Histone Deacetylase Inhibitors Increase the Embryogenic Potential and Alter the Expression of Embryogenesis-Related and HDAC-Encoding Genes in Grapevine (Vitis vinifera L., cv. Mencía)
Abstract
1. Introduction
2. Results
2.1. Effect of Histone Deacetylase Inhibitors on the Embryogenic Potential of Different Grapevine Explants
2.2. Effect of the Histone Deacetylase Inhibitor NaB on the Expression of Somatic Embryogenesis-Related Genes and HDAC-Encoding Genes in Grapevine Cotyledonary Somatic Embryos
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Effect of Treatment with Histone Deacetylase Inhibitors on the Embryogenic Potential of Different Grapevine Explants
4.3. Histological Analysis
4.4. Total RNA Extraction and cDNA Synthesis
4.5. Primer Design
4.6. Real-Time PCR
4.7. Data and Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Yang, X.; Zhang, X. Regulation of somatic embryogenesis in higher plants. CRC Crit. Rev. Plant Sci. 2010, 29, 36–57. [Google Scholar] [CrossRef] [Scilit]
- Dhekney, S.A.; Basford, A.T.; Chhatre, V.E.; Rosenberg, M.B.; Claflin, C.; Sessions, S.K.; Li, Z.J.; Gray, D.J. Vitis spp. Grape. In Biotechnology of Fruit and Nut Crops, 2nd ed.; Litz, R.E., Pliego-Alfaro, F., Hormaza, J.I., Eds.; CAB International: Boston, MA, USA, 2020; pp. 655–674. [Google Scholar]
- Martinelli, L.; Gribaudo, I. Strategies for effective somatic embryogenesis in grapevine: An appraisal. In Grapevine Molecular Physiology & Biotechnology; Roubelakis-Angelakis, K.A., Ed.; Springer: Dordrecht, The Netherlands, 2009; pp. 461–493. [Google Scholar] [CrossRef] [Scilit]
- Gribaudo, I.; Gambino, G.; Vallania, R. Somatic embryogenesis from grapevine anthers: The optimal developmental stage for collecting explants. Am. J. Enol. Vitic. 2004, 55, 427–430. [Google Scholar]
- Dhekney, S.A.; Li, Z.T.; Gray, D.J. Optimizing initiation and maintenance of Vitis embryogenic cultures. HortScience 2009, 44, 1400–1406. [Google Scholar] [CrossRef] [Scilit]
- Prado, M.J.; Grueiro, M.P.; González, M.V.; Testillano, P.S.; Domínguez, C.; López, M.; Rey, M. Efficient plant regeneration through somatic embryogenesis from anthers and ovaries of six autochthonous grapevine cultivars from Galicia (Spain). Sci. Hortic. Amst. 2010, 125, 342–352. [Google Scholar] [CrossRef] [Scilit]
- López-Pérez, A.J.; Carreño, J.; Martínez-Cutillas, A.; Dabauza, M. High embryogenic ability and plant regeneration of table grapevine cultivars (Vitis vinifera L.) induced by activated charcoal. Vitis 2005, 44, 79–85. [Google Scholar] [CrossRef]
- Morgana, C.; Di Lorenzo, R.; Carimi, F. Somatic embryogenesis of Vitis vinifera L. (cv. Sugraone) from stigma and style culture. Vitis 2004, 43, 169–173. [Google Scholar] [CrossRef]
- Nakajima, I.; Matsuta, N. Somatic embryogenesis from filaments of Vitis vinifera L. and Vitis labruscana Bailey. Vitis 2003, 42, 53–54. [Google Scholar] [CrossRef]
- Acanda, Y.; Prado, M.J.; González, M.V.; Rey, M. Somatic embryogenesis from stamen filaments in grapevine (Vitis vinifera L. cv. Mencía): Changes in ploidy level and nuclear DNA content. In Vitro Cell. Dev. Biol. Plant 2013, 49, 276–284. [Google Scholar] [CrossRef] [Scilit]
- Gambino, G.; Ruffa, P.; Vallania, R.; Gribaudo, I. Somatic embryogenesis from whole flowers, anthers and ovaries of grapevine (Vitis spp.). Plant Cell Tissue Organ Cult. 2007, 90, 79–83. [Google Scholar] [CrossRef] [Scilit]
