Next Article in Journal
Genome-Wide Identification and Expression Analysis of Wall-Associated Kinase (WAK) Gene Family in Cannabis sativa L.
Next Article in Special Issue
Leaf Functional Traits in Relation to Species Composition in an Arctic–Alpine Tundra Grassland
Previous Article in Journal
Effects of LED Light Spectra on the Development, Phytochemical Profile, and Antioxidant Activity of Curcuma longa from Easter Island
Previous Article in Special Issue
Amplified Drought Alters Leaf Litter Metabolome, Slows Down Litter Decomposition, and Modifies Home Field (Dis)Advantage in Three Mediterranean Forests
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Protective Responses at the Biochemical and Molecular Level Differ between a Coffea arabica L. Hybrid and Its Parental Genotypes to Supra-Optimal Temperatures and Elevated Air [CO2]

by
Gabriella Vinci
1,2,3,*,†,
Isabel Marques
2,3,*,†,
Ana P. Rodrigues
2,3,†,
Sónia Martins
4,5,†,
António E. Leitão
2,3,5,†,
Magda C. Semedo
4,5,
Maria J. Silva
2,3,5,
Fernando C. Lidon
5,
Fábio M. DaMatta
6,
Ana I. Ribeiro-Barros
2,3,5,* and
José C. Ramalho
2,3,5,*
1
Department of Biological, Geological and Environmental Sciences (BiGeA), Alma Mater Studiorum, The University of Bologna, Via Irnerio 42, 40126 Bologna, Italy
2
Plant Stress & Biodiversity Lab, Centro de Estudos Florestais (CEF), Instituto Superior Agronomia (ISA), Universidade de Lisboa (ULisboa), Quinta do Marquês, Av. República, Oeiras, 2784-505 Lisboa, Portugal
3
Plant Stress & Biodiversity Lab, Centro de Estudos Florestais (CEF), Instituto Superior Agronomia (ISA), Universidade de Lisboa (ULisboa), Quinta do Marquês, Av. República, Tapada da Ajuda, 1349-017 Lisboa, Portugal
4
Departamento de Engenharia Química, Instituto Superior de Engenharia de Lisboa, Instituto Politécnico de Lisboa, R. Conselheiro Emídio Navarro 1, 1959-007 Lisboa, Portugal
5
Unidade de Geobiociências, Geoengenharias e Geotecnologias (GeoBioTec), Faculdade de Ciências e Tecnologia (FCT), Universidade NOVA de Lisboa (UNL), Monte de Caparica, 2829-516 Caparica, Portugal
6
Departamento de Biologia Vegetal, Universidade Federal Viçosa (UFV), Viçosa 36570-900, MG, Brazil
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Plants 2022, 11(20), 2702; https://doi.org/10.3390/plants11202702
Submission received: 1 September 2022 / Revised: 6 October 2022 / Accepted: 10 October 2022 / Published: 13 October 2022

Abstract

Climate changes with global warming associated with rising atmospheric [CO2] can strongly impact crop performance, including coffee, which is one of the most world’s traded agricultural commodities. Therefore, it is of utmost importance to understand the mechanisms of heat tolerance and the potential role of elevated air CO2 (eCO2) in the coffee plant response, particularly regarding the antioxidant and other protective mechanisms, which are crucial for coffee plant acclimation. For that, plants of Coffea arabica cv. Geisha 3, cv. Marsellesa and their hybrid (Geisha 3 × Marsellesa) were grown for 2 years at 25/20 °C (day/night), under 400 (ambient CO2, aCO2) or 700 µL (elevated CO2, eCO2) CO2 L−1, and then gradually submitted to a temperature increase up to 42/30 °C, followed by recovery periods of 4 (Rec4) and 14 days (Rec14). Heat (37/28 °C and/or 42/30 °C) was the major driver of the response of the studied protective molecules and associated genes in all genotypes. That was the case for carotenoids (mostly neoxanthin and lutein), but the maximal (α + β) carotenes pool was found at 37/28 °C only in Marsellesa. All genes (except VDE) encoding for antioxidative enzymes (catalase, CAT; superoxide dismutases, CuSODs; ascorbate peroxidases, APX) or other protective proteins (HSP70, ELIP, Chape20, Chape60) were strongly up-regulated at 37/28 °C, and, especially, at 42/30 °C, in all genotypes, but with maximal transcription in Hybrid plants. Accordingly, heat greatly stimulated the activity of APX and CAT (all genotypes) and glutathione reductase (Geisha3, Hybrid) but not of SOD. Notably, CAT activity increased even at 42/30 °C, concomitantly with a strongly declined APX activity. Therefore, increased thermotolerance might arise through the reinforcement of some ROS-scavenging enzymes and other protective molecules (HSP70, ELIP, Chape20, Chape60). Plants showed low responsiveness to single eCO2 under unstressed conditions, while heat promoted changes in aCO2 plants. Only eCO2 Marsellesa plants showed greater contents of lutein, the pool of the xanthophyll cycle components (V + A + Z), and β-carotene, compared to aCO2 plants at 42/30 °C. This, together with a lower CAT activity, suggests a lower presence of H2O2, likely also associated with the higher photochemical use of energy under eCO2. An incomplete heat stress recovery seemed evident, especially in aCO2 plants, as judged by the maintenance of the greater expression of all genes in all genotypes and increased levels of zeaxanthin (Marsellesa and Hybrid) relative to their initial controls. Altogether, heat was the main response driver of the addressed protective molecules and genes, whereas eCO2 usually attenuated the heat response and promoted a better recovery. Hybrid plants showed stronger gene expression responses, especially at the highest temperature, when compared to their parental genotypes, but altogether, Marsellesa showed a greater acclimation potential. The reinforcement of antioxidative and other protective molecules are, therefore, useful biomarkers to be included in breeding and selection programs to obtain coffee genotypes to thrive under global warming conditions, thus contributing to improved crop sustainability.

1. Introduction

Climate changes associated with global warming are expected to endanger ecosystems and food security [1]. Climate changes are believed to be closely driven by greenhouse gas (GHG) emissions into the atmosphere. Among them, air [CO2] already exceeds 400 µL L−1 and continues to increase at a rate close to 2 µL CO2 L−1 per year [2], with estimates pointing to unprecedented values between 730 and 1000 µL L−1 by 2100, depending on the measures to control future GHGs emissions. This air [CO2] increase is believed to trigger a temperature rise between 1.0–1.8 °C (best scenario) and 3.3–5.7 °C (worst scenario without additional efforts to limit the emissions), as compared to 1850–1900 [3,4]. Climate changes are already affecting the frequency and severity of extreme events, such as heat waves, longer and harsher droughts, unpredictable rainfalls, etc. [4]. This will have severe impacts on agricultural ecosystems, with the consequent decline of crop yields, quality [3], and suitable areas, under increasing pressure for feed and food availability to fulfill the demands of a growing world population [5] that is expected to approach 10,000 million people by 2050 [6,7,8].
High temperature is one of the major abiotic stresses that pose growing and serious challenges to plant growth and development [9]. Heat stress affects several physiological processes [10], e.g., it could alter membrane permeability and fluidity, influencing cellular homeostasis [11,12], and cause denaturation and aggregation of proteins [13], cell damage and ion leakage, interfering with important processes such as respiration and photosynthesis [14]. Indeed, the photosynthetic apparatus is highly sensitive to high temperatures [15], namely at the PSII level [9], associated with the dissociation of the D1 protein, but the electron transport chain (ETC) and the oxygen-evolving complex (OEC), and photosynthetic enzymes, such as RuBisCO activase, could also be inactivated [10,16,17]. Additionally, temperature rise stimulates photorespiration and respiration more than photosynthesis due to decreases in the affinity of RuBisCO for CO2 and the solubility of CO2, both relative to O2, thus reducing the relative rate of carboxylation to oxygenation and C-assimilation [18,19,20].
Unfavorable environmental conditions that inhibit energy use through photochemistry may promote the over-reduction of the ETC, and the accumulation of molecules in the excited state [9,21], such as singlet oxygen (1O2), the singlet chlorophyll (1Chl) and triplet state of chlorophyll (3Chl), leading to the production of superoxide radical (O2*), hydrogen peroxide (H2O2) and hydroxyl radical (OH●−) [22]. The reactive oxygen species (ROS), mainly produced in chloroplasts, mitochondria, and peroxisomes [23], are harmful oxidants able to cause lipid peroxidation, enzyme inactivation, and degradation of pigments, proteins, and DNA [24] leading ultimately to cell apoptosis [25]. The control of highly reactive molecules of Chl and O2 is achieved by promoting energy dissipation mechanisms that prevent its formation (e.g., photoprotective pigments) and the expression of enzymatic and non-enzymatic antioxidants that scavenge the ROS already produced [13,24]. Therefore, the reinforcement of mechanisms dedicated to preventing ROS overproduction and/or its efficient scavenging is usually crucial to plant tolerance to a wide number of environmental constraints. That is also the case in Coffea spp., which shows a common antioxidative response to several stresses, such as drought [26,27,28,29], high irradiance [30], cold [24,31,32], and heat [33,34,35,36].
Coffee is one of the most world’s traded commodities and popular beverages, consumed by about one-third of the world’s population [37]. It is estimated that the coffee chain involves ca. 100–125 million people from cultivation to the final product for consumption [37,38], based on the production of ca. 25 million smallholder farmers [39], which represent about 60% of the coffee farms, usually of low income [40]. The world’s annual production has reached ca. 10 million tons in recent years [41], yielded from approximately 80 tropical countries, from South and Central America to Africa and Southwest Asia, extending from a latitude of 20–25° N in Hawaii down to 24° S in Brazil [42]. Among the identified 130 species of the Coffea genus [43], two species are responsible for almost all the world’s coffee production: C. arabica L. (arabica coffee) and C. canephora Pierre ex A. Froehner (robusta coffee) [42].
Coffee crop and yield, especially in C. arabica, are strongly influenced by climatic variability, particularly extreme temperatures and water deficit [44,45]. With the increase in global mean temperatures, the coffee industry might have to face serious challenges in the future, with negative consequences for the entire supply chain. Climate changes are expected to cause a reduction in coffee crop yields and in suitable land for coffee growth [46,47,48,49]. Traditionally, the optimal annual mean temperature range was stated as 18–21 °C for arabica cultivars [50]. In this way, it was reported that mean air temperatures above 23 °C could accelerate fruit ripening of arabica cultivars, which can cause bean quality loss, and seasonal high temperatures above 33 °C and dryer seasons can greatly reduce floral initiation and increase the production of abnormal reproductive structures, and flower abortion [51,52,53,54]. However, current Arabica cultivars can grow in marginal regions, such as in the northeast of Brazil, where the mean annual temperature can reach 25 °C [55], and elite cultivars can successfully withstand relatively high temperatures [12,34] to a greater extent than traditionally assumed in classical studies [56]. Furthermore, elevated air [CO2] (eCO2) was reported to play a key role in heat stress resilience in coffee genotypes, with the potential to offset some of the negative impacts of climate change [33,34,57]. Indeed, recent experiments showed that coffee can tolerate heat stress and maintain photosynthetic performance at temperatures up to 37/30 °C (day/night), especially under eCO2, and that under 42/34 °C, photosynthesis is greatly affected, but relevant photosynthetic activity is still maintained only under eCO2 [33,34].
In this context, the present work was undertaken to test the ability of new elite arabica coffee genotypes to cope with supra-optimal temperatures in the context of climate change, with a focus on the potential protective mechanisms (especially those associated with photo- and antioxidative action, and how these responses can be (or not) affected by eCO2. Biochemical and molecular approaches were used to study the effects of supra-optimal temperature under both ambient air [CO2] (aCO2) or eCO2 in terms of (a) carotenoids concentration, (b) cellular activity of antioxidant enzymes, and (c) expression of genes related to the antioxidant and other protective mechanisms. Furthermore, hybrid vigor (heterosis), a way to explore and increase the acclimation capabilities in crops with the progeny exhibiting traits that outperform their parentals [58], was also envisaged in a hybrid resulting from C. arabica Marsellesa × Geisha 3 cross.

2. Results

2.1. Carotenoids Evaluation

At the control temperature (25/20 °C), the single eCO2 exposure in Marsellesa altered the carotenoid composition, showing greater concentrations of several pigments, significantly for neoxanthin (50%), the sum of violaxanthin (V), antheraxanthin (A), and zeaxanthin (Z; V + A + Z, 64%), lutein (54%), total carotenoids (54%), and a tendency to greater values of (α + β) carotene (53%; Table 1). By contrast, individual carotenoids did not respond significantly to eCO2 in Geisha 3 and Hybrid plants.
Under aCO2, the single impact of temperature rising to 31/25 °C and then further to 37/28 °C led to a general increase of most carotenoids in the three genotypes, although significantly only in some cases, especially in Geisha 3 and Hybrid plants. That was reflected in maximal increases in total carotenoid concentration in Geisha 3 (76%), Hybrid (43%), both at 31/25 °C, and Marsellesa (40%) at 37/28 °C (the latter was not significant), always when compared to their control values.
In detail, maximal increases of neoxanthin and lutein were found in Geisha 3 at 31/25 °C (50% and 39%, respectively) and in the Hybrid at 37/28 °C (41% and 40%, in the same order). Always at 31/25 °C, Geisha 3 and Hybrid plants also showed maximal contents of α-carotene (105% and 78%), β-carotene (63% and 28%), and (α + β) carotene (76% and 43%), with the concomitant increase of (α/β)-carotene ratio. Notably, by 37/28 °C, both zeaxanthin and DEPS values were not significantly altered in none of the genotypes.
As the temperature reached the maximum value (42/30 °C), the carotenoid concentration declined in aCO2 plants from their maxima to values that usually did not differ from their controls at 25/20 °C, except for lutein in Geisha 3 plants that maintained an increased value, or violaxanthin that showed reduced values (all genotypes). Still, DEPS tended to greater values than at 25/20 °C, with rises in Geisha 3 (45%), Marsellesa (315%), and Hybrid leaves (98%). A strong decline was observed in carotenes pools, particularly in α-carotene, implicating a clear decline in the (α/β)-carotene ratio of all genotypes.
The plants grown under eCO2 submitted to temperature rise showed notable stability of the studied carotenoids, without significant modifications from 25/20 °C up to 37/28 °C (lutein) or even 42/30 °C (neoxanthin, zeaxanthin, V + A + Z, carotenes, total carotenoid) for the three genotypes. That also implicated the stability of DEPS values, even at 42/30 °C, although the (α/β)-carotene ratio tended to lower values in Geisha 3 and Marsellesa at that temperature.
Only a few significant differences were depicted between the two [CO2] conditions regarding the leaf xanthophyll concentration at maximal temperature. Noteworthy were the observations that, at 42/30 °C, the eCO2 Marsellesa plants showed greater concentrations of V + A + Z and, especially, lutein than their aCO2 counterparts, but such eCO2 superimposition reduced DEPS in all genotypes (significantly only in Hybrid) as compared with aCO2 plants. Additionally, at 42/30 °C, the eCO2 plants tended to have greater values of α-carotene (significant in Hybrid), β-carotene, (α + β) carotene (both significant in Marsellesa), and (α/β) carotene (significant in Hybrid).
Overall, during the recovery period (at 25/20 °C), most carotenoid concentrations returned to values that did not differ from the initial values, usually regardless of CO2 condition and genotype. That was the case from Rec4 onwards of neoxanthin (all genotypes), zeaxanthin (only by Rec14 for Hybrid plants), V + A + Z, α-carotene, β-carotene, and (α + β) carotene (except the Hybrid plants under aCO2 for the latter). In contrast, lutein and total carotenoids maintained increased levels by Rec4 in all genotypes under aCO2, and still by Rec14 in Geisha 3 and Hybrid plants, whereas α-carotene had reduced concentrations even by Rec14 in the three genotypes and both [CO2]. DEPS showed greater values than the control at 25/20 °C for Marsellesa and Hybrid plants both in Rec4 and Rec14.

