Next Article in Journal
Combination of Molecular Networking and LC-MS/MS Profiling in Investigating the Interrelationships between the Antioxidant and Antimicrobial Properties of Curculigo latifolia
Next Article in Special Issue
First Detection and Molecular Characterization of Apple Stem Grooving Virus, Apple Chlorotic Leaf Spot Virus, and Apple Hammerhead Viroid in Loquat in Spain
Previous Article in Journal
Typification and Taxonomic Remarks on Names of Iris (Iridaceae) Associated with the Turkish Flora
Previous Article in Special Issue
An Annotated List of Legume-Infecting Viruses in the Light of Metagenomics
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms

National Center for Eliminating Viruses from Deciduous Fruit Trees, Research Institute of Pomology, Chinese Academy of Agriculture Sciences, Xingcheng 125100, China
*
Author to whom correspondence should be addressed.
Plants 2021, 10(7), 1487; https://doi.org/10.3390/plants10071487
Submission received: 25 June 2021 / Revised: 16 July 2021 / Accepted: 17 July 2021 / Published: 20 July 2021

Abstract

:
A putative new marafivirus was identified in a ‘Jumeigui’ grapevine exhibitting obvious vein-clearing symptoms by high-throughput sequencing, which tentatively named grapevine-associated marafivirus (GaMV). The nearly complete genomic sequence of GaMV was amplified by reverse transcription PCR, and the terminal sequences were determined using the rapid amplification of cDNA ends method. The nearly complete genome of GaMV is 6346 bp long, excluding the poly(A) tail, and shows 51.2–62.3% nucleotide identity with other members of the genera Marafivirus, Maculavirus and Tymovirus in the family Tymoviridae. Additionally, it includes five functional domains homologous to those found in members of these genera. A phylogenetic analysis showed that GaMV clustered with other species-related marafiviruses. These data support GaMV being a representative member of a novel species in the genus Marafivirus. Furthermore, GaMV was graft-transmissible and 26 of 516 (5.04%) grapevine samples from five provinces in China tested positive by reverse transcription PCR. The coat protein of GaMV isolates shared 91.7–100% and 96.7–100% identities at the nt and aa levels, respectively. The coat protein-based phylogenetic trees revealed three well-defined clusters.

Graphical Abstract

1. Introduction

The International Committee on the Taxonomy of Viruses divides the family Tymoviridae into three genera, Maculavirus, Marafivirus and Tymovirus [1]. These positive single-stranded RNA viruses contain genomes of approximately 6.0–7.5 kb. There are five viruses belonging to the family Tymoviridae that are reported to infect grapevine: Grapevine fleck virus (GFkV), grapevine red globe virus (GRGV), grapevine Syrah virus 1 (GSyV-1), grapevine asteroid mosaic-associated virus (GAMaV) and grapevine rupestris vein feathering virus (GRVFV). Among them, GFkV and GRGV belong to the genus Maculavirus, whereas GSyV-1, GAMaV and GRVFV belong to the genus Marafivirus [2]. GFkV, GRGV, GAMaV and GRVFV are associated with grapevine fleck complex, which is a major grapevine viral disease distributed worldwide [3]. This complex consists of several diseases, including grapevine fleck (FK), grapevine asteroid mosaic (AM), grapevine rupestris necrosis and grapevine rupestris vein feathering. The first recognized disease of this complex in California was AM [4]. It has been successfully transmitted by grafting and is characterized by translucent/chlorotic star-like spots on the foliage of several Vitis vinifera cultivars, as well as the clearing of primary and secondary veins of Vitis rupestris [5]. An isometric virus with morphological traits resembling those of GFkV was purified from AM-affected V. rupestris [5] and named GAMaV. GAMaV was further characterized after its genome was sequenced [6,7,8]. The FK disease has also been reported in California, and it induces symptoms on V. rupestris that are distinct from those of AM. It is characterized by the clearing of the third- and fourth-order veins [9,10]. In Italy, GFkV is associated with the FK-affected V. rupestris [11]. GRVFV is associated with vein feathering on V. rupestris, which is characterized by the transient mild chlorotic discoloration of the primary and secondary leaf veins [3,5]. In addition to the viruses causing these diseases, the grapevine vein-clearing virus is associated with grapevine vein-clearing symptoms, similar to those caused by AM [12].
During a field investigation in 2014, a disease causing obvious vein-clearing symptoms was observed on a ‘Jumeigui’ grapevine in Dalian City, Liaoning Province, China. The symptoms were similar to those of AM caused by the grapevine fleck complex. The possible agent of this disease was thought to be GAMaV or GCVC, but neither was detected by reverse transcription (RT)-PCR in this sample. In 2017, to identify possible viral infections in the diseased grapevine sample, small RNA sequencing (sRNA-seq) and RNA sequencing (RNA-seq) were employed.