- Maillot, P.; Deglène-Benbrahim, L.; Walter, B. Efficient somatic embryogenesis from meristematic explants in grapevine (Vitis vinifera L.) cv. Chardonnay: An improved protocol. Trees Struct. Funct. 2016, 30, 1377–1387. [Google Scholar] [CrossRef] [Scilit]
- Das, D.K.; Reddy, M.K.; Upadhyaya, K.C.; Sopory, S.K. Grape (Vitis vinifera L.). In Protocol for Somatic Embryogenesis in Woody Plants; Jain, S.M., Gupta., P.K., Eds.; Springer: Dordrecht, The Netherlands, 2005; pp. 301–308. [Google Scholar]
- Hecht, V.; Vielle-Calzada, J.P.; Hartog, M.V.; Schmidt, E.D.; Boutilier, K.; Grossniklaus, U.; de Vries, S.C. The Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR KINASE 1 gene is expressed in developing ovules and embryos and enhances embryogenic competence in culture. Plant Physiol. 2001, 127, 803–816. [Google Scholar] [CrossRef]
- Boutilier, K.; Offringa, R.; Sharma, V.K.; Kieft, H.; Ouellet, T.; Zhang, L.; Hattori, J.; Liu, C.-M.; van Lammeren, A.A.M.; Miki, B.L.A.; et al. Ectopic expression of BABY BOOM triggers a conversion from vegetative to embryonic growth. Plant Cell 2002, 14, 1737–1749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zuo, J.; Niu, Q.W.; Frugis, G.; Chua, N.H. The WUSCHEL gene promotes vegetative-to- embryonic transition in Arabidopsis. Plant J. 2002, 30, 349–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elhiti, M.; Stasolla, C.; Wang, A. Molecular regulation of plant somatic embryogenesis. In Vitro Cell. Dev. Biol. Plant 2013, 49, 631–642. [Google Scholar] [CrossRef] [Scilit]
- Schellenbaum, P.; Jacques, A.; Maillot, P.; Bertsch, C.; Mazet, F.; Farine, S.; Walter, B. Characterization of VvSERK1, VvSERK2, VvSERK3 and VvL1L genes and their expression during somatic embryogenesis of grapevine (Vitis vinifera L.). Plant Cell Rep. 2008, 27, 1799–1809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Licausi, F.; Giorgi, F.M.; Zenoni, S.; Osti, F.; Pezzotti, M.; Perata, P. Genomic and transcriptomic analysis of the AP2/ERF superfamily in Vitis vinifera. BMC Genom. 2010, 11, 719. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gambino, G.; Minuto, M.; Boccacci, P.; Perrone, I.; Vallania, R.; Gribaudo, I. Characterization of expression dynamics of WOX homeodomain transcription factors during somatic embryogenesis in Vitis vinifera. J. Exp. Bot. 2011, 62, 1089–1101. [Google Scholar] [CrossRef] [Scilit]
- Us-Camas, R.; Rivera-Solís, G.; Duarte-Aké, F.; De-la-Peña, C. In Vitro culture: An epigenetic challenge for plants. Plant Cell Tissue Organ Cult. 2014, 118, 187–201. [Google Scholar] [CrossRef] [Scilit]
- Sugimoto, K.; Temman, H.; Kadokura, S.; Matsunaga, S. To regenerate or not to regenerate: Factors that drive plant regeneration. Curr. Opin. Plant Biol. 2019, 47, 138–150. [Google Scholar] [CrossRef] [Scilit]
- Berger, S.L. The complex language of chromatin regulation during transcription. Nature 2007, 447, 407–412. [Google Scholar] [CrossRef] [Scilit]
- Shahbazian, M.D.; Grunstein, M. Functions of site-specific histone acetylation and deacetylation. Annu. Rev. Biochem. 2007, 76, 75–100. [Google Scholar] [CrossRef] [Scilit]