2.2. Antioxidant Enzyme Activity

At control temperature, the single eCO2 exposure altered the activity of antioxidative enzymes, depending on the genotype and enzyme (Figure 1 and Figure 2). In Marsellesa, the potential activities of SOD (Figure 1) and GR (Figure 2) declined 49% and 58%, respectively, relative to their aCO2 plants, whereas APX and CAT were not affected. Geisha 3 plants showed an approximately doubled APX activity and ca. half of CAT, without changes in SOD and GR. Notably, all four enzymes were mostly insensitive to eCO2 in the Hybrid plants.
Under single 37/28 °C exposure, remarkable activity increases were observed for APX, by 95% (Geisha 3), 368% (Marsellesa) and 71% (Hybrid); for CAT, by 94% (Geisha 3), 153% (Marsellesa) and 122% (Hybrid); and for GR by 125% (Geisha 3) and 196% (Hybrid). Instead, SOD activity tended to decrease significantly only in the Hybrid plants, always as compared with their respective activity values at 25/20 °C and aCO2.
With further temperature increase to 42/30 °C, APX activity was severely depressed (Figure 1), whereas CAT showed values even greater (Geisha 3 and Hybrid) or unaltered (Marsellesa) as compared with those at 37/28 °C (Figure 2). At this harshest condition (42/30 °C), SOD activity continued to decline (except in the Hybrid), whereas GR values were mostly maintained in all genotypes when compared to the values under 37/28 °C.
The superimposition of eCO2 at 37/28 °C altered, in a few cases, the enzyme activities observed under aCO2. A clearer case was observed with CAT, whose activity decreased under eCO2 both at 37/28 °C and 42/30 °C in all genotypes. Additionally, APX also declined in Geisha 3 (42/30 °C), Marsellhesa and Hybrid (both at 37/28 °C). In contrast, SOD activity increased in Geisha 3 (by 63% at 42/30 °C), Marsellhesa and Hybrid (by 64% and 35%, respectively, both at 37/28 °C), although not showing differences to aCO2 at 42/30 °C for the last two genotypes. Marsellesa showed the lowest values among the three genotypes. Finally, GR activity was unchanged between CO2 conditions at 37/28 °C and 42/30 °C for the three genotypes, except for a decline at the harshest temperature in Geisha 3.
After 14 days of recovery (Rec14) at 25/20 °C, the aCO2 plants tended to approach the value observed at the beginning of the experiment (also at 25/20 °C). That was the case for all enzymes in Geisha 3 and Marsellesa. In the Hybrid plants, there were reduced activities of SOD and APX and greater values of CAT.
Still, by Rec14, the eCO2 plants showed a distinct pattern from their aCO2 counterparts. All genotypes showed lower SOD activity under eCO2 than at aCO2 by the end of the experiment (Figure 1), but for the other enzymes, a genotype-dependent situation was observed. In eCO2 plants, Geisha 3 showed a declined APX activity, in opposition to the rise in CAT. Marsellesa kept close APX activities between [CO2] conditions and a reduction of CAT under eCO2 (but always similar to the initial controls), whereas the Hybrid plants showed greater (130%) and lower (89%) values for APX and CAT, respectively. Finally, GR was mostly irresponsive to [CO2] by Rec14 in the studied genotypes, showing values close to those at the beginning of the trial (Figure 2).

2.3. Expression of Selected Genes Associated with Protective Roles

The single exposure to eCO2 at 25/20 °C did not significantly alter the expression of any of the studied genes, irrespective of genotype, in comparison to their aCO2 plant counterparts (Table 2).
Regarding the single temperature exposure, a moderate down-regulation impact was observed only for VDE2 at 37/28 and/or 42/30 °C, together with a total recovery under Rec14 for the three genotypes compared with the initial expression values at 25/20 °C. For all the other studied genes, considering both those encoding for antioxidative enzymes (CAT, the two CuSODs, and the three APX isoforms) and other protective proteins (HSP70, ELIP, Chape20, Chape60), the high temperature was the major driver of gene expression changes, promoting a strong up-regulation at 37/28 °C and a further rise at 42/30 °C, when the highest expression values were usually attained in the three genotypes. Notably, maximal gene expression was always found in Hybrid plants (aCO2, 42/30 °C), except for CAT (Geisha 3) and APXCyt (Marsellesa).
In general, the abundance of gene transcripts associated with antioxidative enzymes was the highest up-regulated in the three genotypes. For instance, the expression of genes encoding for Cu, Zn-SOD (CuSOD1, CuSOD2), APX (cytosolic enzyme APX, APXCyt; chloroplast APX, APXChl; stromatic APX, APXt+s), and CAT presented a common pattern of marked up-regulation at 42/30 °C. Among SOD, APX and CAT genes, APXCyt was the most strongly up-regulated one in Geisha 3 (70-fold) and, especially, in Marsellesa (104-fold), whereas in Hybrid plants, the greatest up-regulation was observed for CuSOD2 (55-fold; Table 2). CAT was always significantly up-regulated under heat (between 2-fold in Marsellesa and 6-fold in Geisha 3) but was the less up-regulated of this group of genes encoding for antioxidative enzymes. By Rec14, the transcripts abundance of all studied genes (but VDE) declined in comparison with 42/30 °C, but significantly higher values than the control were still found in all cases, mainly in the antioxidative enzymes (Table 2).
Under heat, eCO2 strongly attenuated the observed up-regulation under aCO2, for all studied genes and in the three genotypes. That eCO2 impact occurred at 37/28 °C (except for HSP70, ELIP, APXChl, APXt+s, and VDE in Geisha 3, and APXChl and VDE in Hybrid) and 42/30 °C. However, a significant up-regulation was still usually observed in eCO2 plants at supra-optimal temperatures when compared with their values at 25/20 °C, meaning that under eCO2, gene expression reinforcement still occurred, although to a lesser extent than at aCO2. Among the largest gene expression attenuations observed, CuSOD1, CuSOD2, and APXCyt stood out in the three genotypes, both under 37/28 °C and/or 42/30 °C. Such declines were frequently to values close to or lower than half (Table 2), with striking reductions of 88% (CuSOD2, Hybrid, 37/28 °C), 78% (APXCyt, Marsellesa, 37/28 °C), and 75% (APXCyt, Geisha 3, 42/30 °C) when compared with their respective aCO2 counterparts at the same temperature. Additionally, in Rec14, eCO2 plants still maintained lower expression values than the aCO2 plants but were closer to their controls, suggesting a better recovery to the initial status.

3. Materials and Methods

3.1. Plant Material, Growth Conditions and Experimental Design

For these experiments were used plants from Coffea arabica L. cv. Geisha 3, cv. Marsellesa and their hybrid (Geisha 3 × Marsellesa), which result from breeding efforts to find new cultivars (and in this case also their hybrid) to be used under shaded environments, and to better cope with the new climate conditions estimated to occur along this century. The applied experimental design was similar to that described in [34], with minor modifications. Following a completely randomized design, potted plants (6 to 8 per treatment) were grown in 20 L pots from the seedling stage until ca. two years of age in walk-in growth chambers (EHHF 10000; ARALAB, Albarraque, Portugal) under controlled environmental conditions of temperature (25/20 °C, day/night), irradiance (ca. 700–800 μmol m−2 s−1), air humidity RH (70%), and photoperiod (12 h), and either ambient (400 μL CO2 L−1, aCO2) or elevated (700 μL CO2 L−1, eCO2). For the entire experiment, the plants were kept under well-watered conditions (predawn water potential higher than −0.3 MPa), adequate mineral nutrient supply (provided as in [59]), and without restrictions as regards space for root growth, as judged by visual examination at the end of the experiment after removing the plants from pots.

3.2. Temperature Rise Implementation

Plants were submitted to a gradual temperature increase to allow them to express their potential acclimation capability. The temperature was raised from 25/20 °C (day/night) up to 42/30 °C, at a rate of 0.5 °C day−1 (of the diurnal temperature), with 5–7 days of stabilization at 31/25 °C, 37/28 °C, and 42/30 °C to allow for programmed plant material collection. Subsequently, the temperature was readjusted to 25/20 °C and plants were monitored over a recovery period of 4 (Rec4) and 14 (Rec14) days. The control conditions refer to the plants grown at 25/20 °C and aCO2.
All measurements were performed on newly matured leaves from the upper third part of the plant canopies, which were flash-frozen in liquid nitrogen and stored at −80 °C until analyses.
The carotenoid concentration and the enzyme activities were given per dry weight units (DW) since it is a more stable basis of expression due to the eventual change of leaf hydration status under high-temperature conditions. In this way, the relation between fresh weight (FW) and DW was obtained from the same leaves used for biochemical measurement, similarly to what is established for leaf relative water content (RWC) determinations in Coffea spp. [26]. For that, eight foliar discs of 0.5 cm2 each were punched from the leaves and FW was immediately determined, whereas DW was obtained after drying the discs at 80 °C for 48 h.

3.3. Carotenoids Evaluation

Carotenoids were assessed from three leaf discs (each of 0.5 cm2) from 4 to 6 plants per treatment, cut after 1.5–2 h of leaf exposure to diurnal illumination, flash frozen in liquid nitrogen, and stored at −80 °C until analysis. The leaf tissue homogenization and subsequent reversed-phase HPLC analysis were performed as described in [60] using an end-capped C18 5 µm Spherisorb ODS-2 column (250 × 4.6 mm, Waters, Milford, MA, USA). Carotenoid detection was performed at 440 nm in an HPLC system (Waters Alliance e2695, Milford, MA, USA) coupled with a diode-array detector (Waters 2996, Milford, MA, USA). Identification and quantification of each carotenoid were performed using specific standards. The de-epoxidation state, involving xanthophyll cycle components, was calculated as [DEPS = (zeaxanthin + 0.5 antheraxantin)/(violaxanthin + antheraxantin + zeaxanthin)].

3.4. Activity of Antioxidative Enzymes

Maximal cellular enzyme activities were assayed using 100 mg fresh weight (FW) of leaf tissue for the most important treatments (the enzyme activity assays were not performed for the 31/25 °C and Rec4 treatments), taken from 3 plants per treatment. All the procedures, from homogenization to enzyme activity measurements, were performed following [26], with some modifications. Briefly, 1 mL of buffer containing 200 mM Tris-HCl (pH 8), 10 mM MgCl2 6H2O, 30 mM β-mercaptoethanol, 4 mM DTT, 2% Triton X-100, “Complete cocktail EDTA” (2 pills) and 10% glycerol was used, with addition of 1% (1 mL) of polyvinylpolypyrrolidone (PVPP) to each sample in the homogenization phase. The samples were centrifuged (13,000× g, 20 min, 4 °C), and the supernatant was used to evaluate enzymatic activities.
Superoxide dismutase (SOD, EC 1.15.1.1) reaction mixture contained 20 mM adrenaline in 50 mM phosphate buffer (pH 7.8) and sodium carbonate buffer (pH 10.4) with EDTA 0.125 mM and 50 μM, and 50 μL of the enzyme extract in a final volume of 1 mL. The activity was spectrophotometrically assessed at 480 nm.
Ascorbate peroxidase (APX, EC 1.11.1.11) reaction mixture contained 20 mM ascorbate and 0.1 mM H2O2 in 50 mM phosphate buffer (pH 7.8) and 10 μL of the enzyme extract in a total volume of 1 mL. The sample reaction was assessed through the H2O2-dependent oxidation of ascorbate at 290 nm, using an extinction coefficient of 2.8 mM−1 cm−1 for calculations.
Glutathione reductase (GR, EC 1.6.4.2) reaction mixture contained 0.15 mM NADPH, 0.5 mM oxidized glutathione (GSSG), 3 mM MgCl2 in 50 mM phosphate buffer (pH 7.8), and 10 μL of enzyme extract in a total volume of 1 mL. The activity was evaluated through the NADPH oxidation rate at 340 nm, using an extinction coefficient of 6.22 mM−1 cm−1 for calculations.
Catalase (CAT, EC 1.11.1.6) reaction mixture contained 40 mM H2O2 in 50 mM phosphate buffer (pH 7.8) and 10 μL of the enzyme extract in a total volume of 1 mL; activity was evaluated through the rate of H2O2 consumption at 240 nm, using an extinction coefficient of 3.94 mM−1 cm−1.

3.5. Expression of Genes Associated with Antioxidant and Protective Molecules

Genes encoding antioxidant and other protective proteins were selected based on [26,33] for real-time qPCR studies, using malate dehydrogenase (MDH) and Ubiquitin-conjugating enzyme E2 (UBQ), which were found to be among the most stable pair of genes to be used as reference genes for the studied conditions of temperature and [CO2] [39]. All primer sequences are presented in Table 3.
Total RNA was isolated from 100 mg of frozen material taken from 3 plants per treatment and processed as described in [35], using the innuPREP Plant RNA Kit (Analytik Jena, Jena, Germany) following the manufacturer’s protocol. The intactness of the extracted RNA was verified by electrophoresis on a 1.5% agarose gel by evaluating the integrity of the 28S and 18S ribosomal RNA bands and the absence of smears. cDNA was synthesized from 1 µg total RNA using the SensiFASTTM cDNA Synthesis kit (Meridian BioScience, Cincinnati, OH, USA), according to the manufacturer’s recommendations. The presence of a single amplification product of the expected gene size was verified by electrophoresis on a 1.5% agarose gel. RT-qPCR reactions were prepared using the SensiFASTTM SYBR No-ROX kit (Meridian BioScience, Cincinnati, OH, USA) according to the manufacturer’s protocol. One negative was included for each primer pair, in which cDNA was replaced by water. Reactions were carried out in 96-well plates using a qTOWER 2.2 Thermal Cycler (Analytik Jena, Jena, Germany) using the following parameters: hot start activation of the Taq DNA polymerase at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s, elongation at 72 °C for 30 s. A melting curve analysis was performed at the end of the PCR run by a continuous fluorescence measurement from 55 °C to 95 °C with sequential steps of 0.5 °C for 15 s (single peaks were obtained). Three technical replicates were used for each biological replicate.

3.6. Statistical Analysis

Data were analyzed using two-way ANOVA (p < 0.05) to evaluate the differences between the two atmospheric [CO2] (aCO2 or eCO2) or between the different temperature and recovery treatments (25/20 °C, 31/25 °C, 37/28 °C, 42/30 °C, Rec4, Rec14), and their interaction, followed by Tukey’s HSD test for mean comparisons, except when otherwise stated. The ANOVA for each parameter was performed independently for each of the studied genotypes. For gene expression analysis, the relative expression ratio of each target gene was quantified based on its real-time PCR efficiencies and the crossing point (CP) difference of the unknown sample versus the control (25/20 °C, 400 μL CO2 L−1 air) within each genotype, as described in [33,39], followed by the same statistical procedure described above. Data were analyzed using Statistica, v8 (StatSoft, Tulsa, OK, USA).

4. Discussion

4.1. Photoprotective Pigments

4.1.1. Xanthophylls

Under the control temperature, eCO2 by itself did not significantly alter the level of most xanthophylls in Geisha 3 and Hybrid plants but promoted greater concentrations of several xanthophylls in Marsellesa (neoxanthin, lutein, the pool of V + A + Z involved in the xanthophyll cycle; Table 1), as also reported in other coffee genotypes [34], revealing its potential photoprotective capability in Marsellesa leaves, even in the absence of stressful conditions. By contrast, under aCO2, the rise of temperature to 37/28 °C promoted an increase in the concentration of several carotenoids (particularly neoxanthin and lutein) in all genotypes, although especially in Geisha 3 and Hybrid plants, as also reflected in a global reinforcement of total carotenoids. Still, both zeaxanthin and DEPS values were not significantly altered in all genotypes, which would be linked to the maintenance of the use of energy through photosynthesis at this temperature [12,34]. This was in line with the moderate rise of zeaxanthin and DEPS under 42/30 °C when the photochemical use of energy (and net photosynthesis) was strongly depressed (data not shown). Such rise in zeaxanthin (and DEPS) were also observed in C. arabica cv. Icatu and cv. IPR108 at 42/34 °C, irrespective of [CO2], when the photochemical use of energy was compromised [12,34], and plant acclimation (namely of photosystems, electron carriers, and chloroplast membranes) strongly depended on photoprotective thermal dissipation and antioxidative mechanisms [33]. The presence of adequate levels of xanthophylls, and especially zeaxanthin and lutein (but also of β-carotene), in the light-harvesting complexes (LHC), are associated with a higher capability of reducing excess excitation energy through thermal dissipation, thus preventing the formation of highly reactive molecules of oxygen and Chl [61,62].
Notably, the eCO2 plants showed mostly stable carotenoid values up to 37/28 °C or even 42/30 °C. This suggests a lower need for thermal dissipation when compared with aCO2 counterparts, likely associated with the maintenance of a greater photosynthetic functioning due to a greater CO2 availability at the chloroplast level and the associated lower energy excess. Furthermore, at 42/30 °C, the Marsellesa plants showed a better potential photoprotective capability due to greater concentrations of lutein and the pool of V + A + Z. Still, this was accompanied by a lowered DEPS value (as also in the other two genotypes) as compared with their aCO2 plants. Zeaxanthin was reported to rise (as well as DEPS) in coffee plants exposed to conditions that strongly depress the photochemical use of energy [26,32] since it is associated with a higher need for thermal dissipation and prevention of lipid peroxidation by removing the epoxy groups from the oxidized double bonds of thylakoid fatty acids [63,64]. Therefore, our findings suggest that under the imposed conditions, zeaxanthin was not needed in these plants, although we cannot discard that they were unable to convert violaxanthin into zeaxanthin through VDE action, both of which were suggested by the maintenance or down-regulation of VDE (Table 2). Notably, for Hybrid (regardless of [CO2]) and Marsellesa (aCO2) plants, the need for energy dissipation persisted by Rec4 since zeaxanthin concentration (and DEPS) increased in comparison with both 25/20 °C and 42/30 °C values. Furthermore, Geisha 3 plants showed a higher DEPS value at 42/30 °C, although associated with the maintenance of zeaxanthin and a declined V + A + Z pool, thus supporting the view of an incomplete ability of these genotypes to cope with heat at the xanthophyll cycle level.
Neoxanthin and lutein are found in the periphery of the LHC of photosystems, and they play important functions as they maintain the correct assembly and stability of antenna proteins [65]. In addition, the lutein-epoxide cycle and neoxanthin (as well as β-carotene) are quenchers of 3Chl* and 1O2, thus, scavenging these important lipoperoxidation initiators [66,67,68,69,70]. In fact, besides the structural contribution to the antenna complexes, neoxanthin can influence energy harvest, transfer, and dissipation in the photosystem, with implications for photoprotection, namely by increasing the efficiency of 3Chl* quenching by lutein, thus contributing to preventing ROS formation and the consequent photoinhibition [71]. Still, neoxanthin did not significantly differ between [CO2] treatments and was mostly stable within each [CO2] treatment except in Hybrid (increase by 37/28 °C under aCO2) and Geisha 3 plants (rise at 31/25 °C and 37/28 °C). By contrast, only the eCO2 plants of Marsellesa at 42/30 °C displayed a greater concentration of lutein (than their aCO2 counterparts) which likely strengthened the thermal dissipation protection of photosystems against photooxidation in those plants. In fact, the eCO2 positive impact on the performance of the photosynthetic apparatus and stress defenses was reported at physiological and molecular levels in studies involving other C. arabica and C. canephora genotypes, where a significant up-regulation of photosynthetic, antioxidant, and lipid metabolism genes and/or proteins was found under eCO2 [28,29,35]. That ultimately mitigated the harsh effects of drought [27,28,29] and heat [34,36], supporting the maintenance of higher photosynthetic performance under eCO2 in the studied coffee genotypes.

4.1.2. Carotenes

The α- and β-carotenes are accessory pigments found in the reaction centers and core antennae of PSI and PSII [72]. Besides the function of absorbing light (especially blue light), carotenes, and especially β-carotene, have important photoprotective functions. The latter has the ability to protect lipid components of membranes, and chlorophyll a from oxidation, quenching 1O2 and 3Chl* by forming triplet carotenes that dissipate energy through heat [31,73,74]. Furthermore, β-carotene protects the cytochrome b6f complex from photobleaching promoted by 1O2 [75], and decreased levels of this pigment in the reaction centers have been associated with higher vulnerability to photodamage [74]. The carotenoid biosynthesis pathway has been previously found to be significantly enriched in C. canephora cv. CL153 plants grown under eCO2 [35], although without a corresponding carotenoid rise [33]. Such lack of impact of the single exposure to eCO2 was also found in the present work, except in Marsellesa, which was the only genotype to present a significant rise (55%) in total carotenoids, together with rising tendencies of α- and β-carotenes (and a 53% rise for (α + β) carotene). Therefore, Marsellesa plants would have a better potential photoprotection capability (in addition to the already mentioned lutein significant rise), namely against 3Chl* and 1O2 [66,67,68,70].
Regarding the single temperature implementation, α- and/or β-carotenes tended to have greater concentrations at 31/25 °C and 37/28 °C, similarly to other pigments. That was accompanied by a tendency to higher (α/β) carotene ratios in all genotypes. However, Marsellesa plants were the only ones to show maximal concentrations of (α + β) carotenes at 37/28 °C, thus supporting a greater protective function at this moderately high temperature when the other two genotypes showed already a tendency to decline. However, at 42/30 °C, the α- and β-carotenes strongly declined (as compared to the values at 37/28 °C), especially the first, which was reflected in strong reductions in the (α/β) carotene ratios of all genotypes, as also found in other genotypes submitted to high temperatures [33]. Although the strong concomitant decline of β-carotene suggested that the photosynthetic apparatus was largely affected, the decrease in (α/β) carotene ratio was interpreted as reflecting a protective mechanism against the energy in excess under cold conditions in Coffea sp. [31]. This view agrees with the maintenance of lowered (α/β) carotene ratio values, even if β-carotene and (α + β) carotene values tended to recover (e.g., in Marsellesa) by Rec14, irrespective of genotype and [CO2]. Contrasting with aCO2 plants, there were remarkable stability of α-, β- and (α + β) carotenes in the eCO2 plants from 25/20 °C up to 42/30 °C, thus suggesting the maintenance of photosynthetic structures to which these pigments are associated, e.g., the photosystems. The decline in (α/β) carotene in Marsellesa at 42/30 °C could suggest a higher thermotolerance capability at the harshest temperature, in line with the finding of a greater potential functioning of the photosynthetic apparatus (evaluated through photosynthetic capacity, Amax—data not shown). However, in the present case, such (α/β) carotene decline resulted from a tendency to α-reduction and not from an increase in β-carotene (which was maintained), contrary to what was found in C. arabica cv. Icatu under heat stress, where β-carotene showed its maximal values under 42/34 °C as compared to their initial values at 25/20 °C [33,34]. Nevertheless, as compared with their aCO2 counterparts, under 42/30 °C, only the eCO2 plants of Marsellesa displayed simultaneously greater concentrations of β-carotene, lutein, and (V + A + Z), thus denoting a greater potential for photoprotection of the photosynthetic apparatus acting in a complementary way [33].

4.2. Antioxidant Enzyme Responses and the Associated Gene Expression

The studied enzymes play important roles in oxidative stress control since they react with several ROS, such as O2●− (SOD) and H2O2 (APX, CAT). The ROS control is greatly accomplished, namely, through the ascorbate-glutathione cycle, with the participation of enzymes such as SOD, APX, and GR, complemented with extra-chloroplast scavenging systems, such as CAT [25,67,76].
Although the single effect of eCO2 on the antioxidant enzymes was genotype- and enzyme-dependent, the studied enzyme activities were always maintained or reduced, as compared with the aCO2 plant counterparts, with the only exception of APX in Geisha 3, which showed a significant rise. In fact, in the Hybrid plants, no significant changes were observed for all these enzymes, whereas in Marsellesa, SOD and GR activity values declined (Figure 1 and Figure 2). This low responsiveness to eCO2 was in accordance with the absence of significant expression changes in SODs, APXs, and CAT (Table 2), showing that under non-stressed conditions, the eCO2 had a low, if any, impact on the expression of these genes. This was also in line with the minor changes detected in the primary metabolite profile of C. canephora cv. CL153 and C. arabica cv. Icatu genotypes are grown under eCO2 and control (well-watered and 25 °C) conditions [77]. Our present results also revealed a genotype-dependent response to eCO2 among C. arabica genotypes but contrasted with previous findings in the above-mentioned genotypes where it was highlighted that eCO2 promoted a significant up-regulation of a considerable number of genes related to photosynthetic, antioxidant, and lipid metabolism. These supported the maintenance of increased photosynthetic potential promoted by eCO2 and the absence of photosynthesis down-regulation [35]. In fact, single eCO2 promoted moderate responsiveness regarding the antioxidative response, which was much lower than the one felt under drought [78] or heat constraints [28,29,36] in those same C. canephora and C. arabica genotypes.
Contrasting with the single eCO2 impact, the single exposure to supra-optimal temperatures was a strong driver of response since it greatly promoted changes in the activity of APX, CAT, and GR (although not of SOD; Figure 1 and Figure 2) and up-regulated genes associated with the antioxidant enzymes (CAT, CuSODs, APXs; Table 2) at 37/28 °C. CAT and APX activities increased in the three genotypes under aCO2, reinforcing the potential for H2O2 control and reflecting a clear response toward the acclimation of the three genotypes. This agrees with the increases in the activity of APX, GR, and CAT under aCO2 in C. canephora cv. CL153, under eCO2 of GR and CAT in C. arabica cv. Icatu, as well as of Cu, Zn-SOD and CAT in C. arabica cv. IPR108 up to 37 °C [33]. In fact, thermotolerance can be improved by up-regulating gene expression and protein levels of ROS-scavenging enzymes [79,80]. Furthermore, the key protective role of the antioxidant defense system in coffee plants was previously reported to increase under several environmental stress conditions. For instance, Cu, Zn-SOD, and APX activities were enhanced in some coffee genotypes subjected to a gradual cold treatment [24] since an efficient ROS control is crucial to the acclimation response of C. arabica and C. canephora cultivars exposed to single and combined drought and cold conditions [26]. As stated above, our findings are consistent with the strong up-regulation of genes coding for CAT and APX enzymes at 37/28 °C, which was greater under aCO2 than under eCO2, both for the enzyme activity and for gene expression. On the other hand, SOD activity tended to decline (significantly in Hybrid plants at 37/28 °C), although the expression of SOD genes was markedly up-regulated. In fact, although they were often coherent, transcript level changes of genes coding for antioxidant enzymes were not always fully in line with the enzyme’s activity pattern. The notion that gene expression does not always perfectly follow biochemical patterns has been previously mentioned in other studies [26,28,33]. For example, at the two highest temperatures, CuSOD1 and CuSOD2 were overexpressed in the three genotypes and, to a much greater extent, under aCO2 than under eCO2. This contrasted with the absence of rises (or even decline) of enzyme activity in most cases, and even with the greater activity at 37/28 °C (Marsellesa and Hybrid) and 42/30 °C (Geisha 3) under eCO2 (Figure 1), what can be justified by post-transcriptional and post-translational mechanisms regulating protein synthesis and enzyme functional conformation. This can greatly alter the relation between transcription levels and the biochemical results (e.g., of enzyme activities), thus reinforcing the need for data integration of complementary transcript and other molecular profiling, physiological and biochemical studies to have a clear picture of the real plant response to stress [36].
The difference between enzyme activity and gene expression was particularly striking at 42/30 °C, as also found for chloroplast APX activity and APXChl expression in C. canephora cv. Conilon [33]. Gene expression associated with antioxidant enzymes showed their maximal absolute values (CAT, CuSODs, APXs) at the highest temperature when the enzyme activities showed quite different and variable impacts. In fact, the activities of GR and CAT were mostly maintained, and the one of APX declined in all genotypes, whereas SOD showed different variations in the genotypes (declined in Hybrid and Marsellesa; maintained in Hybrid), compared to the values at 37/28 °C. Noteworthy is the common response regarding all genotypes and both [CO2] (although greater in aCO2) at this extreme temperature regarding the activity of CAT and its gene expression. The complementary ability to control the oxidative stress promoted by H2O2 through CAT reinforcement could be of particular importance due to the concomitant severe decline of cellular APX activity in all genotypes in both [CO2] conditions. These findings confirm the high heat sensitivity of APX found in Coffea spp. since it was the greatest negatively affected enzyme under 42 °C [33]. Furthermore, it points to a change of H2O2 control from chloroplast APX [33] or other cellular APXs (Figure 1) until 37/28 °C to an extra-chloroplast control through CAT (which is predominantly located in mitochondria, peroxisomes, and glyoxissomes) at higher temperatures (42 °C). This is of recognized great importance since H2O2 is capable of diffusing passively across membranes, turning the extra chloroplastic scavenging systems into important H2O2 detoxification pathways [24,67,81,82].
Regarding GR, the higher (Geisha 3 and Hybrid) or stable (Marsellesa) activity at the two highest temperatures will contribute to regenerating GSH and indirectly ascorbate in the ascorbate-glutathione cycle [67,83,84]. In most cases, a significant up-regulation both at 37/28 °C and 42/30 °C was observed in eCO2 plants, as compared with their values at 25/20 °C. However, under such supra-optimal temperatures, the eCO2 greatly reduced the transcript abundance of CAT, CuSODs, and APXs, frequently below 50%, with striking attenuations in some cases (e.g., to 12% in CuSOD2, Hybrid, 37/28 °C), compared with their aCO2 counterparts. Notably, among the studied enzymes, the activity of CAT was the best example of an eCO2-induced down-regulation in the three genotypes (Figure 2). Similarly, the activity of APX also declined in Geisha 3 (42/30 °C), Marsellhesa, and Hybrid (both at 37/28 °C). Higher gene expression and enzyme activity under aCO2 (than at eCO2) suggests a greater presence of ROS and, therefore, a higher need to control them, namely of H2O2, which is a known signaling molecule that also triggers the expression of genes encoding its scavenging enzymes [82,85]. The relaxation of part of the antioxidant system (considering both the activity of some enzymes and the gene expression of this type of enzymes) under eCO2 can be interpreted as reflecting a lower need for a robust antioxidant system [33,86]. That is a consequence of the presence of higher C-assimilation associated with greater photochemical use of energy (data not shown [34]) and minor photorespiration, the latter directly decreasing H2O2 production [87,88]. This ultimately reduces the energy and H2O2 pressure on the photosynthetic apparatus, always when compared with aCO2 plants. Additionally, Geisha 3 plants under eCO2 showed a greater SOD activity than that of aCO2 plants, although with a lower gene expression. The overexpression of genes coding for Cu, Zn-SOD, and greater SOD and APX activities has been associated with a greater tolerance to oxidative stress in transgenic tobacco (Nicotiana tabacum L.) [89] since a greater SOD activity indicates a stronger control of superoxide radicals, although with an increase in H2O2 production that could be controlled through APX and CAT action. The antioxidant response under eCO2 and its potential mitigating effect under stress conditions have been addressed in other species. The wide variety of obtained results showed not only a strong species-dependency but also varying as well between different cultivars, as reported in this study. For instance, when submitted to heat and drought stress, Arabidopsis thaliana plants showed high levels of ascorbate and CAT activity under eCO2 [90], whereas in soybean (Glycine max (L.) Merr.) declines in SOD, CAT, APX, and GR activities were observed [91], and in alfalfa (Medicago sativa L. cv. Aragón) reductions of antioxidant molecules and CAT activity was also reported [86].
After the recovery period (Rec14), with very few exceptions (e.g., CAT in Hybrid under aCO2 and in Geisha 3 under eCO2), the activity of the antioxidative enzymes declined in comparison with the values observed at 42/30 °C (or were maintained when such values were already similar to controls) regardless of [CO2] conditions. That was fully in line with strong declines in transcript abundance of CAT, SODs, and APXs, thus approaching the initial expression levels under control. However, under aCO2, a higher expression of these genes was maintained when compared with eCO2. This pattern was particularly evident for CuSOD2 in Marsellesa and Hybrid and the APX genes in the three genotypes, which points out that a greater need for ROS scavenging is still present in aCO2 plants 2 weeks after the end of stress exposure.