2. Results

2.1. Analyses of the High-Throughput Sequencing (HTS) Data

Sequencing of sRNAs and RNAs from symptomatic leaves of the ‘Jumeigui’ grapevine resulted in 18, 599, 455 and 602, 231, 929 clean reads, respectively. The clean data were analyzed to identify viral sequences using VirusDetect software. The sRNA-seq data revealed 17 contigs of 55–286 nt that were homologous to polyproteins of GAMaV (AOX24075), representing 26.6% coverage (Figure S1), and the RNA-seq data revealed 14 contigs of 206–4866 nt that were homologous to polyproteins of oat blue dwarf virus (AAC57874), representing 94.6% coverage (Figure S1). These results indicated the presence of a candidate marafivirus in the ‘Jumeigui’ grapevine sample, which we tentatively named grapevine-associated marafivirus (GaMV). Mapping results showed that 50,789 sRNAs and 12,937 RNAs from sRNA-seq and RNA-seq clean data were derived from GaMV, respectively (Figure 1). Additionally, both sRNA-seq and RNA-seq identified some contigs in the sample that were homologous to sequences ofgrapevine geminivirus A, grapevine leafroll-associated virus-3 (GLRaV-3), grapevine rupestris stem pitting-associated virus, GFkV, grapevine Pinot gris virus, grapevine virus E, grapevine yellow speckle viroid 1, hop stunt viroid and citrus exocortis viroid.

2.2. Sequence and Phylogenetic Analyses of the GaMV Genome

Five overlapping fragments of GaMV isolate JMG were amplified by RT-PCR with specific primers and were assembled into a contiguous sequence by overlapping common regions (in general, approximately 100 bp) of the amplicons. Furthermore, we obtained the intact sequence of the 3′-untranslated regions (UTR) using 3′-rapid amplification of cDNA ends (RACE), and the partial sequences of 5′-end was obtained, after several attempts to produce a longer fragment, using 5′-RACE. Finally, we obtained the nearly complete genome of GaMV (GenBank accession NO. MZ422607), which was 6346 bp, excluding the polyA tail. The nearly complete GaMV sequence showed 51.2–62.3% identities with the genera Marafivirus, Maculavirus and Tymoviruses in the family Tymoviridae (Table 1). The following five domains were identified in the polyprotein using the CD search tool at the National Center for Biotechnology Information database (Figure 1): (i): A viral methyltransferase (Met) (at 113–958 nt), which is found throughout the Alphavirus superfamily and is involved in mRNA capping. It shared 57.2–70.2% nt and 50.0–70.2% aa identities with other members of Tymoviridae; (ii): tThe tymovirus endopeptidase proteolytic domain (Pep) (2264–2569 nt), which may mediate an additional cleavage between the protease and RNA helicase (Hel) domains of the polyprotein [13]. It shared 51.4–57.4% nt and 25.0–47.4% aa identities with other related viruses; (iii): The Hel domain (2,843–3,544 nt). In the N- terminal region of the GaMV Hel domain, a sequence, 952GFAGCGKS959, homologous to the NTP-binding site of RNA viruses was present. The Hel domain showed 57.3–70.7% nt and 50.0–70.2% aa identity levels with those of other related viruses; (iv): the RNA-dependent RNA polymerase domain (4490–5185 nt) shared 63.4–77.6% nt and 63.8–80.7% aa identities with those of other viruses; and (v): the tymovirus coat protein (CP) (5705–6223 nt) shared 39.8–68.2% nt and 22.0–63.4% aa identities with the CP of other tymoviruses. A marafibox-like sequence, CAGGGTGAATTGCTTCA, was found at 5501–5517 nt in the GaMV genome, and it may be the transcriptional promoter that drives the synthesis of a subgenomic RNA encoding only the CP translational reading frame [14].
A phylogenetic tree was constructed to establish the relationships between GaMV and other members of the family Tymoviridae (Figure 2). The nucleotide sequences of the complete genomes from all the approved marafiviruses, and several members of the genera Maculavirus and Tymovirus, were used in the analyses. GaMV clustered together with marafiviruses with high bootstrap values, thereby confirming a close phylogenetic relationship between GaMV and members of the genus Marafivirus (Figure 2).