- Hollender, C.; Liu, Z. Histone deacetylase genes in Arabidopsis development. J. Integr. Plant Biol. 2008, 50, 875–885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, X.; Lv, S.; Zhang, C.; Yang, C. Histone deacetylases and their functions in plants. Plant Cell Rep. 2013, 32, 465–478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aquea, F.; Timmermann, T.; Arce-Johnson, P. Analysis of histone acetyltransferase and deacetylase families of Vitis vinifera. Plant Physiol. Biochem. 2010, 48, 194–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tai, H.H.; Tai, G.C.C.; Beardmore, T. Dynamic histone acetylation of late embryonic genes during seed germination. Plant Mol. Biol. 2005, 59, 909–925. [Google Scholar] [CrossRef] [Scilit]
- Wakeel, A.; Imran, A.; Ali, R.K.; Minjie, W.; Sakila, U.; Dongdong, L.; Bohan, L.; Yinbo, G. Involvement of histone acetylation and deacetylation in regulating auxin responses and associated phenotypic changes in plants. Plant Cell Rep. 2018, 37, 51–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uddenberg, D.; Valladares, S.; Abrahamsson, M.; Sundström, J.F.; Sundås-Larsson, A.; von Arnold, S. Embryogenic potential and expression of embryogenesis-related genes in conifers are affected by treatment with a histone deacetylase inhibitor. Planta 2011, 234, 527–539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Soriano, M.; Cordewener, J.; Muiño, J.M.; Riksen, T.; Fukuoka, H.; Angenent, G.C.; Boutilier, K. The histone deacetylase inhibitor trichostatin A promotes totipotency in the male gametophyte. Plant Cell 2014, 26, 195–209. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, M.; Kikuchi, A.; Kamada, H. The Arabidopsis histone deacetylases HDA6 and HDA19 contribute to the repression of embryonic properties after germination. Plant Physiol. 2008, 146, 149–161. [Google Scholar] [CrossRef] [Scilit]
- Bond, D.M.; Dennis, E.S.; Pogson, B.J.; Finnegan, E.J. Histone acetylation, VERNALIZATION INSENSITIVE 3, FLOWERING LOCUS C, and the vernalization response. Mol. Plant 2009, 2, 724–737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nguyen, H.N.; Kim, J.H.; Jeong, C.Y.; Hong, S.W.; Lee, H. Inhibition of histone deacetylation alters Arabidopsis root growth in response to auxin via PIN1 degradation. Plant Cell Rep. 2013, 32, 1625–1636. [Google Scholar] [CrossRef] [Scilit]
- Cui, Y.; Ling, Y.; Zhou, J.; Li, X. Interference of the histone deacetylase inhibits pollen germination and pollen tube growth in Picea wilsonii Mast. PLoS ONE 2015, 10, e0145661. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.; Zhang, C.; Zhang, B.; Yang, C.; Li, S. Identification of genes regulated by histone acetylation during root development in Populus trichocarpa. BMC Genom. 2016, 17, 96. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Wang, P.; Hou, H.; Zhang, H.; Tan, J.; Huang, Y.; Li, Y.; Wu, J.; Qiu, Z.; Li, L. Histone acetylation and reactive oxygen species are involved in the preprophase arrest induced by sodium butyrate in maize roots. Protoplasma 2017, 254, 167–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, M.H.; Lee, J.; Choi, S.H.; Jie, E.Y.; Jeong, J.C.; Kim, C.Y.; Kim, S.W. The effect of sodium butyrate on adventitious shoot formation varies among the plant species and the explant types. Int. J. Mol. Sci. 2020, 21, 8451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Acanda, Y.; Martínez, Ó.; Prado, M.J.; González, M.V.; Rey, M. Changes in abscisic acid metabolism in relation to the maturation of grapevine (Vitis vinifera L., cv. Mencía) somatic embryos. BMC Plant Biol. 2020, 20, 487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, L.-C.; Deng, B.; Liu, S.; Li, L.-M.; Hu, B.; Zhong, Y.-T.; Li, L. Isolation and characterization of an osmotic stress and ABA induced histone deacetylase in Arachis hygogaea. Front. Plant Sci. 2015, 6, 512. [Google Scholar] [CrossRef] [Scilit]
- Awada, R.; Verdier, D.; Froger, S.; Brulard, E.; de Faria Maraschin, S.; Etienne, H.; Breton, D. An innovative automated active compound screening system allows high-throughput optimization of somatic embryogenesis in Coffea arabica. Sci. Rep. 2020, 10, 810. [Google Scholar] [CrossRef] [Scilit]
- Stamp, J.A.; Meredith, C.P. Somatic embryogenesis from leaves and anthers of grapevine. Sci. Hortic. 1988, 35, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Matsuta, N.; Hirabayashi, T. Embryogenic cell lines from somatic embryos of grape (Vitis vinifera L.). Plant Cell Rep. 1989, 7, 684–687. [Google Scholar] [CrossRef] [Scilit]
- Martinelli, L.; Bragagna, P.; Poletti, V.; Scienza, A. Somatic embryogenesis from leaf and petiole derived callus of Vitis rupestris. Plant Cell Rep. 1993, 12, 207–210. [Google Scholar] [CrossRef] [Scilit]
- Nakano, M.; Sakakibara, T.; Watanabe, Y.; Mii, M. Establishment of embryogenic cultures in several cultivars of Vitis vinifera and V. x labruscana. Vitis 1997, 36, 141–145. [Google Scholar] [CrossRef]
- Das, D.K.; Reddy, M.K.; Upadhyaya, K.C.; Sopory, S.K. An efficient leaf-disc culture method for the regeneration via somatic embryogenesis and transformation of grape (Vitis vinifera L.). Plant Cell Rep. 2002, 20, 999–1005. [Google Scholar] [CrossRef] [Scilit]
- Salunke, C.K.; Rao, P.S.; Mhatre, M. Induction of somatic embryogenesis and plantlets in tendrils of Vitis vinifera L. Plant Cell Rep. 1997, 17, 65–67. [Google Scholar] [CrossRef] [Scilit]
- Maillot, P.; Kieffer, F.; Walter, B. Somatic embryogenesis from stem nodal sections of grapevine. Vitis 2006, 45, 185–189. [Google Scholar] [CrossRef]
- Birnbaum, K.D.; Alvarado, A.S. Slicing across kingdoms: Regeneration in plants and animals. Cell 2008, 132, 697–710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klimaszewska, K.; Pelletier, G.; Overton, C.; Stewart, D.; Rutledge, R.G. Hormonally regulated overexpression of Arabidopsis WUS and conifer LEC1 (CHAP3A) in transgenic white spruce: Implications for somatic embryo development and somatic seedling growth. Plant Cell Rep. 2010, 29, 723–734. [Google Scholar] [CrossRef] [Scilit]
- Horstman, A.; Bemer, M.; Boutilier, K. A transcriptional view on somatic embryogenesis. Regeneration 2017, 4, 201–216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.M.; Wang, Y.; Wu, Y.; Ni, B.; Liang, Z. Sodium butyrate promotes the differentiation of rat bone marrow mesenchymal stem cells to smooth muscle cells through histone acetylation. PLoS ONE 2014, 9, e116183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, V.; Bhatia, H.S.; Kumar, A.; de Oliveira, A.C.P.; Fiebich, B.L. Histone deacetylase inhibitors valproic acid and sodium butyrate enhance prostaglandins release in lipopolysaccharide-activated primary microglia. Neuroscience 2014, 265, 147–157. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Tang, Y.; Liu, H.; Guo, F.; Ni, J.; Le, W. Suppression of histone deacetylation promotes the differentiation of human pluripotent stem cells towards neural progenitor cells. BMC Biol. 2014, 12, 95. [Google Scholar] [CrossRef]
- De-la-Peña, C.; Nic-Can, G.I.; Galaz-Ávalos, R.M.; Avilez-Montalvo, R.; Loyola-Vargas, V.M. The role of chromatin modifications in somatic embryogenesis in plants. Front. Plant Sci. 2015, 6, 635. [Google Scholar] [CrossRef] [Scilit]
- Wójcikowska, B.; Wójcik, A.M.; Gaj, M.D. Epigenetic regulation of auxin-induced somatic embryogenesis in plants. Int. J. Mol. Sci. 2020, 21, 2307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abrahamsson, M.; Valladares, S.; Merino, I.; Larsson, E.; von Arnold, S. Degeneration pattern in somatic embryos of Pinus sylvestris L. In Vitro Cell. Dev. Biol. Plant 2017, 53, 86–96. [Google Scholar] [CrossRef] [Scilit]
- Jiang, F.; Ryabova, D.; Diedhiou, J.; Hucl, P.; Randhawa, H.; Marillia, E.-F.; Foroud, N.A.; Eudes, F.; Kathiria, P. Trichostatin A increases embryo and green plant regeneration in wheat. Plant Cell Rep. 2017, 36, 1701–1706. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.M.; Enns, J.L.; Nelson, K.L.; Brost, J.M.; Orr, T.D.; Ferrie, A.M.R. Improving the efficiency of wheat microspore culture methodology: Evaluation of pretreatments, gradients, and epigenetic chemicals. Plant Cell Tissue Organ Cult. 2019, 139, 589–599. [Google Scholar] [CrossRef] [Scilit]
- Wójcikowska, B.; Botor, M.; Moronczyk, J.; Wójcik, A.M.; Nodzynski, T.; Karcz, J.; Gaj, M.D. Trichostatin A triggers an embryogenic transition in Arabidopsis explants via an auxin-related pathway. Front. Plant Sci. 2018, 9, 1353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Zhang, Y.; Gao, Y.; Jiang, X.; Zhang, M.; Wu, H.; Liu, Z.; Feng, H. Effects of histone deacetylase inhibitors on microspore embryogenesis and plant regeneration in Pakchoi (Brassica rapa ssp. chinensis L.). Sci. Hortic. 2016, 209, 61–66. [Google Scholar] [CrossRef] [Scilit]
- Schmidt, E.D.; Guzzo, F.; Toonen, M.A.; de Vries, S.C. A leucine-rich repeat containing receptor-like kinase marks somatic plant cells competent to form embryos. Development 1997, 124, 2049–2062. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maillot, P.; Lebel, S.; Schellenbaum, P.; Jacques, A.; Walter, B. Differential regulation of SERK, LEC1-like and pathogenesis-related genes during indirect secondary somatic embryogenesis in grapevine. Plant Physiol. Biochem. 2009, 47, 743–752. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Srinivasan, C.; Liu, Z.; Heidmann, I.; Supena, E.D.J.; Fukuoka, H.; Joosen, R.; Lambalk, J.; Angenent, G.; Scorza, R.; Custers, J.B.M.; et al. Heterologous expression of the BABY BOOM AP2/ERF transcription factor enhances the regeneration capacity of tobacco (Nicotiana tabacum L.). Planta 2007, 225, 341–351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imin, N.; Nizamidin, M.; Wu, T.; Rolfe, B.G. Factors involved in root formation in Medicago truncatula. J. Exp. Bot. 2007, 58, 439–451. [Google Scholar] [CrossRef] [Scilit]
- Horstman, A.; Li, M.; Heidmann, I.; Weemen, M.; Chen, B.; Muiño, J.M.; Angenent, G.C.; Boutilier, K. The BABY BOOM transcription factor activates the LEC1-ABI3-FUS3-LEC2 network to induce somatic embryogenesis. Plant Physiol. 2017, 175, 848–857. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haecker, A.; Gross-Hardt, R.; Geiges, B.; Sarkar, A.; Breuninger, H.; Herrmann, M.; Laux, T. Expression dynamics of WOX genes mark cell fate decisions during early embryonic patterning in Arabidopsis thaliana. Development 2004, 131, 657–668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rupps, A.; Raschke, J.; Rümmler, M.; Linke, B.; Zoglauer, K. Identification of putative homologs of Larix decidua to BABYBOOM (BBM), LEAFY COTYLEDON1 (LEC1), WUSCHEL-related HOMEOBOX2 (WOX2) and SOMATIC EMBRYOGENESIS RECEPTOR-like KINASE (SERK) during somatic embryogenesis. Planta 2016, 243, 473–488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lotan, T.; Ohto, M.; Yee, K.M.; West, M.A.; Lo, R.; Kwong, R.W.; Yamagishi, K.; Fischer, R.L.; Goldberg, R.B.; Harada, J.J. Arabidopsis LEAFY COTYLEDON1 is sufficient to induce embryo development in vegetative cells. Cell 1998, 93, 1195–1205. [Google Scholar] [CrossRef] [Scilit]
- Stone, S.L.; Kwong, L.W.; Yee, K.M.; Pelletier, J.; Lepiniec, L.; Fischer, R.L.; Goldberg, R.B.; Harada, J.J. LEAFY COTYLEDON2 encodes a B3 domain transcription factor that induces embryo development. Proc. Natl. Acad. Sci. USA 2001, 98, 11806–11811. [Google Scholar] [CrossRef] [Scilit]
- Gaj, M.D.; Zhang, S.; Harada, J.J.; Lemaux, P.G. Leafy cotyledon genes are essential for induction of somatic embryogenesis of Arabidopsis. Planta 2005, 222, 977–988. [Google Scholar] [CrossRef] [Scilit]
- Orłowska, A.; Igielski, R.; Łagowska, K.; Kępczyńska, E. Identification of LEC1, L1L and Polycomb Repressive Complex. 2 genes and their expression during the induction phase of Medicago truncatula Gaertn. somatic embryogenesis. Plant Cell Tissue Organ Cult. 2017, 129, 119–132. [Google Scholar] [CrossRef] [Scilit]
- Zhou, C.; Labbe, H.; Sridha, S.; Wang, L.; Tian, L.; Latoszek-Green, M.; Yang, Z.; Brown, D.; Miki, B.; Wu, K. Expression and function of HD2-type histone deacetylases in Arabidopsis development. Plant J. 2004, 38, 715–724. [Google Scholar] [CrossRef] [Scilit]
- Bustin, A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruijter, J.M.; Ramakers, C.; Hoogaars, W.M.H.; Karlen, Y.; Bakker, O.; van den Hoff, M.J.B.; Moorman, A.F.M. Amplification efficiency: Linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009, 37, e45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pfaffl, M.W.; Horgan, G.W.; Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002, 30, e36. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Inhibitor Treatments | Cotyledonary Somatic Embryos | Recently Germinated Somatic Embryos | ||
|---|---|---|---|---|
| Necrosis (%) after 4 Weeks | Necrosis (%) after 8 Weeks | Necrosis (%) after 4 Weeks | Necrosis (%) after 8 Weeks | |
| Control | 7.50 ± 3.66 a | 16.07 ± 8.38 a | 0.00 ± 0.00 a | 27.50 ± 11.06 a |
| 0.5 mM NaB | 26.00 ± 9.09 ab | 40.00 ± 9.89 ab | 0.00 ± 0.00 a | 0.00 ± 0.00 a |
| 2 mM NaB | 72.72 ± 8.07 c | 83.83 ± 6.05 c | 0.00 ± 0.00 a | 5.00 ± 3.33 a |
| 5 mM NaB | 38.89 ± 5.79 b | 55.08 ± 1.89 b | 16.67 ± 9.32 a | 58.33 ± 11.79 b |
| 0.5 µM TSA | 2.00 ± 1.33 a | 29.00 ± 6.79 ab | 7.50 ± 5.34 a | 20.00 ± 7.26 a |
| 2 µM TSA | 7.00 ± 2.60 a | 29.00 ± 6.74 ab | 7.50 ± 5.34 a | 17.50 ± 9.17 a |
| 5 µM TSA | 25.00 ± 7.03 ab | 56.00 ± 7.48 b | 17.50 ± 3.82 a | 25.00 ± 6.45 a |
| Gene | Accession No. | Primer Sequences (Forward/Reverse) | Amplicon Size (bp) | qPCR Efficiency |
|---|---|---|---|---|
| VvSERK1 | VIT_18s0164g00070 | TCAGAAGTGGTGAGAATGCTG/ GTCCACAATCCAATCAGAGTTG | 126 | 1.90 |
| VvSERK2 | VIT_07s0031g01410 | CGAGGTTGTCCGAATGCTT/ ACGATCCATTCAGAACACCG | 120 | 1.89 |
| VvL1L | VIT_00s0956g00020 | CTGTGAGGGAACAAGACAGG/ GCATCATCCGAGATTTTGGC | 94 | 1.94 |
| VvWUS | VIT_04s0023g03310 | CCCATGCACGCTGAGGAT/ CGGATTCGGGCTTAATGTTG | 52 | 1.94 |
| VvWOX2 | XM_002281125.3 | CCTTTGTTCCCTCCTCCATG/ AAAAGCACCTTGGGGTACTG | 98 | 1.92 |
| VvBBM | VIT_04s0023g00950 | GTGACCAGACACCATCAGCAT/ ATCCTCGAAACTTAATGGCAG | 142 | 1.91 |
| HDT1 | VIT_08s0007g03940 | CTGTGGATAATGGGAAGCCTC/ ACGATCTTCACCTGCTTAGC | 76 | 1.99 |
| SRT1 | VIT_19s0015g00570 | ATTTCAAGGTTTCGACAGACTGTTT/ GATCTGGGATGGGCTTTTTCT | 129 | 1.89 |
| SRT2 | VIT_07s0031g02510 | TGGTATTGACTGGAGCTGGA/ AACGTACAAACTCCTGATGGG | 114 | 1.91 |
| HDA1 | VIT_14s0006g01820 | GCCCTTTAGCCCATCATCAC/ CTCTGTGTGCCTTGAACTCA | 144 | 1.93 |
| HDA2 | VIT_03s0038g04240 | GCTGATTTTGGAACCACAACC/ TTTTTCACCTCAGAAGCCACTC | 120 | 1.89 |
| HDA3 | VIT_17s0000g04120 | AGGCTTTAATGGACAGCATGA/ TCTTCCCGACAATTTTCATCAGA | 81 | 1.98 |
| HDA4 | VIT_06s0080g00210 | GAACGGGAGATCGGGGATAT/ CCATTCGGATCAAAAGCACTT | 124 | 1.85 |
| HDA6 | VIT_17s0000g09070 | AGACCTAAACCTCGCATTTGG/ CCAGTGACACCCCTCATCTC | 131 | 1.90 |
| HDA 7-9 * | VIT_06s0061g01510 | AACTTAAATAGCAAATCGTATATTGGAAC/ AACCTCTTGCATCTGTACGC | 99 | 1.95 |
| HDA8 | VIT_17s0000g07280 | CATTCGAGTCAACATGGCGT/ TCTTCAGAATCAGAGCTTGCG | 148 | 1.84 |
| HDA10 | VIT_04s0008g00910 | GTTGAAGTAGTGAGTGGGACC/ AGGATCAAACATGCGTCCAG | 87 | 1.94 |
| HDA11 | VIT_04s0044g01510 | GGTGAAGGAGCGACACTAAA/ CCCATCATAACCAGCTGAGAC | 141 | 1.86 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martínez, Ó.; Arjones, V.; González, M.V.; Rey, M. Histone Deacetylase Inhibitors Increase the Embryogenic Potential and Alter the Expression of Embryogenesis-Related and HDAC-Encoding Genes in Grapevine (Vitis vinifera L., cv. Mencía). Plants 2021, 10, 1164. https://doi.org/10.3390/plants10061164
Martínez Ó, Arjones V, González MV, Rey M. Histone Deacetylase Inhibitors Increase the Embryogenic Potential and Alter the Expression of Embryogenesis-Related and HDAC-Encoding Genes in Grapevine (Vitis vinifera L., cv. Mencía). Plants. 2021; 10(6):1164. https://doi.org/10.3390/plants10061164
Chicago/Turabian StyleMartínez, Óscar, Verónica Arjones, María Victoria González, and Manuel Rey. 2021. "Histone Deacetylase Inhibitors Increase the Embryogenic Potential and Alter the Expression of Embryogenesis-Related and HDAC-Encoding Genes in Grapevine (Vitis vinifera L., cv. Mencía)" Plants 10, no. 6: 1164. https://doi.org/10.3390/plants10061164
APA StyleMartínez, Ó., Arjones, V., González, M. V., & Rey, M. (2021). Histone Deacetylase Inhibitors Increase the Embryogenic Potential and Alter the Expression of Embryogenesis-Related and HDAC-Encoding Genes in Grapevine (Vitis vinifera L., cv. Mencía). Plants, 10(6), 1164. https://doi.org/10.3390/plants10061164