4.3. Expression of Genes Associated with Other Protective Molecules

Besides the antioxidant enzymes and photoprotective pigments, other protective molecules were assessed through gene expression studies. These molecules are reported to have crucial roles in the maintenance of cellular homeostasis under several environmental stresses, including heat stress [92,93]. Transcript levels of protective molecules, other than the antioxidative enzymes discussed above, i.e., chaperonins 20 and 60 (Chape20 and Chape60), early light-inducible protein (ELIP), and 70 kD Heat Shock Proteins (HSP70s), showed a similar pattern of variation. These confirmed (1) an absence of response to the single exposure to eCO2 in the expression of these genes in the three genotypes (similarly to the findings of [33]), in line with the results of the genes associated with the antioxidative enzymes; (2) a clear overexpression under single heat conditions, with a maximal accumulation of transcripts at 42/30 °C (although similar to the values at 37/28 °C in a few cases) for both aCO2 and eCO2, but (3) always with greater values under aCO2, especially in the Hybrid plants. (4) A subsequent transcriptional decline by Rec14 was observed, although maintaining values above those under the initial control conditions under aCO2. Regarding the specific roles of the proteins encoded by these genes, chaperonins ensure the correct folding of new proteins, especially plastid proteins (e.g., RuBisCO), thus playing an important role in heat stress tolerance [94,95,96]. ELIPs are found in thylakoid membranes and protect plants under different environmental stresses since they can participate in the antioxidative stress response by dissipating excess energy and preventing the formation of radicals [97,98,99]. As for HSP70s, although in this study, the maximum transcript accumulation was found at 42/30 °C, the greatest abundance of the protein was previously found at 37 °C [33]. These proteins are considered one of the most important protective molecules in plant responses to stress [95,100,101]. Furthermore, previous studies in Coffea spp. showed that the HSP70 protein synthesis is among the earlier responses to high temperatures [33], but also to moderate and severe drought, its presence further amplified under the superimposition with eCO2 [29]. In the present study, a lower HSP70 expression under eCO2 might also point to a lower need for stress protection and enhanced thermotolerance in these coffee plants since the up-regulation of HSP70 genes and the greater presence of this protein are usually found under stress conditions [36,95]. Furthermore, HSP70s are involved, among other roles, in PSII repair, and a positive correlation between the expression of the gene encoding for APX and heat shock transcription factors (HSFs) was reported in transgenic plants of Arabidopsis under heat stress [102]. As terminal components in the signal transduction chain triggered by heat stress, HSFs bind to the heat shock elements (HSEs) involved in downstream heat-inducible genes, playing a central role in the heat response stress [103]. Thus, a greater presence of HSP70 could also contribute to protecting coffee plants from oxidative stress. Overall, the lower gene expression of these protective molecules (HSP70, ELIP, Chape20; Chape60) under eCO2 plants when compared with their aCO2 counterparts reinforces the suggestion of a lower need for protecting photosynthetic components from photoinhibition due to increased use of energy through photochemical processes (and lower photorespiration rate), as reflected in the observed photosynthetic performance under eCO2 [34,53], which is the better photoprotective mechanism against the build-up of energy overpressure in the chloroplast structures [34].
Our findings highlight that, although, with similar patterns of response, a genotype-dependent response to heat and/or eCO2 was clear, both among the C. arabica genotypes studied here or regarding previously studied ones where a stronger response relative to protective molecules (e.g., HSP70) was observed [27,36]. Such relevant differences were also found between C. arabica and C. canephora genotypes [28] and strongly highlight the need to search for thermotolerance biomarkers to be used in breeding programs [54]. Also, some “hybrid vigor” might occur in the studied Hybrid plants when compared to their parental genotypes. This was supported by the greatest responsiveness of all of the studied genes associated with proteins linked to protective roles. Still, that was clear only in aCO2 plants at 42/30 °C, which might also suggest a greater need for protective mechanisms, thus needing further studies to understand if this wide up-regulation configures a greater vigor or, by opposition, a stronger sensitivity to the imposed conditions. Both issues regarding the genotype-dependent response to heat and/or eCO2 and the “hybrid vigor” potential strongly advise the implementation of accurate breeding and selection programs to get new coffee genotypes. These, together with the use of adequate crop management practices, such as agroforestry [40,104], will be decisive in guaranteeing the environmental and economic sustainability of this crop.

5. Conclusions

Overall, eCO2 alone barely altered most protective components as compared with aCO2. Most xanthophylls were maintained in Geisha 3 and Hybrid plants, but Marsellesa tended to rise the concentration of neoxanthin, lutein, the pool of V + A + Z, (α + β) carotene, and total carotenoids, improving its photoprotective ability. The enzyme activities did not increase upon the single effect of eCO2 (with the exception of APX in Geisha 3), in line with the absence of significant modifications of genes associated with antioxidant enzymes and other protective proteins, always relative to aCO2 plant counterparts.
Temperature was the main driver of plant response at 37/28 °C and 42/30 °C., At 37/28 °C several carotenoids (particularly neoxanthin and lutein) increased in all genotypes, whereas at 42/30 °C a moderate increase of zeaxanthin and DEPS was found, likely contributing to preventing the formation of highly reactive molecules of O2 and Chl when the photochemical use of energy would be quite depressed. Marsellesa showed greater additional carotenoids photoprotection at 37/28 °C than the other genotypes, including maximal (α + β) carotene concentration, although the latter declined in all genotypes at 42/30 °C.
With the exception of VDE (down-regulated with heat), all genes encoding for antioxidative enzymes (CAT, CuSODs, APX) or other protective proteins (HSP70, ELIP, Chape20, Chape60), exhibited a high responsiveness to single heat in all genotypes, with a strong up-regulation at 37/28 °C. This was usually even greater at 42/30 °C, with the genes associated with antioxidative enzymes showing the greatest transcripts abundance. Accordingly, 37/28 °C greatly promoted the activity of APX and CAT in all genotypes (likely controlling H2O2 presence), and of GR (except in Marsellesa), but not of SOD (that tended to decline despite the large increase of SODs transcripts). CAT activity deserves a special mention since it increased even at 42/30 °C, thus compensating for the strong APX activity decline at this temperature in all genotypes. An increased potential thermotolerance could arise also through the reinforcement of HSP70, ELIP, Chape20, and Chape60 molecules, as supported by a large up-regulation of their associated genes. Hybrid plants showed the greatest gene up-regulation of most genes under 42/30 °C.
In contrast with the low responsiveness to single eCO2 exposure, the superimposition with high temperatures revealed an interaction between heat and eCO2. The eCO2 plants showed mostly stable carotenoid values up to 37/28 °C or even 42/30 °C, but only Marsellesa plants denoted greater photoprotective capabilities at 42/30 °C, through greater concentrations of lutein, V + A + Z, and β-carotene, as compared their aCO2 plants. The eCO2 attenuated the gene up-regulation observed in aCO2 plants under heat and lower lowered the antioxidative system (CAT activity is the best example), pointing to a lesser need for ROS control (e.g., H2O2) supported by the persistence of photochemical use of energy and low photorespiration in eCO2 plants.
An incomplete recovery by Rec14 was suggested in the Hybrid and Marsellesa (regardless of [CO2]) due to greater zeaxanthin (and DEPS) values than in control, reflecting the persistence of a thermal dissipation need. Although most antioxidant enzyme activities declined towards their initial values, the partial recovery in all genotypes was further pointed out by the maintenance of up-regulation of all genes, usually much greater under aCO2 than in eCO2 counterparts, what denoted a better/faster recovery under eCO2. Still, higher levels of antioxidant components (molecules and gene expression) in aCO2 plants can also be seen as a protection strategy, allowing the plants to better endure new stress events, whereas, in eCO2 counterparts, such a role could be performed by the greater photochemical use of energy.
Altogether, C. arabica plants responded to heat and/or eCO2 in a genotype-dependent manner, with a greater acclimation potential in Marsellesa. Heat was the main response driver for the addressed protective molecules and genes, whereas eCO2 alone did not greatly altered plant status but usually attenuated the heat response, likely supported by a greater use of energy through photochemistry. The importance of the acclimation process and their responsiveness turn these molecules/genes useful biomarkers to breeding and selection programs, which should also explore the heterosis advantages that might arise from select hybrid crosses. Together with adequate management practices, these can help this crop to thrive under global warming conditions.

Author Contributions

Conceptualization, A.I.R.-B. and J.C.R.; Data curation, I.M., M.J.S. and A.I.R.-B.; Formal analysis, G.V., I.M., A.P.R., S.M., A.E.L., M.C.S., M.J.S., F.C.L., F.M.D., A.I.R.-B. and J.C.R.; Funding acquisition, F.C.L., F.M.D., A.I.R.-B. and J.C.R.; Investigation, G.V., I.M., A.P.R., S.M., A.E.L., M.C.S., M.J.S., F.C.L., F.M.D., A.I.R.-B. and J.C.R.; Methodology, I.M., A.P.R., S.M., A.E.L., M.C.S., M.J.S. and A.I.R.-B.; Project administration, A.I.R.-B. and J.C.R.; Resources, M.J.S., A.I.R.-B. and J.C.R.; Supervision, I.M., A.P.R., S.M., A.E.L., F.C.L., A.I.R.-B. and J.C.R.; Validation, I.M., A.P.R., S.M., A.E.L., A.I.R.-B. and J.C.R.; Visualization, G.V., I.M., A.P.R., S.M., A.E.L. and J.C.R.; Writing—original draft, G.V., I.M., A.E.L. and J.C.R.; Writing—review & editing, G.V., I.M., A.P.R., S.M., A.E.L., M.C.S., M.J.S., F.C.L., F.M.D., A.I.R.-B. and J.C.R. All authors have read and agreed to the published version of the manuscript.

Funding

The research was made in collaboration with the Instituto Superior de Agronomía (ISA), University of Lisbon, thanks to a fellowship from the ERASMUS+ program. The work received funding support from the European Union’s Horizon 2020 (H2020) research and innovation program (grant agreement No. 727934, project BreedCAFS—Breeding Coffee for Agroforestry Systems, www.breedcafs.eu), and from national funds from Fundação para a Ciência e a Tecnologia, I.P. (FCT), Portugal, through the project PTDC/ASP-AGR/31257/2017, through the Scientific Employment Stimulus—Individual Call (CEEC Individual)—2021.01107.CEECIND/CP1689/CT0001 (IM), and through the research units UIDB/00239/2020 (CEF) and UIDP/04035/2020 (GeoBioTec). FMD acknowledges research fellowships granted by the Foundation for Research Assistance of Minas Gerais State, Brazil (FAPEMIG, Project CRA-RED-00053-16; APQ01512-18).

Data Availability Statement

Data is contained within the article.

Acknowledgments

Coffee plants (from genotypes Geisha, Marsellesa, and their corresponding hybrid) were provided by Hervé Etienne (Cirad-UMR DIADE, France) in the framework of the BreedCAFS project.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Lesk, C.; Rowhani, P.; Ramankutty, N. Influence of extreme weather disasters on global crop production. Nature 2016, 529, 84–87. [Google Scholar] [CrossRef]
  2. Forster, P.; Ramaswamy, V.; Artaxo, P.; Berntsen, T.; Betts, R.; Fahey, D.W.; Haywood, J.; Lean, J.; Lowe, D.C.; Myhre, G.; et al. Changes in atmospheric constituents and in radiative forcing. In Climate Change 2007: The Physical Science Basis; Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change; Solomon, S., Qin, D., Manning, M., Chen, Z., Marquis, M., Averyt, K.B., Tignor, M., Miller, H.L., Eds.; Cambridge University Press: Cambridge, UK; New York, NY, USA, 2007. [Google Scholar]
  3. IPCC. Climate Change 2007: The physical science basis. In Summary for Policymakers; Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change; Solomon, S., Qin, D., Manning, M., Chen, Z., Marquis, M., Averyt, K.B., Tignor, M., Miller, H.L., Eds.; Cambridge University Press: Cambridge, UK; New York, NY, USA, 2007. [Google Scholar]
  4. IPCC. Summary for Policymakers. In Climate Change 2021: The Physical Science Basis; Contribution of Working Group I to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change; Masson-Delmotte, V., Zhai, P., Pirani, A.S., Connors, L., Péan, C., Berger, S., Caud, N., Chen, Y., Goldfarb, L., Gomis, M.I., et al., Eds.; Cambridge University Press: Cambridge, UK, 2021. [Google Scholar]
  5. Pais, I.P.; Reboredo, F.H.; Ramalho, J.C.; Pessoa, M.F.; Lidon, F.C.; Silva, M.M. Potential impacts of climate change on agriculture—A review. Emir. J. Food Agric. 2020, 32, 397–407. [Google Scholar] [CrossRef]
  6. FAO. How to Feed the World in 2050. Synthesis Report. 2009. Available online: http://www.fao.org/fileadmin/templates/wsfs/docs/expert_paper/How_to_Feed_the_World_in_2050.pdf (accessed on 1 October 2021).
  7. FAO. Looking Ahead in World Food and Agriculture: Perspectives to 2050; Conforti, P., Ed.; Food and Agriculture Organization: Rome, Italy, 2011. [Google Scholar]
  8. FAO. The State of Food and Agriculture Climate Change, Agriculture and Food Security; Food and Agriculture Organization: Rome, Italy, 2016. [Google Scholar]
  9. Mathur, S.; Agrawal, D.; Jajoo, A. Photosynthesis: Response to high temperature stress. J. Photochem. Photobiol. B Biol. 2014, 137, 116–126. [Google Scholar] [CrossRef]
  10. Peer, L.A.; Dar, Z.A.; Lone, A.A.; Bhat, M.Y.; Ahamad, N. High temperature triggered plant responses from whole plant to cellular level. Plant Physiol. Rep. 2020, 25, 611–626. [Google Scholar] [CrossRef]
  11. Scotti-Campos, P.; Pais, I.P.; Ribeiro-Barros, A.I.; Martins, L.D.; Tomaz, M.A.; Rodrigues, W.P.; Campostrini, E.; Semedo, J.N.; Fortunato, A.S.; Martins, M.Q.; et al. Lipid profile adjustments may contribute to warming acclimation and to heat impact mitigation by elevated [CO2] in Coffea spp. Environ. Exp. Bot. 2019, 167, 103856. [Google Scholar] [CrossRef]
  12. Dubberstein, D.; Lidon, F.C.; Rodrigues, A.P.; Semedo, J.N.; Marques, I.; Rodrigues, W.P.; Gouveia, D.; Armengaud, J.; Semedo, M.C.; Martins, S.; et al. Resilient and sensitive key points of the photosynthetic machinery of Coffea spp. to the single and superimposed exposure to severe drought and heat stresses. Front. Plant Sci. 2020, 11, 1049. [Google Scholar] [CrossRef]
  13. Liu, H.L.; Lee, Z.X.; Chuang, T.W.; Wu, H.C. Effect of heat stress on oxidative damage and antioxidant defense system in white clover (Trifolium repens L.). Planta 2021, 254, 103. [Google Scholar] [CrossRef]
  14. Hassan, M.U.; Chattha, M.U.; Khan, I.; Chattha, M.B.; Barbanti, L.; Aamer, M.; Iqbal, M.M.; Nawaz, M.; Mahmood, A.; Ali, A.; et al. Heat stress in cultivated plants: Nature, impact, mechanisms, and mitigation strategies—A review. Plant Biosyst. Int. J. Deal. All Asp. Plant Biol. 2021, 155, 211–234. [Google Scholar] [CrossRef]
  15. Szymańska, R.; Ślesak, I.; Orzechowska, A.; Kruk, J. Physiological and biochemical responses to high light and temperature stress in plants. Environ. Exp. Bot. 2017, 139, 165–177. [Google Scholar] [CrossRef]
  16. Nash, D.; Miyao, M.; Murata, N. Heat inactivation of oxygen evolution in Photosystem II particles and its acceleration by chloride depletion and exogenous manganese. BBA Bioenerg. 1985, 807, 127–133. [Google Scholar] [CrossRef]
  17. Ivanov, A.G.; Velitchkova, M.Y.; Allakhverdiev, S.I.; Huner, N.P.A. Heat stress-induced effects of photosystem I: An overview of structural and functional responses. Photosynth. Res. 2017, 133, 17–30. [Google Scholar] [CrossRef]
  18. Crafts-Brandner, S.J.; Salvucci, M.E. Rubisco activase constrains the photosynthetic potential of leaves at high temperature and CO2. Proc. Natl. Acad. Sci. USA 2000, 97, 13430–13435. [Google Scholar] [CrossRef] [PubMed]
  19. Ainsworth, E.A.; Rogers, A. The response of photosynthesis and stomatal conductance to rising [CO2]: Mechanisms and environmental interactions. Plant Cell Environ. 2007, 30, 258–270. [Google Scholar] [CrossRef] [PubMed]
  20. Lambers, H.; Chapin, F.S., III; Pons, T.L. Plant Physiological Ecology, 2nd ed.; Springer: New York, NY, USA, 2008. [Google Scholar] [CrossRef]
  21. Rodrigues, W.P.; Silva, J.R.; Ferreira, L.S.; Filho, J.A.M.; Figueiredo, F.A.M.M.A.; Ferraz, T.M.; Bernado, W.P.; Bezerra, B.S.; de Abreu, D.P.; Cespom, L.; et al. Stomatal and photochemical limitations of photosynthesis in coffee (Coffea spp.) plants subjected to elevated temperatures. Crop Pasture Sci. 2018, 69, 317–325. [Google Scholar] [CrossRef]
  22. Foyer, C.H.; Noctor, G. Redox regulation in photosynthetic organisms: Signaling, acclimation, and practical implications. Antioxid. Redox Signal. 2009, 11, 861–905. [Google Scholar] [CrossRef]
  23. Del Río, L.A. ROS and RNS in plant physiology: An overview. J. Exp. Bot. 2015, 66, 2827–2837. [Google Scholar] [CrossRef]
  24. Fortunato, A.S.; Lidon, F.C.; Batista-Santos, P.; Leitão, A.E.; Pais, I.P.; Ribeiro, A.I.; Ramalho, J.C. Biochemical and molecular characterization of the antioxidative system of Coffea sp. under cold conditions in genotypes with contrasting tolerance. J. Plant Physiol. 2010, 167, 333–342. [Google Scholar] [CrossRef]
  25. Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef]
  26. Ramalho, J.C.; Rodrigues, A.P.; Lidon, F.C.; Marques, L.M.C.; Leitão, A.E.; Fortunato, A.S.; Pais, I.P.; Silva, M.J.; Scotti-Campos, P.; Lopes, A.; et al. Stress cross-response of the antioxidative system promoted by superimposed drought and cold conditions in Coffea spp. PLoS ONE 2018, 13, e0198694. [Google Scholar] [CrossRef]
  27. Semedo, J.N.; Rodrigues, A.P.; Lidon, F.C.; Pais, I.P.; Marques, I.; Gouveia, D.; Armengaud, J.; Martins, S.; Semedo, M.C.; Silva, M.J.; et al. Intrinsic non-stomatal resilience to drought of the photosynthetic apparatus in Coffea spp. can be strengthened by elevated air CO2. Tree Physiol. 2021, 41, 708–727. [Google Scholar] [CrossRef]
  28. Marques, I.; Gouveia, D.; Gaillard, J.-C.; Martins, S.; Semedo, M.C.; Lidon, F.C.; DaMatta, F.M.; Ribeiro-Barros, A.I.; Armengaud Ramalho, J.C. Next-generation proteomics reveals a greater antioxidative response to drought in Coffea arabica than in Coffea canephora. Agronomy 2022, 12, 148. [Google Scholar] [CrossRef]
  29. Marques, I.; Rodrigues, A.P.; Gouveia, D.; Lidon, F.C.; Martins, S.; Semedo, M.C.; Gaillard, J.-C.; Pais, I.P.; Semedo, J.N.; Scotti-Campos, P.; et al. High-resolution shotgun proteomics reveals that increased air [CO2] amplifies the acclimation response of Coffea species to drought regarding antioxidative, energy, sugar, and lipid dynamics. J. Plant Physiol. 2022, 276, 153788. [Google Scholar] [CrossRef] [PubMed]
  30. Ramalho, J.C.; Campos, P.S.; Teixeira, M.; Nunes, M.A. Nitrogen dependent changes in antioxidant system and in fatty acid composition of chloroplast membranes from Coffea arabica L. plants submitted to high irradiance. Plant Sci. 1998, 135, 115–124. [Google Scholar] [CrossRef]
  31. Ramalho, J.C.; Quartin, V.L.; Leitão, E.; Campos, P.S.; Carelli, M.L.C.; Fahl, J.I.; Nunes, M.A. Cold acclimation ability and photosynthesis among species of the tropical Coffea genus. Plant Biol. 2003, 5, 631–641. [Google Scholar] [CrossRef]
  32. Batista-Santos, P.; Lidon, F.C.; Fortunato, A.; Leitão, A.E.; Lopes, E.; Partelli, F.; Ribeiro, A.I.; Ramalho, J.C. The impact of cold on photosynthesis in genotypes of Coffea spp.–Photosystem sensitivity, photoprotective mechanisms and gene expression. J. Plant Physiol. 2011, 168, 792–806. [Google Scholar] [CrossRef]
  33. Martins, M.Q.; Rodrigues, W.P.; Fortunato, A.S.; Leitão, A.E.; Rodrigues, A.P.; Pais, I.P.; Martins, L.D.; Silva, M.J.; Reboredo, F.H.; Partelli, F.L.; et al. Protective response mechanisms to heat stress in interaction with high [CO2] conditions in Coffea spp. Front. Plant Sci. 2016, 7, 947. [Google Scholar] [CrossRef]
  34. Rodrigues, W.P.; Martins, M.Q.; Fortunato, A.S.; Rodrigues, A.P.; Semedo, J.N.; Simões-Costa, M.C.; Pais, I.P.; Leitão, A.E.; Colwell, F.; Goulao, L.; et al. Long-term elevated air [CO2] strengthens photosynthetic functioning and mitigates the impact of supra-optimal temperatures in tropical Coffea arabica and C. canephora species. Glob. Chang. Biol. 2016, 22, 415–431. [Google Scholar] [CrossRef]
  35. Marques, I.; Fernandes, I.; David, P.H.C.; Paulo, O.S.; Goulao, L.F.; Fortunato, A.S.; Lidon, F.C.; DaMatta, F.M.; Ramalho, J.C.; Ribeiro-Barros, A.I. Transcriptomic leaf profiling reveals differential responses of the two most traded coffee species to elevated [CO2]. Int. J. Mol. Sci. 2020, 21, 9211. [Google Scholar] [CrossRef]
  36. Marques, I.; Fernandes, I.; Paulo, O.S.; Lidon, F.C.; DaMatta, F.M.; Ramalho, J.C.; Ribeiro-Barros, A.I. A transcriptomic approach to understanding the combined impacts of supra-optimal temperatures and CO2 revealed different responses in the polyploid Coffea arabica and its diploid progenitor C. canephora. Int. J. Mol. Sci. 2021, 22, 3125. [Google Scholar] [CrossRef]
  37. DaMatta, F.M.; Rahn, E.; Läderach, P.; Ghini, R.; Ramalho, J.C. Why could the coffee crop endure climate change and global warming to a greater extent than previously estimated? Clim. Chang. 2019, 152, 167–178. [Google Scholar] [CrossRef]
  38. Osorio, N. The Global Coffee Crisis: A Threat to Sustainable Development. International Coffee Organization, London. Submission to the World Summit on Sustainable Development, Johannesburg. 2002. Available online: https://www.ico.org/documents/ed1849.pdf (accessed on 2 May 2022).
  39. Martins, M.Q.; Fortunato, A.S.; Rodrigues, W.P.; Partelli, F.L.; Campostrini, E.; Lidon, F.C.; DaMatta, F.M.; Ramalho, J.C.; Ribeiro-Barros, A.I. Selection and validation of reference genes for accurate RT-qPCR data normalization in Coffea spp. under a climate changes context of interacting elevated [CO2] and temperature. Front. Plant Sci. 2017, 8, 307. [Google Scholar] [CrossRef]
  40. Koutouleas, A.; Sarzynski, T.; Bordeaux, M.; Bosselmann, A.S.; Campa, C.; Etienne, H.; Turreira-García, N.; Rigal, C.; Vaast, P.; Ramalho, J.C.; et al. Shaded-coffee: A nature-based strategy for coffee production under climate change? A review. Front. Sustain. Food Syst. 2022, 6, 877476. [Google Scholar] [CrossRef]
  41. ICO—International Coffee Organisation. Coffee Price Rise Continues in November Reaching a 10-Year High. 2021. Available online: athttps://www.ico.org/documents/cy2021-22/cmr-1121-e.pdf (accessed on 3 January 2022).
  42. DaMatta, F.M.; Avila, R.T.; Cardoso, A.A.; Martins, S.C.V.; Ramalho, J.C. Physiological and agronomic performance of the coffee crop in the context of climate change and global warming: A review. J. Agric. Food Chem. 2018, 66, 5264–5274. [Google Scholar] [CrossRef] [PubMed]
  43. Davis, A.P.; Rakotonasolo, F. Six new species of coffee (Coffea) from northern Madagascar. Kew Bull. 2021, 76, 497–511. [Google Scholar] [CrossRef]
  44. DaMatta, F.M.; Ramalho, J.C. Impacts of drought and temperature stress on coffee physiology and production: A review. Braz. J. Plant Physiol. 2006, 18, 55–81. [Google Scholar] [CrossRef]
  45. Santos, C.; Leitão, A.; Pais, I.; Lidon, F.; Ramalho, J. Perspectives on the potential impacts of climate changes on coffee plant and bean quality. Emir. J. Food Agric. 2015, 27, 152–163. [Google Scholar] [CrossRef]
  46. Assad, E.D.; Pinto, H.S.; Zullo, J., Jr.; Ávila, A.M.H. Climatic changes impact in agroclimatic zonning of coffee in Brazil. Pesqui. Agropecu. Bras. 2004, 39, 1057–1064. [Google Scholar] [CrossRef]
  47. Bunn, C.; Läderach, P.; Ovalle Rivera, O.; Kirschke, D. A bitter cup: Climate change profile of global production of Arabica and Robusta coffee. Clim. Chang. 2015, 129, 89–101. [Google Scholar] [CrossRef]
  48. Craparo, A.C.W.; Van Asten, P.J.A.; Läderach, P.; Jassogne, L.T.P.; Grab, S.W. Coffea arabica yields decline in Tanzania due to climate change: Global implications. Agric. For. Meteorol. 2015, 207, 1–10. [Google Scholar] [CrossRef]
  49. Läderach, P.; Ramirez-Villegas, J.; Navarro-Racines, C.; Zelaya, C.; Martinez–Valle, A.; Jarvis, A. Climate change adaptation of coffee production in space and time. Clim. Chang. 2017, 141, 47–62. [Google Scholar] [CrossRef]
  50. Alégre, C. Climates et caféiers d’Arabie. Agron. Trop. 1959, 14, 23–58. [Google Scholar]
  51. Camargo, A.P. O clima e a cafeicultura no Brasil. Inf. Agropecuário 1985, 11, 13–26. [Google Scholar]
  52. Drinnan, J.E.; Menzel, C.M. Temperature affects vegetative growth and flowering of coffee (Coffea arabica L.). J. Hortic. Sci. 1995, 70, 25–34. [Google Scholar] [CrossRef]
  53. Martins, L.D.; Tomaz, M.A.; Lidon, F.C.; DaMatta, F.M.; Ramalho, J.C. Combined effects of elevated [CO2] and high temperature on leaf mineral balance in Coffea spp. plants. Clim. Chang. 2014, 126, 365–379. [Google Scholar] [CrossRef]
  54. Oliveira, R.R.; Ribeiro, T.H.C.; Cardon, C.H.; Fedenia, L.; Maia, V.A.; Barbosa, B.C.F.; Caldeira, C.F.; Klein, P.E.; Chalfun-Junior, A. Elevated temperatures impose transcriptional constraints and elicit intraspecific differences between coffee genotypes. Front. Plant Sci. 2020, 11, 1113. [Google Scholar] [CrossRef]
  55. Camargo, M.B.P. The impact of climatic variability and climate change on arabic coffee crop in Brazil. Bragantia 2010, 69, 239–247. [Google Scholar] [CrossRef]
  56. Nunes, M.A.; Bierhuizen, J.F.; Ploegman, C. Studies on productivity of coffee. I. Effect of light, temperature and CO2 concentration on photosynthesis of Coffea arabica. Acta Bot. Neerl. 1968, 17, 93–102. [Google Scholar] [CrossRef]
  57. Verhage, F.Y.F.; Anten, N.P.R.; Sentelhas, P.C. Carbon dioxide fertilization offsets negative impacts of climate change on arabica coffee yield in Brazil. Clim. Chang. 2017, 144, 671–685. [Google Scholar] [CrossRef]
  58. Labroo, M.R.; Studer, A.J.; Rutkoski, J.E. Heterosis and hybrid crop breeding: A multidisciplinary review. Front. Genet. 2021, 12, 643761. [Google Scholar] [CrossRef] [PubMed]
  59. Ramalho, J.C.; Rodrigues, A.P.; Semedo, J.N.; Pais, I.P.; Martins, L.D.; Simões-Costa, M.C.; Leitão, A.E.; Fortunato, A.S.; Batista-Santos, P.; Palos, I.M.; et al. Sustained photosynthetic performance of Coffea spp. under long-term enhanced [CO2]. PLoS ONE 2013, 8, e82712. [Google Scholar] [CrossRef]
  60. Ramalho, J.C.; Marques, N.C.; Semedo, J.N.; Matos, M.C.; Quartin, V.L. Photosynthetic performance and pigment composition of leaves from two tropical species is determined by light quality. Plant Biol. 2002, 4, 112–120. [Google Scholar] [CrossRef]
  61. Demmig-Adams, B. Carotenoids and photoprotection in plants: A role for the xanthophyll zeaxanthin. BBA Bioenerg. 1990, 1020, 1–24. [Google Scholar] [CrossRef]
  62. Demmig-Adams, B.; López-Pozo, M.; Stewart, J.J.; Adams, W.W., III. Zeaxanthin and lutein: Photoprotectors, anti-inflammatories, and brain food. Molecules 2020, 25, 3607. [Google Scholar] [CrossRef]
  63. Havaux, M.; Niyogi, K.K. The violaxanthin cycle protects plants from photooxidative damage by more than one mechanism. Proc. Natl. Acad. Sci. USA 1999, 96, 8762–8767. [Google Scholar] [CrossRef]
  64. Lichtenthaler, H.K.; Babani, F. Light adaptation and senescence of the photosynthetic apparatus. Changes in pigment composition, chlorophyll fluorescence parameters and photosynthetic activity. In Chlorophyll a Fluorescence: A Signature of Photosynthesis; Papageorgiou, G.C., Govindjee, Eds.; Springer: Dordrecht, The Netherlands, 2004; pp. 713–736. [Google Scholar] [CrossRef]
  65. Pogson, B.J.; Niyogi, K.K.; Björkman, O.; DellaPenna, D. Altered xanthophyll compositions adversely affect chlorophyll accumulation and nonphotochemical quenching in Arabidopsis mutants. Proc. Natl. Acad. Sci. USA 1998, 95, 13324–13329. [Google Scholar] [CrossRef]
  66. Niyogi, K.K.; Björkman, O.; Grossman, A.R. The roles of specific xanthophylls in photoprotection. Proc. Natl. Acad. Sci. USA 1997, 94, 14162–14167. [Google Scholar] [CrossRef]
  67. Logan, B.A. Reactive oxygen species and photosynthesis. In Antioxidants and Reactive Oxygen in Plants; Smirnoff, N., Ed.; Blackwell Publishing: Oxford, UK, 2005; pp. 250–267. [Google Scholar]
  68. Kalituho, L.; Rech, J.; Jahns, P. The roles of specific xanthophylls in light utilization. Planta 2007, 225, 423–439. [Google Scholar] [CrossRef] [PubMed]
  69. Matsubara, S.; Chen, Y.-X.; Caliandro, R.; Govindjee Clegg, R.M. Photosystem II fluorescence life time imaging in avocado leaves: Contributions of the lutein-epoxide and violaxanthin cycles to fluorescence quenching. J. Photochem. Photobiol. B 2011, 104, 271–284. [Google Scholar] [CrossRef] [PubMed]
  70. Jahns, P.; Holzwarth, A.R. role of the xanthophyll cycle and of lutein in photoprotection of photosystem II. Biochim. Biophys. Acta 2012, 1817, 182–193. [Google Scholar] [CrossRef] [PubMed]
  71. Giossi, C.; Cartaxana, P.; Cruz, S. Photoprotective role of neoxanthin in plants and algae. Molecules 2020, 25, 4617. [Google Scholar] [CrossRef]
  72. Johnson, G.N.; Scholes, J.D.; Horton, P.; Young, A.J. Relationships between carotenoid composition and growth habit in British plant species. Plant Cell Environ. 1993, 16, 681–686. [Google Scholar] [CrossRef]
  73. Lichtenthaler, H.K. Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. Methods Enzymol. 1987, 148, 350–382. [Google Scholar] [CrossRef]
  74. De Las Rivas, J.; Telfer, A.; Barber, J. Two coupled β-carotene molecules protect P680 from photodamage in isolated Photosystem II reaction centres. Biochim. Biophys. Acta (BBA) Bioenerg. 1993, 1142, 155–164. [Google Scholar] [CrossRef]
  75. Zhang, H.; Huang, D.; Cramer, W.A. Stoichiometrically bound β-carotene in the cytochrome b6f complex of oxygenic photosynthesis protects against oxygen damage. J. Biol. Chem. 1999, 274, 1581–1587. [Google Scholar] [CrossRef]
  76. Asada, K. Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiol. 2006, 141, 391–396. [Google Scholar] [CrossRef]
  77. Rodrigues, A.M.; Jorge, T.; Osorio, S.; Pott, D.M.; Lidon, F.C.; DaMatta, F.M.; Marques, I.; Ribeiro-Barros, A.I.; Ramalho, J.C.; António, C. Primary metabolite profile changes in Coffea spp. promoted by single and combined exposure to drought and elevated CO2 concentration. Metabolites 2021, 11, 427. [Google Scholar] [CrossRef]
  78. Fernandes, I.; Marques, I.; Paulo, O.S.; Batista, D.; Partelli, F.L.; Lidon, F.C.; DaMatta, F.M.; Ramalho, J.C.; Ribeiro-Barros, A.I. Understanding the impact of drought in Coffea genotypes: Transcriptomic analysis supports a common high resilience to moderate water deficit but a genotype dependent sensitivity to severe water deficit. Agronomy 2021, 11, 2255. [Google Scholar] [CrossRef]
  79. Suzuki, N.; Mittler, R. Reactive oxygen species and temperature stresses: A delicate balance between signaling and destruction. Physiol. Plant. 2006, 126, 45–51. [Google Scholar] [CrossRef]
  80. Hasanuzzaman, M.; Nahar, K.; Fujita, M. Extreme temperature responses, oxidative stress and antioxidant defense in plants. In Abiotic Stress—Plant Responses and Applications in Agriculture; Vahdatiand, K., Leslie, C., Eds.; InTech: Milton, QS, Canada, 2013; pp. 169–205. [Google Scholar]
  81. Feierabend, J. Catalases in plants: Molecular and functional properties and role in stress defense. In Antioxidants and Reactive Oxygen in Plants; Smirnoff, N., Ed.; Blackwell Publishing: Oxford, UK, 2005; pp. 99–140. [Google Scholar]
  82. Sofo, A.; Scopa, A.; Nuzzaci, M.; Vitti, A. Ascorbate peroxidase and catalase activities and their genetic regulation in plants subjected to drought and salinity stresses. Int. J. Mol. Sci. 2015, 16, 13561–13578. [Google Scholar] [CrossRef]
  83. Dumanović, J.; Nepovimova, E.; Natić, M.; Kuča, K.; Jaćević, V. The significance of reactive oxygen species and antioxidant defense system in plants: A concise overview. Front. Plant Sci. 2021, 11, 552969. [Google Scholar] [CrossRef] [PubMed]
  84. Banerjee, A.; Roychoudhury, A. Abiotic stress, generation of reactive oxygen species, and their consequences: An overview. In Reactive Oxygen Species in Plants: Boon or Bane—Revisiting the Role of ROS; John Wiley & Sons Ltd.: Hoboken, NJ, USA, 2017; pp. 23–50. [Google Scholar] [CrossRef]
  85. Zhang, S.-G.; Han, S.-Y.; Yang, W.-H.; Wei, H.-L.; Zhang, M.; Qi, L.-W. Changes in H2O2 content and antioxidant enzyme gene expression during the somatic embryogenesis of Larix leptolepis. Plant Cell Tissue Organ Cult. 2010, 100, 21–29. [Google Scholar] [CrossRef]
  86. Erice, G.; Aranjuelo, I.; Irigoyen, J.J.; Sánchez-Díaz, M. Effect of elevated CO2, temperature and limited water supply on antioxidant status during regrowth of nodulated alfalfa. Physiol. Plant. 2007, 130, 33–45. [Google Scholar] [CrossRef]
  87. Long, S.P.; Ainsworth, E.A.; Rogers, A.; Ort, D.R. Rising atmospheric carbon dioxide: Plants FACE the future. Annu. Rev. Plant Biol. 2004, 55, 591–628. [Google Scholar] [CrossRef] [PubMed]
  88. Dusenge, M.E.; Duarte, A.G.; Way, D.A. Plant carbon metabolism and climate change: Elevated CO2 and temperature impacts on photosynthesis, photorespiration and respiration. New Phytol. 2019, 221, 32–49. [Google Scholar] [CrossRef]
  89. Gupta, A.S.; Webb, R.P.; Holaday, A.S.; Allen, R.D. Overexpression of superoxide dismutase protects plants from oxidative stress (induction of ascorbate peroxidase in superoxide dismutase-overexpressing plants). Plant Physiol. 1993, 103, 1067–1073. [Google Scholar] [CrossRef] [PubMed]
  90. Zinta, G.; AbdElgawad, H.; Domagalska, M.A.; Vergauwen, L.; Knapen, D.; Nijs, I.; Janssens, I.A.; Beemster, G.T.S.; Asard, H. Physiological, biochemical, and genome-wide transcriptional analysis reveals that elevated CO2 mitigates the impact of combined heat wave and drought stress in Arabidopsis thaliana at multiple organizational levels. Glob. Chang. Biol. 2014, 20, 3670–3685. [Google Scholar] [CrossRef] [PubMed]
  91. Pritchard, S.G.; Ju, Z.; Van Santen, E.; Qiu, J.; Weaver, D.B.; Prior, S.A.; Rogers, H.H. The influence of elevated CO2 on the activities of antioxidative enzymes in two soybean genotypes. Aust. J. Plant Physiol. 2000, 27, 1061–1068. [Google Scholar] [CrossRef]
  92. Iba, K. Acclimative response to temperature stress in higher plants: Approaches of gene engineering for temperature tolerance. Annu. Rev. Plant Biol. 2002, 53, 225–245. [Google Scholar] [CrossRef]
  93. Ahn, Y.J.; Zimmerman, J.L. Introduction of the carrot HSP17.7 into potato (Solanum tuberosum L.) enhances cellular membrane stability and tuberization in vitro. Plant Cell Environ. 2006, 29, 95–104. [Google Scholar] [CrossRef]
  94. Boston, R.S.; Viitanen, P.V.; Vierling, E. Molecular chaperones and protein folding in plants. Plant Mol. Biol. 1996, 32, 191–222. [Google Scholar] [CrossRef]
  95. Wang, W.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 2004, 9, 244–252. [Google Scholar] [CrossRef]
  96. Mao, J.; Chia, W.; Ouyang, M.; He, B.; Chen, F.; Zhang, L. PAB is an assembly chaperone that functions downstream of chaperonin 60 in the assembly of chloroplast ATP synthase coupling factor 1. Proc. Natl. Acad. Sci. USA 2015, 112, 4152–4157. [Google Scholar] [CrossRef]
  97. Montané, M.H.; Dreyer, S.; Triantaphylides, C.; Kloppstech, K. Early light-inducible proteins during long-term acclimation of barley to photooxidative stress caused by light and cold: High level of accumulation by posttranscriptional regulation. Planta 1997, 202, 293–302. [Google Scholar] [CrossRef]
  98. Hutin, C.; Nussaume, L.; Moise, N.; Moya, I.; Kloppstech, K.; Havaux, M. Early light-induced proteins protect Arabidopsis from photooxidative stress. Proc. Natl. Acad. Sci. USA 2003, 100, 4921–4926. [Google Scholar] [CrossRef]
  99. Liu, X.; Zhang, Y.; Yang, H.; Liang, Y.; Li, X.; Oliver, M.J.; Zhang, D. Functional aspects of early light-induced protein (ELIP) genes from the desiccation-tolerant moss Syntrichia caninervis. Int. J. Mol. Sci. 2020, 21, 1411. [Google Scholar] [CrossRef] [PubMed]
  100. Wahid, A.; Gelani, S.; Ashraf, M.; Foolad, M.R. Heat tolerance in plants: An overview. Environ. Exp. Bot. 2007, 61, 199–223. [Google Scholar] [CrossRef]
  101. Anaraki, Z.E.; Tafreshi, S.A.H.; Shariati, M. Transient silencing of heat shock proteins showed remarkable roles or HSP70 during adaptation to stress in plants. Environ. Exp. Bot. 2018, 155, 142–157. [Google Scholar] [CrossRef]
  102. Panchuk, I.I.; Volkov, R.A.; Schöffl, F. Heat stress- and heat shock transcription factor-dependent expression and activity of ascorbate peroxidase in Arabidopsis. Plant Physiol. 2002, 129, 838–853. [Google Scholar] [CrossRef] [PubMed]
  103. Cottee, N.S.; Wilson, I.W.; Tan, D.K.Y.; Bange, M.P. Understanding the molecular events underpinning cultivar differences in the physiological performance and heat tolerance of cotton (Gossypium hirsutum). Funct. Plant Biol. 2014, 41, 56–67. [Google Scholar] [CrossRef]
  104. Cassamo, C.T.; Draper, D.; Romeiras, M.M.; Marques, I.; Chiulele, R.; Rodrigues, M.; Stalmans, M.; Partelli, F.L.; Ribeiro-Barros, A.; Ramalho, J.C. Impact of climate changes in the suitable areas for Coffea arabica L. production in Mozambique: Agroforestry as an alternative management system to strengthen crop sustainability. Agric. Ecosyst. Environ. 2022. submitted. [Google Scholar]
Figure 1. Changes in leaf cellular activities of superoxide dismutase (SOD) and ascorbate peroxidase (APX) enzymes in C. arabica cv. Geisha 3, cv. Marsellesa and their Hybrid (Geisha 3 × Marsellesa) plants grown under 400 or 700 μLCO2 L−1 at control (25/20 °C, day/night), submitted to supra-optimal temperatures (37/28 °C, 42/30 °C), and after 14 days of recovery (Rec14). For each enzyme, the mean values ± SE (n = 3 plants) followed by different letters express significant differences between CO2 treatments for each temperature, separately for each genotype (a, b), or between temperatures for the same CO2 treatment (A, B, C), always separately for each genotype, where a > b and A > B > C.
Figure 1. Changes in leaf cellular activities of superoxide dismutase (SOD) and ascorbate peroxidase (APX) enzymes in C. arabica cv. Geisha 3, cv. Marsellesa and their Hybrid (Geisha 3 × Marsellesa) plants grown under 400 or 700 μLCO2 L−1 at control (25/20 °C, day/night), submitted to supra-optimal temperatures (37/28 °C, 42/30 °C), and after 14 days of recovery (Rec14). For each enzyme, the mean values ± SE (n = 3 plants) followed by different letters express significant differences between CO2 treatments for each temperature, separately for each genotype (a, b), or between temperatures for the same CO2 treatment (A, B, C), always separately for each genotype, where a > b and A > B > C.
Plants 11 02702 g001
Figure 2. Changes in leaf cellular activities of glutathione reductase (GR) and catalase (CAT) enzymes in C. arabica cv. Geisha 3, cv. Marsellesa and their Hybrid (Geisha 3 × Marsellesa) plants grown under 400 or 700 μLCO2 L−1 at control (25/20 °C, day/night), submitted to supra-optimal temperatures (37/28 °C, 42/30 °C) and after 14 days of recovery (Rec14). For each enzyme, the mean values ± SE (n = 3 plants) followed by different letters express significant differences between CO2 treatments for each temperature, separately for each genotype (a, b), or between temperatures for the same CO2 treatment (A, B, C), always separately for each genotype, where a > b and A > B > C.
Figure 2. Changes in leaf cellular activities of glutathione reductase (GR) and catalase (CAT) enzymes in C. arabica cv. Geisha 3, cv. Marsellesa and their Hybrid (Geisha 3 × Marsellesa) plants grown under 400 or 700 μLCO2 L−1 at control (25/20 °C, day/night), submitted to supra-optimal temperatures (37/28 °C, 42/30 °C) and after 14 days of recovery (Rec14). For each enzyme, the mean values ± SE (n = 3 plants) followed by different letters express significant differences between CO2 treatments for each temperature, separately for each genotype (a, b), or between temperatures for the same CO2 treatment (A, B, C), always separately for each genotype, where a > b and A > B > C.
Plants 11 02702 g002
Table 1. Leaf carotenoids concentration (mg g−1 dry weight, DW) in C. arabica cv. Geisha 3, cv. Marsellesa and their Hybrid (Geisha 3 × Marsellesa) plants grown under 400 or 700 μLCO2 L−1 at the control temperature (25/20 °C, day/night), submitted to supra-optimal temperatures (31/25 °C, 37/28 °C, 42/30 °C), and after 4 (Rec4) and 14 (Rec14) days of recovery. For each parameter, the mean values ± SE (n = 4–6 plants) followed by different letters express significant differences between CO2 treatments for each temperature (a, b) or between temperatures for the same CO2 treatment (A, B, C, D), always separately for each genotype, where a > b and A > B > C > D.
Table 1. Leaf carotenoids concentration (mg g−1 dry weight, DW) in C. arabica cv. Geisha 3, cv. Marsellesa and their Hybrid (Geisha 3 × Marsellesa) plants grown under 400 or 700 μLCO2 L−1 at the control temperature (25/20 °C, day/night), submitted to supra-optimal temperatures (31/25 °C, 37/28 °C, 42/30 °C), and after 4 (Rec4) and 14 (Rec14) days of recovery. For each parameter, the mean values ± SE (n = 4–6 plants) followed by different letters express significant differences between CO2 treatments for each temperature (a, b) or between temperatures for the same CO2 treatment (A, B, C, D), always separately for each genotype, where a > b and A > B > C > D.
PigmentGenotype[CO2]
(µL L−1)
Temperature (Day/Night)
25/20 °C31/25 °C37/28 °C42/30 °CRec4Rec14
Neoxanthin
(mg g−1 DW)
Geisha 34000.195 ± 0.004 aC0.293 ± 0.014 aA0.269 ± 0.004 aAB0.178 ± 0.012 aC0.222 ± 0.010 aBC0.201 ± 0.028 aC
7000.180 ± 0.019 aA0.168 ± 0.020 bA0.227 ± 0.025 aA0.197 ± 0.006 aA0.170 ± 0.014 aA0.182 ± 0.020 aA
Marsellesa4000.270 ± 0.039 bA0.298 ± 0.041 aA0.315 ± 0.015 aA0.215 ± 0.042 aA0.329 ± 0.019 aA0.234 ± 0.022 aA
7000.404 ± 0.024 aA0.363 ± 0.033 aA0.368 ± 0.034 aA0.321 ± 0.014 aA0.304 ± 0.012 aA0.295 ± 0.014 aA
Hybrid4000.245 ± 0.003 aB0.291 ± 0.025 aAB0.346 ± 0.030 aA0.219 ± 0.022 aB0.219 ± 0.015 aB0.236 ± 0.016 aB
7000.251 ± 0.027 aAB0.254 ± 0.019 aAB0.236 ± 0.017 bAB0.291 ± 0.013 aA0.178 ± 0.011 aB0.221 ± 0.011 aAB
Violaxanthin
(mg g−1 DW)
Geisha 34000.203 ± 0.008 aBC0.360 ± 0.013 aA0.247 ± 0.014 aB0.093 ± 0.010 aD0.154 ± 0.011 aCD0.187 ± 0.023 aBC
7000.178 ± 0.028 aAB0.205 ± 0.032 bA0.221 ± 0.038 aA0.139 ± 0.004 aB0.157 ± 0.009 aAB0.148 ± 0.009 aB
Marsellesa4000.299 ± 0.050 aA0.326 ± 0.050 bA0.327 ± 0.016 aA0.132 ± 0.031 bB0.195 ± 0.008 aAB0.182 ± 0.026 aAB
7000.435 ± 0.032 aA0.467 ± 0.031 aA0.385 ± 0.032 aAB0.276 ± 0.031 aBC0.219 ± 0.013 aC0.192 ± 0.027 aC
Hybrid4000.270 ± 0.015 aB0.351 ± 0.044 aAB0.356 ± 0.019 aA0.153 ± 0.010 bC0.154 ± 0.029 aC0.205 ± 0.019 aBC
7000.246 ± 0.027 aAB0.334 ± 0.014 aA0.263 ± 0.018 aAB0.267 ± 0.022 aAB0.120 ± 0.028 aB0.169 ± 0.011 aAB
Antheraxanthin
(mg g−1 DW)
Geisha 34000.058 ± 0.005 aA0.043 ± 0.010 aA0.062 ± 0.005 aA0.048 ± 0.004 aA0.045 ± 0.002 aA0.021 ± 0.000 aB
7000.059 ± 0.004 aA0.059 ± 0.003 aA0.066 ± 0.004 aA0.040 ± 0.008 aAB0.026 ± 0.009 aB0.028 ± 0.003 aB
Marsellesa4000.046 ± 0.012 aA0.044 ± 0.014 aA0.064 ± 0.007 aA0.064 ± 0.011 aA0.073 ± 0.006 aA0.041 ± 0.009 aA
7000.067 ± 0.008 aA0.043 ± 0.010 aA0.069 ± 0.016 aA0.060 ± 0.007 aA0.048 ± 0.009 aA0.040 ± 0.008 aA
Hybrid4000.039 ± 0.002 aB0.054 ± 0.015 aAB0.056 ± 0.012 aAB0.077 ± 0.013 aA0.069 ± 0.003 aAB0.062 ± 0.005 aAB
7000.047 ± 0.007 aA0.038 ± 0.006 aA0.059 ± 0.008 aA0.040 ± 0.006 aA0.042 ± 0.003 aA0.046 ± 0.004 aA
Zeaxanthin
(mg g−1 DW)
Geisha 34000.094 ± 0.005 aA0.030 ± 0.014 aB0.092 ± 0.014 aA0.097 ± 0.015 aA0.049 ± 0.019 aAB0.008 ± 0.001 aB
7000.057 ± 0.002 aAB0.066 ± 0.006 aAB0.094 ± 0.010 aAB0.056 ± 0.017 aAB0.034 ± 0.006 aB0.023 ± 0.004 aB
Marsellesa4000.015 ± 0.002 aB0.013 ± 0.003 aB0.043 ± 0.011 aB0.097 ± 0.026 aAB0.144 ± 0.035 aA0.123 ± 0.058 aA
7000.089 ± 0.022 aAB0.026 ± 0.007 aB0.018 ± 0.005 aB0.097 ± 0.033 aAB0.084 ± 0.036 aAB0.182 ± 0.073 aA
Hybrid4000.051 ± 0.007 aB0.061 ± 0.011 aB0.063 ± 0.016 aB0.114 ± 0.034 aB0.228 ± 0.040 aA0.114 ± 0.037 aB
7000.066 ± 0.028 aB0.022 ± 0.008 aB0.037 ± 0.010 aB0.029 ± 0.005 aB0.179 ± 0.054 aA0.106 ± 0.026 aAB
V + A + Z
(mg g−1 DW)
Geisha 34000.355 ± 0.013 aAB0.433 ± 0.031 aA0.401 ± 0.030 aA0.239 ± 0.025 aB0.248 ± 0.020 aB0.216 ± 0.022 aB
7000.380 ± 0.039 aAB0.343 ± 0.031 aAB0.381 ± 0.033 aA0.235 ± 0.028 aB0.217 ± 0.007 aB0.198 ± 0.014 aB
Marsellesa4000.360 ± 0.061 bA0.383 ± 0.061 aA0.433 ± 0.031 aA0.272 ± 0.044 aA0.412 ± 0.042 aA0.346 ± 0.043 aA
7000.592 ± 0.051 aA0.536 ± 0.035 aAB0.473 ± 0.049 aAB0.434 ± 0.019 aAB0.351 ± 0.033 aB0.414 ± 0.059 aAB
Hybrid4000.360 ± 0.020 aA0.466 ± 0.062 aA0.475 ± 0.031 aA0.344 ± 0.050 aA0.451 ± 0.025 aA0.381 ± 0.023 aA
7000.387 ± 0.043 aA0.394 ± 0.025 aA0.360 ± 0.026 aA0.336 ± 0.025 aA0.341 ± 0.026 aA0.321 ± 0.020 aA
DEPSGeisha 34000.345 ± 0.014 aAB0.105 ± 0.030 aC0.299 ± 0.024 aAB0.499 ± 0.034 aA0.272 ± 0.055 aB0.093 ± 0.013 aC
7000.305 ± 0.030 aA0.282 ± 0.026 aA0.354 ± 0.049 aA0.293 ± 0.053 aA0.212 ± 0.032 aA0.178 ± 0.012 aA
Marsellesa4000.116 ± 0.008 aB0.098 ± 0.015 aB0.163 ± 0.021 aB0.481 ± 0.072 aA0.402 ± 0.051 aAB0.320 ± 0.115 aAB
7000.202 ± 0.024 aAB0.088 ± 0.018 aB0.105 ± 0.017 aB0.280 ± 0.072 aA0.257 ± 0.076 aA0.383 ± 0.124 aAB
Hybrid4000.193 ± 0.008 aB0.189 ± 0.022 aB0.187 ± 0.020 aB0.383 ± 0.064 aAB0.572 ± 0.075 aA0.352 ± 0.072 aAB
7000.203 ± 0.045 aB0.097 ± 0.021 aB0.178 ± 0.032 aB0.145 ± 0.022 bB0.524 ± 0.120 aA0.367 ± 0.066 aAB
Lutein
(mg g−1 DW)
Geisha 34000.601 ± 0.007 aC0.833 ± 0.027 aB0.780 ± 0.033 aB0.756 ± 0.043 aB1.036 ± 0.058 aA0.809 ± 0.104 aB
7000.534 ± 0.042 aBC0.503 ± 0.042 bC0.650 ± 0.052 aAB0.710 ± 0.032 aA0.649 ± 0.043 bAB0.646 ± 0.071 bAB
Marsellesa4000.779 ± 0.109 bBC0.842 ± 0.107 aBC0.945 ± 0.051 aB0.612 ± 0.067 bC1.427 ± 0.045 aA0.886 ± 0.076 aBC
7001.198 ± 0.085 aA1.010 ± 0.072 aA1.030 ± 0.081 aA1.153 ± 0.054 aA1.148 ± 0.075 aA1.101 ± 0.075 aA
Hybrid4000.731 ± 0.020 aB0.913 ± 0.069 aAB1.021 ± 0.068 aA0.919 ± 0.074 aAB1.054 ± 0.068 aA1.026 ± 0.035 aA
7000.742 ± 0.105 aB0.706 ± 0.057 aB0.683 ± 0.042 bB1.042 ± 0.049 aA0.807 ± 0.035 bAB0.907 ± 0.070 aA
α-carotene
(mg g−1 DW)
Geisha 34000.129 ± 0.011 aB0.265 ± 0.014 aA0.256 ± 0.009 aA0.074 ± 0.010 aB0.071 ± 0.010 aB0.046 ± 0.005 aB
7000.120 ± 0.019 aB0.113 ± 0.030 bB0.224 ± 0.039 aA0.094 ± 0.002 aB0.056 ± 0.012 aB0.062 ± 0.016 aB
Marsellesa4000.225 ± 0.048 aAB0.279 ± 0.047 aA0.319 ± 0.034 aA0.121 ± 0.040 aB0.187 ± 0.028 aAB0.109 ± 0.026 aB
7000.364 ± 0.036 aA0.306 ± 0.041 aAB0.306 ± 0.058 aAB0.240 ± 0.027 aAB0.190 ± 0.017 aB0.117 ± 0.017 aB
Hybrid4000.156 ± 0.017 aBC0.278 ± 0.037 aA0.255 ± 0.014 aAB0.107 ± 0.020 bC0.055 ± 0.010 aC0.072 ± 0.015 aC
7000.205 ± 0.038 aA0.223 ± 0.041 aA0.209 ± 0.025 aAB0.223 ± 0.026 aA0.060 ± 0.012 aB0.080 ± 0.009 aB
β-carotene
(mg g−1 DW)
Geisha 34000.314 ± 0.016 aC0.513 ± 0.023 aA0.407 ± 0.009 aB0.322 ± 0.025 aBC0.277 ± 0.016 aC0.291 ± 0.051 aC
7000.286 ± 0.016 aA0.298 ± 0.033 bA0.374 ± 0.032 aA0.317 ± 0.018 aA0.251 ± 0.025 aA0.254 ± 0.049 aA
Marsellesa4000.353 ± 0.070 aAB0.378 ± 0.075 aAB0.488 ± 0.027 aA0.233 ± 0.048 bB0.439 ± 0.030 aAB0.367 ± 0.035 aAB
7000.522 ± 0.042 aA0.561 ± 0.046 aA0.528 ± 0.079 aA0.483 ± 0.030 aA0.456 ± 0.015 aA0.427 ± 0.028 aA
Hybrid4000.371 ± 0.013 aAB0.475 ± 0.047 aA0.421 ± 0.016 aAB0.381 ± 0.027 aAB0.306 ± 0.018 aB0.361 ± 0.014 aAB
7000.289 ± 0.043 aB0.392 ± 0.016 aAB0.433 ± 0.034 aA0.331 ± 0.042 aAB0.312 ± 0.024 aAB0.360 ± 0.012 aAB
(α + β) carotene
(mg g−1 DW)
Geisha 34000.443 ± 0.015 aB0.778 ± 0.035 aA0.662 ± 0.008 aA0.396 ± 0.032 aB0.348 ± 0.021 aB0.336 ± 0.056 aB
7000.406 ± 0.033 aB0.411 ± 0.062 bB0.598 ± 0.071 aA0.411 ± 0.018 aAB0.306 ± 0.037 aB0.317 ± 0.063 aB
Marsellesa4000.578 ± 0.115 aAB0.657 ± 0.121 aAB0.807 ± 0.060 aA0.355 ± 0.087 bB0.626 ± 0.057 aAB0.476 ± 0.059 aB
7000.886 ± 0.057 aA0.867 ± 0.081 aA0.834 ± 0.132 aA0.722 ± 0.033 aA0.645 ± 0.028 aA0.544 ± 0.043 aA
Hybrid4000.528 ± 0.024 aB0.753 ± 0.083 aA0.676 ± 0.022 aAB0.488 ± 0.046 aBC0.362 ± 0.028 aC0.433 ± 0.022 aC
7000.494 ± 0.081 aAB0.615 ± 0.051 aAB0.642 ± 0.058 aA0.554 ± 0.045 aAB0.372 ± 0.019 aB0.440 ± 0.010 aB
(α/β) carotene
(g g−1 DW)
Geisha 34000.426 ± 0.052 aB0.518 ± 0.018 aAB0.633 ± 0.035 aA0.228 ± 0.025 aC0.259 ± 0.037 aC0.175 ± 0.024 aC
7000.404 ± 0.052 aAB0.346 ± 0.054 bB0.576 ± 0.056 aA0.301 ± 0.022 aBC0.207 ± 0.034 aC0.255 ± 0.031 aBC
Marsellesa4000.658 ± 0.079 aAB0.764 ± 0.058 aA0.642 ± 0.040 aAB0.424 ± 0.074 aBC0.411 ± 0.038 aBC0.271 ± 0.049 aC
7000.718 ± 0.077 aA0.545 ± 0.070 aAB0.597 ± 0.069 aAB0.522 ± 0.086 aB0.415 ± 0.035 aBC0.267 ± 0.026 aC
Hybrid4000.422 ± 0.044 aAB0.570 ± 0.027 aA0.611 ± 0.034 aA0.266 ± 0.033 bB0.172 ± 0.025 aB0.199 ± 0.041 aB
7000.696 ± 0.033 aAB0.561 ± 0.086 aAB0.475 ± 0.034 aB0.770 ± 0.135 aA0.210 ± 0.048 aC0.230 ± 0.030 aC
Total carotenoids
(mg g−1 DW)
Geisha 34001.594 ± 0.032 aC2.338 ± 0.099 aA2.113 ± 0.009 aAB1.569 ± 0.106 aB1.854 ± 0.103 aB1.562 ± 0.203 aB
7001.500 ± 0.131 aA1.425 ± 0.154 bA1.855 ± 0.180 aA1.553 ± 0.070 aA1.343 ± 0.088 bA1.343 ± 0.159 aB
Marsellesa4001.987 ± 0.317 bAB2.180 ± 0.320 aAB2.500 ± 0.151 aAB1.688 ± 0.332 aB2.795 ± 0.138 aA1.941 ± 0.165 aAB
7003.079 ± 0.196 aA2.777 ± 0.215 aA2.705 ± 0.290 aA2.630 ± 0.114 aA2.448 ± 0.139 aA2.354 ± 0.168 aA
Hybrid4001.864 ± 0.042 aB2.423 ± 0.227 aAB2.519 ± 0.123 aA1.970 ± 0.190 aAB2.085 ± 0.101 aAB2.076 ± 0.059 aAB
7001.875 ± 0.238 aA1.969 ± 0.133 aA1.921 ± 0.138 bA2.223 ± 0.121 aA1.698 ± 0.049 aA1.890 ± 0.088 aA
Table 2. Real-time PCR expression studies relative to the expression value observed under control conditions of temperature and CO2 (25/20 °C, 400 μL CO2 L−1) from leaves of C. arabica cv. Geisha3, cv. Marsellesa and their Hybrid (Geisha 3 × Marsellesa) plants grown under 400 or 700 μL CO2 L−1 at control (25/20 °C, day/night), submitted to supra-optimal temperatures (37/28 °C, 42/30 °C), and after 14 days of recovery (Rec14). For each gene transcript, the mean values (n = 3 plants) followed by different letters express significant differences between [CO2] levels for each temperature treatment (a, b) or between temperature treatments for the same CO2 treatment (A, B, C, D), always separately for each genotype, where a > b and A > B > C > D.
Table 2. Real-time PCR expression studies relative to the expression value observed under control conditions of temperature and CO2 (25/20 °C, 400 μL CO2 L−1) from leaves of C. arabica cv. Geisha3, cv. Marsellesa and their Hybrid (Geisha 3 × Marsellesa) plants grown under 400 or 700 μL CO2 L−1 at control (25/20 °C, day/night), submitted to supra-optimal temperatures (37/28 °C, 42/30 °C), and after 14 days of recovery (Rec14). For each gene transcript, the mean values (n = 3 plants) followed by different letters express significant differences between [CO2] levels for each temperature treatment (a, b) or between temperature treatments for the same CO2 treatment (A, B, C, D), always separately for each genotype, where a > b and A > B > C > D.
GenotypeTemperature
(Day/Night)
[CO2]
(µL L−1)
HSP70ELIPChape20Chape60CATCuSOD1CuSOD2APXCytAPXChlAPXt+sVDE2
Geisha 325/20 °C4001.00aD1.00aD1.00aD1.00aD1.00aD1.00aD1.00aC1.00aD1.00aC1.00aD1.00aA
7000.98aD0.96aC1.02aC1.21aC0.98aB0.98aC0.95aC0.88aD0.98aC1.02aC0.99aA
37/28 °C4001.78aC2.23aB8.22aB6.65aB3.42aC4.55aB25.23aA48.23aB12.31aB15.34aB0.56aB
7001.76aB2.21aA4.55bA5.67bB2.22bA3.23bA12.24bA14.55bB10.25aA14.24aA0.54aC
42/30 °C4004.22aA3.45aA11.21aA9.21aA6.56aA6.66aA28.91aA69.89aA24.55aA26.77aA0.98aA
7002.25bA2.44bA4.55bA6.23bA2.27bA3.56bA11.55bA17.67bA12.34bA15.61bA0.72bB
Rec144002.21aB1.25aC7.72aC2.23aC4.46aB2.23aC2.66aB26.55aC14.55aB8.6aC0.98aA
7001.24bC1.22aB2.33bB1.27bC2.26bA1.67bB2.21aB12.21bC8.90bB2.24bB0.88aB
Marsellesa25/20 °C4001.00aD1.00aC1.00aC1.00aD1.00aB1.00aC1.00aB1.00aD1.00aD1.00aD1.00aA
7001.02aC0.98aC0.98aB1.02aC1.04aC0.99aC0.92aB0.99aD1.03aD1.05aD0.96aA
37/28 °C4002.24aB3.33aA3.46aB3.34aB2.61aA4.23aB14.55aA48.91aB18.21aB22.34aB0.97aA
7001.88bB2.24bA2.23bA1.67bB2.18bA2.29bB0.98bB10.98bC8.23bB11.36bB0.76bB
42/30 °C4004.33aA3.37aA6.78aA4.54aA2.67aA8.99aA14.67aA104.22aA24.56aA39.31aA0.55aB
7002.21bA2.27bA2.21bA2.21bA2.17bA4.55bA1.02bB55.66bA19.18bA22.8bA0.43bC
Rec144001.25bC2.21aB3.23aB1.99aC2.41aA4.65aB14.22aA26.71aC5.44aC6.33aC0.98aA
7002.22aA1.98bB1.12bB1.03bC1.98bB2.33bB2.21bA14.33bB2.23bC3.35bC0.78bB
Hybrid25/20 °C4001.00aD1.00aD1.00aD1.00aD1.00aD1.00aD1.00aD1.00aD1.00aD1.00aD1.00aA
7000.97aC0.96bC0.98aD0.98aD0.99aC0.99aC1.13aC1.22aC1.02aC0.98aD0.97bA
37/28 °C4006.22aB5.66aB11.25aB8.91aB3.44aB8.88aB35.61aB23.56aB26.77aB32.44aB0.94aA
7002.43bA2.23bA6.78bB4.56bB2.23bA1.44bBC4.57bB9.21bB22.11aA14.55bB0.96aA
42/30 °C40013.98aA8.66aA26.79aA11.23aA5.21aA12.34aA55.34aA36.21aA33.72aA43.77aA0.56bB
7002.49bA2.21bA9.87bA8.86bA2.21bA5.57bA8.87bA11.23bA21.40bA24.78bA0.67aC
Rec144003.44aC2.82aC5.44aC2.45aC2.49aC4.56aC13.44aC17.22aC14.23aC24.21aC0.98aA
7001.22bB1.45bB3.56bC1.23bC1.89bB2.26bB1.22bC8.54bB5.51bB11.20bC0.77bB
Table 3. Selected genes used for real-time qPCR studies related to protective mechanisms and/or oxidative stress control, primer sequences and amplicon size (bp).
Table 3. Selected genes used for real-time qPCR studies related to protective mechanisms and/or oxidative stress control, primer sequences and amplicon size (bp).
Gene SymbolGene DescriptionPrimer Sequence
(5′–3′)
Amplicon Size
(bp)
HSP70Stromal 70 kDa heat shock-related protein, chloroplasticF: GGGAAGCAATTGACACCAAG150
R: AGCCACCAGATACTGCATCC
ELIPChloroplast early light-induced proteinF: GCCATGATAGGGTTTGTTGC101
R: GTCCCAATGAACCATTGCAG
Chape20Chloroplast 20 kDa chaperoninF: GTTAAAGCTGCCGCTGTTG150
R: CTCACCTCCTTGAGGTTTCG
Chape60Mitochondria chaperonin CPN60F: GGATAGTGAAGCCCTTGC80
R: CCCAGGAGCTTTTATTGCAC
CATCatalase isozyme 1F: CTACTTCCCCTCGCGGTAT150
R: CTGTCTGGTGCAAATGAACG
CuSOD1Superoxide dismutase [Cu-Zn]F: CCCTTGGAGACACAACGAAT141
R: GGCAGTACCATCTTGACCA
CuSOD2Superoxide dismutase [Cu-Zn]F: GGGGCTCTATCCAATTCCTC150
R: GGTTAAAATGAGGCCCAGTG
APXCytCytosol ascorbate peroxidaseF: TCTGGATTTGAGGGACCTTG108
R: GTCAGATGGAAGCCGGATAA
APXChlChloroplast ascorbate peroxidaseF: CACCTGCTGCTCATTTACG100
R: GACCTTCCCAATGTGTGTG
APXt+sStromatic ascorbate peroxidase (sAPX) mRNAF: AGGGCAGAATATGAAGGATTGG112
R: CCAAGCAAGGATGTCAAAATAGCC
VDE2Violaxanthin de-epoxidaseF: GGGTTCAAAATGCACAAGACTG86
R: CCCTCTTTTACCTCAGGCATTG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Vinci, G.; Marques, I.; Rodrigues, A.P.; Martins, S.; Leitão, A.E.; Semedo, M.C.; Silva, M.J.; Lidon, F.C.; DaMatta, F.M.; Ribeiro-Barros, A.I.; et al. Protective Responses at the Biochemical and Molecular Level Differ between a Coffea arabica L. Hybrid and Its Parental Genotypes to Supra-Optimal Temperatures and Elevated Air [CO2]. Plants 2022, 11, 2702. https://doi.org/10.3390/plants11202702

AMA Style

Vinci G, Marques I, Rodrigues AP, Martins S, Leitão AE, Semedo MC, Silva MJ, Lidon FC, DaMatta FM, Ribeiro-Barros AI, et al. Protective Responses at the Biochemical and Molecular Level Differ between a Coffea arabica L. Hybrid and Its Parental Genotypes to Supra-Optimal Temperatures and Elevated Air [CO2]. Plants. 2022; 11(20):2702. https://doi.org/10.3390/plants11202702

Chicago/Turabian Style

Vinci, Gabriella, Isabel Marques, Ana P. Rodrigues, Sónia Martins, António E. Leitão, Magda C. Semedo, Maria J. Silva, Fernando C. Lidon, Fábio M. DaMatta, Ana I. Ribeiro-Barros, and et al. 2022. "Protective Responses at the Biochemical and Molecular Level Differ between a Coffea arabica L. Hybrid and Its Parental Genotypes to Supra-Optimal Temperatures and Elevated Air [CO2]" Plants 11, no. 20: 2702. https://doi.org/10.3390/plants11202702

APA Style

Vinci, G., Marques, I., Rodrigues, A. P., Martins, S., Leitão, A. E., Semedo, M. C., Silva, M. J., Lidon, F. C., DaMatta, F. M., Ribeiro-Barros, A. I., & Ramalho, J. C. (2022). Protective Responses at the Biochemical and Molecular Level Differ between a Coffea arabica L. Hybrid and Its Parental Genotypes to Supra-Optimal Temperatures and Elevated Air [CO2]. Plants, 11(20), 2702. https://doi.org/10.3390/plants11202702

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop