: Orchestration of Polyamines and microRNAs in Maize Plant. Plants, 12(10), 1991. https://doi.org/10.3390/plants12101991