2.3. Graft-Transmission of GaMV

All the grafted ‘Beta’ grapevines showed obvious symptoms of vein-clearing and chlorotic mottling (Figure 3a–c). At 12 months after grafting, the five grafted ‘Beta’ grapevines tested positive for GaMV using the two specific PCR primer pairs (Figure 3d). In contrast, non-grafted plants tested negative for GaMV and did not show symptoms. These data suggested that GaMV was transmissible by grafting.

2.4. Detection of GaMV in the Field

RT-PCR assays were performed to detect GaMV in 516 samples, and 23 of 516 (4.46%) and 12 of 516 (2.33%) tested positive using the primers CP1a/1b and RP1a/1b, respectively (Table S1), suggesting that the former primer set had a better amplification capability than the latter primer set. In total, 26 of 516 grapevine samples (5.04%), collected from Beijing (1), Liaoning (21), Ningxia (2), Shandong (1) and Sichuan (1) provinces, tested positive for GaMV.

2.5. Sequence Identities of CP Genes and Phylogenetic Relationships between Different GaMV Isolates

The CP sequences from 20 GaMV isolates were obtained to analyze the genetic diversity among GaMV isolates. The sequences of these isolates have been deposited in GenBank (Table 2). For all these isolates, except ML2, the three initially sequenced clones within a single grapevine showed >99.0% nt identity levels. Therefore, more clones of isolate ML2 were sequenced and two variant types, represented by ML2 clone 3 and ML2 clone 5, were identified. The CPs of GaMV isolates showed 91.7–100% and 96.7–100% identities at the nucleotide and amino acid levels, respectively (Table S2). The CP-based phylogenetic tree revealed the existence of three well-defined clusters. The major isolates belonged to group I, whereas isolates ML2 and LF belonged to groups II, and III, respectively (Figure 4).

3. Discussion

More than 80 species of grapevine viruses have been reported [15], to date, and new grapevine viruses continue to be identified, largely owing to HTS technology [16]. Most grapevine viruses are associated with the three major viral disease complexes in grapevine: Infectious degeneration, leafroll and rugose wood. The next most important disease is the grapevine fleck complex, which occurs worldwide [3]. Among the viruses related to the disease, GFkV, GRGV, GSyV-1 and GRVFV have been found in China, but their pathogenicity levels remain poorly understood. Here, we demonstrated an infection caused by a new marafivirus, GaMV, in a grapevine sample showing obvious vein-clearing symptoms. Our results provide new knowledge on the fleck complex caused by viruses in the genus Marafivirus.
The genomic sequences of GaMV in the diseased ‘Jumeigui’ grapevine were confirmed by sRNA-seq, RNA-seq and traditional Sanger sequencing of PCR products. The nearly complete genome of GaMV was also determined by multiple 5′-RACE amplifications, which produced the longest obtainable genomic fragments. The genomic sequence included domains homologous to all five common domains found in other marafiviruses, and it also contained a marafibox-like sequence similar to that conserved in viruses belonging to Marafivirus [14]. Furthermore, the complete genome-based phylogenetic tree revealed that GaMV clustered with other species-related marafiviruses. Additionally, this study demonstrated the graft transmission of GaMV. These characteristics strongly support GaMV being a novel member of the genus Marafivirus.
Vein clearing is a typical symptom of the grapevine fleck complex. Although the symptoms observed on the ‘Jumeigui’ samples were very similar to those of AM, we did not confirm a relationship between GaMV and the disease because the sample contained multiple viruses, including GFkV and grapevine Pinot gris virus. GFkV has been associated with the grapevine fleck complex, whereas GPGV has been putatively associated with a novel grapevine disease, known as grapevine leaf mottling and deformation [17]. Therefore, the pathogenicity of GaMV alone still needs to be determined. The field survey showed that GaMV was present in the field at a moderate rate (5.04%), and analyses of CP genes from different samples indicated that there were variants. Therefore, the potential harm of GaMV to grapevines is a cause for concern because of its graft transmissibility and occurrence status.

4. Materials and Methods

4.1. Plant Material for HTS

A ‘Jumeigui’ grapevine, showing vein-clearing symptoms (Figure 5a,b), was collected from a vineyard of the Dalian Academy of Agricultural Sciences (Dalian City, Liaoning Province, China) in 2014. Cutting propagated from the infected grapevine also showed vein-clearing symptoms (Figure 5c–e). In spring 2017, diseased leaves were collected and frozen rapidly in liquid nitrogen before being preserved in carbon dioxide ice-blocks and shipped to Biomarker Biology Technology (Beijing, China). Transport took 2–3 days.

4.2. HTS and Bioinformatics Analyses

Leaf samples were used to extract total RNAs and generate a cDNA library of sRNAs. sRNA-seq was carried out using an Illumina HiSeq™ 2000 system (SinoGenoMax, Beijing, China), as reported previously [18]. Clean data were obtained by removing sequences <18 nt or >30 nt, low-quality tags, poly-A-tags and N-tags from raw reads. Sequences of potential viruses were identified by analyzing the clean data using VirusDetect (http://virusdetect.feilab.net/cgi-bin/virusdetect/index.cgi/) [19]. For RNA-seq, the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA) was used to remove ribosomal RNA from extracts of total RNA. The ribosomal RNA-depleted RNA sample was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina HiSeq 4000 platform with a paired-end 150-bp format (Biomarker Biology Technology). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat software [20]. Unmapped reads were used for de novo assembly and BLAST analyses embedded in VirusDetect.

4.3. Amplification and Analyses of the GaMV Genome

Five primer pairs were designed on the basis of contig sequences and were used to amplify GaMV genomic sequences (Table 3). PCR fragments were recovered, purified and then cloned into the Zero Background pTOPO-Blunt vector (Aidlab, Beijing, China). At least three positive clones of each PCR product were sequenced at Shanghai Sangon Biological Engineering & Technology (Shanghai, China). The 5′- and 3′-UTRs were amplified by the RACE strategy using a SMARTer® RACE 5′/3′ Kit (TaKaRa) in accordance with the manufacturer’s instructions.

4.4. Sequence Analyses

The tool ORF Finder at the National Center for Biotechnology Information was used to search for potential open reading frames in the genomic RNA of GaMV. The CD search tool was used to search for conserved domains. The nucleotide and amino acid sequences were compared with those of other marafiviruses using ClustalW2 (www.ebi.ac.uk/Tools/msa/clustalw2/). For phylogenetic analyses, the representative members of the genera Marafivirus, Maculavirus and Tymoviruses in the family Tymoviridae were used. Neighbor-joining trees were constructed using Molecular Evolutionary Genetics Analysis (MEGA) 7.1 (www.megasoftware.net/).

4.5. Graft-Transmission Assays

Graft transmissibility was assessed in July 2019 by grafting GaMV-infected grapevine buds onto 2-year-old ‘Beta’ grapevine seedlings with five replicates. These seedlings had tested negative for GaMV and the following other major viruses reported in China: GLRaV-1, -2, -3, -4, -7 and -13, grapevine rupestris stem pitting-associated virus, GFkV, grapevine fanleaf virus, grapevine virus A(GVA), GVB, GVE, grapevine Pinot gris virus, grapevine berry inner necrosis virus, grapevine fabavirus, GRVFV, grapevine geminivirus A, GSyV-1 and GRGV. Inoculated seedlings were maintained in a greenhouse under natural conditions for symptom development. At 3, 6 and 12 months after inoculation, grafted grapevines were monitored continuously for symptom development. Total RNAs were extracted from the leaves of the grafted ‘Beta’ grapevines using the method described by MacKenzie and colleagues [21] with slight modifications [22]. Two primer pairs, RP1a/1b (5′-AAGACTCAGCACAAGGTCAACGAG-3′ and 5′-CACGGCTTCTACCGGGAGGAG-3′) and CP1a/1b (5′-GATTCTCGCATTGATGCTCAGC-3′ and 5′-TAGATGGTGTAGGAGTAGCGG -3′), were used to amplify the 780-bp fragment of the RdRP and the 458-bp fragment of the CP gene, respectively, which were used in the RT-PCR detection of GaMV in these samples.

4.6. Survey of GaMV in the Field Samples

To survey GaMV prevalence, 516 grapevines, representing 71 cultivars, were randomly collected from 21 provinces in China. Total RNA extraction and RT-PCR detection were carried out as described in Section 4.5. The PCR products that were assessed positive for the CP gene were cloned and sequenced, as described in Section 4.3.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/plants10071487/s1, Figure S1: Contigs from sRNA-seq; and (a) RNA-seq data (b) mapped to the reference genomes of two marafiviruses, Table S1: The grapevine samples tested positive for grapevine-associated marafivirus (GaMV) using the primers CP1a/1b and RP1a/1b, Table S2: Sequence identities of CP genes among different grapevine-associated marafivirus (GaMV) isolates.

Author Contributions

X.F. and Y.D. conceived and designed the experiments. X.F., and Z.Z. collected the samples. X.F., C.L., F.R., G.H., B.Z. and Y.D. conducted the experiments and analyzed data. X.F., C.L. and Y.D. discussed the results, and drafted and revised the manuscript. All authors approved the final draft of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Key R&D Program of China (2019YFD1001800) and China Agriculture Research System of MOF and MARA.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data have been presented in the manuscript and supplementary materials, so the study did not report other data.

Acknowledgments

We thank Haifeng Ma of Dalian Modern Agricultural Production Development Service Center, China for help in sample collection. We thank Liwen Bianji (Edanz) (www.liwenbianji.cn, accessed on 20 June 2021) for editing the language of a draft of this manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dreher, T.W.; Edwards, M.C.; Gibbs, A.J.; Haenni, A.L.; Hammond, R.W.; Jupin, I.; Koenig, R.; Sabanadzovic, S.; Martelli, G.P. Tymoviridae. In Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses; King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E., Eds.; Academic Press: Cambridge, MA, USA, 2012; pp. 944–952. [Google Scholar]
  2. Cretazzo, E.; Velasco, L. High-throughput sequencing allowed the completion of the genome of grapevine Red Globe virus and revealed recurring co-infection with other tymoviruses in grapevine. Plant Pathol. 2017, 66, 1202–1213. [Google Scholar] [CrossRef]
  3. Martelli, G.P. Directory of virus and virus-like diseases of the grapevine and their agents. J. Plant Pathol. 2014, 96, 1–136. [Google Scholar]
  4. Hewitt, W.B. Some virus and virus-like diseases of grapevines. Bull. Calif. Dep. Agric. 1954, 43, 47–64. [Google Scholar]
  5. Boscia, D.; Sabanadzovic, S.; Savino, V.; Kyriakopoulou, P.E.; Martelli, G.P. A non mechanically transmissible virus associated with asteroid mosaic of the grapevine. Vitis 1994, 33, 101–102. [Google Scholar]
  6. Sabanadzovic, S.; Abou-Ghanem, N.; Digiaro, M.; Castellano, M.; Martelli, G.P. Grapevine fleck virus-like viruses in Vitis. Arch. Virol. 2000, 145, 553–565. [Google Scholar] [CrossRef] [PubMed]
  7. Abou Ghanem-Sabanadzovic, N.A.; Sabanadzovic, S.; Martelli, G.P. Sequence analysis of the 3′end of three grapevine fleck virus-like viruses from grapevine. Virus Genes 2003, 27, 11–16. [Google Scholar] [CrossRef]
  8. Vargas-Asencio, J.; Wojciechowska, K.; Baskerville, M.; Gomez, A.L.; Perry, K.L.; Thompson, J.R. The complete nucleotide sequence and genomic characterization of grapevine asteroid mosaic associated virus. Virus Res. 2017, 227, 82–87. [Google Scholar] [CrossRef]
  9. Hewitt, W.B.; Goheen, A.C.; Raski, D.J.; Gooding, G.V., Jr. Studies on virus diseases of the grapevine in California. Vitis 1962, 3, 57–83. [Google Scholar]
  10. Hewitt, W.B.; Goheen, A.C.; Cory, L.; Luhn, C. Grapevine fleck disease, latent in many varieties, is transmitted by graft inoculation. Ann. Phytopathol. 1972, 1972, 43–47. [Google Scholar]
  11. Boscia, D.; Martelli, G.P.; Savino, V.; Castellano, M.A. Identification of the agent of grapevine fleck disease. Vitis 1991, 30, 97–105. [Google Scholar]
  12. Zhang, Y.; Singh, K.; Kaur, R.; Qiu, W. Association of a novel DNA virus with the grapevine vein-clearing and vine decline syndrome. Phytopathology 2011, 101, 1081–1090. [Google Scholar] [CrossRef] [Green Version]
  13. Jakubiec, A.; Drugeon, G.; Camborde, L.; Jupin, I. Proteolytic Processing of Turnip Yellow Mosaic Virus Replication Proteins and Functional Impact on Infectivity. J. Virol. 2007, 81, 11402–11412. [Google Scholar] [CrossRef] [Green Version]
  14. Izadpanah, K.; Zhang, Y.P.; Daubert, S.; Masumi, M.; Rowhani, A. Sequence of the coat protein gene of Bermuda grass etched-line virus, and of the adjacent ‘marafibox’ motif. Virus Genes 2002, 24, 131–134. [Google Scholar] [CrossRef]
  15. Umer, M.; Liu, J.; You, H.; Xu, C.; Dong, K.; Luo, N.; Kong, L.; Li, X.; Hong, N.; Wang, G.; et al. Genomic, Morphological and Biological Traits of the Viruses Infecting Major Fruit Trees. Viruses 2019, 11, 515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Maliogka, V.; Minafra, A.; Saldarelli, P.; Ruiz-García, A.; Glasa, M.; Katis, N.; Olmos, A. Recent advances on detection and characterization of fruit tree viruses using high-throughput sequencing technologies. Viruses 2018, 10, 436. [Google Scholar] [CrossRef] [Green Version]
  17. Bianchi, G.L.; De Amicis, F.; De Sabbata, L.; Di Bernardo, N.; Governatori, G.; Nonino, F.; Prete, G.; Marrazzo, T.; Versolatto, S.; Frausin, C. Occurrence of grapevine Pinot gris virus in Friuli Venezia Giulia (Italy): Field monitoring and virus quantification by real-time RT-PCR. EPPO Bull. 2015, 45, 22–32. [Google Scholar] [CrossRef]
  18. Fan, X.D.; Hong, N.; Zhang, Z.P.; Ren, F.; Hu, G.J.; Li, Z.N.; Zhou, J.; Dong, Y.F.; Wang, G.P. Identification of a divergent variant of grapevine berry inner necrosis virus in grapevines showing chlorotic mottling and ring spot symptoms. Arch. Virol. 2016, 161, 2025–2027. [Google Scholar] [CrossRef] [PubMed]
  19. Zheng, Y.; Gao, S.; Padmanabhan, C.; Li, R.; Galvez, M.; Gutierrez, D.; Fuentes, S.; Ling, K.S.; Fei, Z.J. VirusDetect: An automated pipeline for efficient virus discovery using deep sequencing of small RNAs. Virology 2017, 500, 130–138. [Google Scholar] [CrossRef] [PubMed]
  20. Kim, D.; Langmead, B.; Salzberg, S. HISAT: A fast spliced aligner with low memory requirements. Nat. Meth. 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. MacKenzie, D.J.; Mclean, M.A.; Mukerji, S.; Grenn, M. Improved RNA extraction from woody plants for the detection of viral pathogens by reverse transcription-polymerase chain reaction. Plant Dis. 1997, 81, 222–226. [Google Scholar] [CrossRef] [Green Version]
  22. Fan, X.D.; Hong, N.; Dong, Y.F.; Ma, Y.X.; Zhang, Z.P.; Ren, F.; Hu, G.J.; Zhou, J.; Wang, G.P. Genetic diversity and recombination analysis of grapevine leafroll-associated virus 1 from China. Arch. Virol. 2015, 160, 1669–1678. [Google Scholar] [CrossRef] [PubMed]
Figure 1. SRNA and RNA reads mapped to the genome of grapevine-associated marafivirus (GaMV). MT, methyltransferase; Pro, protease; Hel, helicase; RdRP, RNA−dependent RNA polymerase; CP, coat protein; A(n), poly(A) tail.
Figure 1. SRNA and RNA reads mapped to the genome of grapevine-associated marafivirus (GaMV). MT, methyltransferase; Pro, protease; Hel, helicase; RdRP, RNA−dependent RNA polymerase; CP, coat protein; A(n), poly(A) tail.
Plants 10 01487 g001
Figure 2. Neighbor-joining phylogenetic tree generated from the genomic sequences of grapevine-associated marafivirus (GaMV) and other members of the genera Marafivirus, Maculavirus and Tymovirus in the family Tymoviridae.
Figure 2. Neighbor-joining phylogenetic tree generated from the genomic sequences of grapevine-associated marafivirus (GaMV) and other members of the genera Marafivirus, Maculavirus and Tymovirus in the family Tymoviridae.
Plants 10 01487 g002
Figure 3. Testing the transmission of grapevine-associated marafivirus (GaMV) to grapevines. (a) a grafted ‘Beta’ grapevine; (b,c) partially enlarged images of (a); (d) Reverse transcription PCR (RT-PCR) detection of GaMV in five grafted grapevines using two sets of specific primers. Lane 1–5, grafted grapevine samples; P, positive control; N, negative control; M, DNA marker DL5000 (TaKaRa).
Figure 3. Testing the transmission of grapevine-associated marafivirus (GaMV) to grapevines. (a) a grafted ‘Beta’ grapevine; (b,c) partially enlarged images of (a); (d) Reverse transcription PCR (RT-PCR) detection of GaMV in five grafted grapevines using two sets of specific primers. Lane 1–5, grafted grapevine samples; P, positive control; N, negative control; M, DNA marker DL5000 (TaKaRa).
Plants 10 01487 g003
Figure 4. Neighbor-joining phylogenetic tree generated using CP gene sequences of grapevine-associated marafivirus (GaMV) isolates.
Figure 4. Neighbor-joining phylogenetic tree generated using CP gene sequences of grapevine-associated marafivirus (GaMV) isolates.
Plants 10 01487 g004
Figure 5. Symptoms on the leaves of a ‘Jumeigui’ grapevine infected with grapevine-associated marafivirus (GaMV). (a,b) vein-clearing symptoms on GaMV-infected grapevine leaves; (c) cut seedlings propagated from the GaMV-infected plant; (d,e) enlarged images of the diseased leaves of (c).
Figure 5. Symptoms on the leaves of a ‘Jumeigui’ grapevine infected with grapevine-associated marafivirus (GaMV). (a,b) vein-clearing symptoms on GaMV-infected grapevine leaves; (c) cut seedlings propagated from the GaMV-infected plant; (d,e) enlarged images of the diseased leaves of (c).
Plants 10 01487 g005
Table 1. Percentage identities for different polyprotein domains of representative viruses compared with grapevine-associated marafivirus (GaMV).
Table 1. Percentage identities for different polyprotein domains of representative viruses compared with grapevine-associated marafivirus (GaMV).
VirusGenomeMetPepHelRdRpCP
Length%nt%nt%aa%nt%aa%nt%aa%nt%aa%nt%aa
BlVS646361.069.365.655.045.766.565.674.280.765.559.3
CSDaV680558.367.565.651.838.366.565.672.479.364.561.5
GAMaV671962.371.269.557.444.370.769.577.680.568.263.4
GSyV-1648157.166.260.654.642.462.060.670.269.555.641.9
MRFV633760.566.964.556.343.563.064.572.376.861.848.0
NeVM647159.566.466.355.044.367.266.374.981.161.457.0
OBDV650962.070.270.254.341.267.270.276.881.166.756.7
OlV-3714855.362.962.454.447.458.362.470.672.756.152.0
PeVD657356.666.963.554.644.463.063.572.880.254.339.6
GRVFV657754.764.360.552.142.661.660.571.474.355.341.8
GFkV756455.463.750.055.825.063.250.069.064.751.934.0
GRGV685052.265.058.256.340.763.758.266.563.849.831.7
APLV633751.260.555.951.437.259.155.963.563.840.528.0
TYMV631852.557.254.353.136.557.354.363.464.439.822.0
Blackberry virus S, BlVS; citrus sudden death-associated virus, CSDaV; grapevine asteroid mosaic-associated virus, GAMaV; grapevine Syrah virus-1, GSyV-1; maize rayado fino virus, MRFV; nectarine marafivirus M, NeVM; oat blue dwarf virus, OBDV; olive latent virus 3, OlV-3; peach marafivirus D, PeVD; grapevine rupestris vein feathering virus, GRVFV; grapevine fleck virus, GFkV; grapevine red globe virus, GRGV; andean potato latent virus, APLV; and turnip yellow mosaic virus, TYMV.
Table 2. Details of grapevine-associated marafivirus (GaMV) isolates generated and analyzed in this study.
Table 2. Details of grapevine-associated marafivirus (GaMV) isolates generated and analyzed in this study.
Isolate IDSampleslocationGenBank Accession Number
BXWH1BixiangwuheLiaoningMZ422608
HMHeimiLiaoningMZ422609
HFDHafudeLiaoningMZ422610
ZZZizaoLiaoningMZ422611
JZJJinzaojingLiaoningMZ422612
DWSMGDengwasimeiguiLiaoningMZ422613
ThS1Thompson SeedlessLiaoningMZ422614
MHMuscat HamburgLiaoningMZ422615
CrSCrimson SeedlessLiaoningMZ422616
RS1Ruby SeedlessLiaoningMZ422617
MKMuscat KyohoLiaoningMZ422618
Ths2Thompson SeedlessLiaoningMZ422619
JFYNJiafeiyinvLiaoningMZ422620
BXWH2BixiangwuheLiaoningMZ422621
RS2Ruby SeedlessLiaoningMZ422622
OSOtilia SeedlessLiaoningMZ422623
LFLefuLiaoningMZ422624
XFXiagnfeiLiaoningMZ422625
ML1MerlotShandongMZ422626
ML2MerlotSichuanMZ422627-28
Table 3. Primers designed for PCR amplification of the grapevine-associated marafivirus (GaMV) genome.
Table 3. Primers designed for PCR amplification of the grapevine-associated marafivirus (GaMV) genome.
Primer NamePrimer Sequence (5′→3′)Position
GaMV-1FACCATCCACCGGGACACCATC38–58
GaMV-1RATGTAGGGGATGGAAGAGCTC1564–1544
GaMV-2FACCCGCCTTCCTCTGGGCTTG1450–1470
GaMV-2RGTGGCGCGGAAGTTGAAGAAG2445–2425
GaMV-3FGAGGATCTCTGGTCCGCTCTC2318–2338
GaMV-3RGGCGGTCGAGAAGAATGTAGC3470–3450
GaMV-4FATCCTGACCAACTCGCAGAAC 3350–3370
GaMV-4RGGCTCGAAATCAAGGACGGAG5007–4987
GaMV-5FCACTCACCTGCATGCGGCTCA4863–4883
GaMV-5RGTAGAAGGAGGTTTCGGTGCC6001–5981
GaMV 5′-outer TCTGAAGAAAGTCATGGCCGG180–160
GaMV 5′-innerAACGATGAGGCGTTGATGCCG159–139
GaMV 3′-outerTCCGCCTTCATCACCGACGAC5804–5824
GaMV 3′-innerTCTGAAGAAAGTCATGGCCGG5842–5862
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Fan, X.; Zhang, Z.; Li, C.; Ren, F.; Hu, G.; Zhang, B.; Dong, Y. High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms. Plants 2021, 10, 1487. https://doi.org/10.3390/plants10071487

AMA Style

Fan X, Zhang Z, Li C, Ren F, Hu G, Zhang B, Dong Y. High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms. Plants. 2021; 10(7):1487. https://doi.org/10.3390/plants10071487

Chicago/Turabian Style

Fan, Xudong, Zunping Zhang, Chen Li, Fang Ren, Guojun Hu, Baodong Zhang, and Yafeng Dong. 2021. "High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms" Plants 10, no. 7: 1487. https://doi.org/10.3390/plants10071487

APA Style

Fan, X., Zhang, Z., Li, C., Ren, F., Hu, G., Zhang, B., & Dong, Y. (2021). High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms. Plants, 10(7), 1487. https://doi.org/10.3390/plants10071487

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop