1. Introduction
Root-lesion nematodes (RLN) belonging to the genus 
Pratylenchus Filipjev 1936 [
1] consist of about 100 species identified so far and are considered as one of the most devastating migratory nematodes, along with root-knot and cyst nematodes [
2,
3,
4]. 
Pratylenchus spp. are widely distributed in cool, temperate and tropical environments, thus resulting in being highly relevant to agriculture [
5]. All life stages can penetrate the root, freely move inside the root, feed and destroy tissues through the combination of mechanical action and secretion of cell wall-modifying enzymes (CWMPs). These nematode secreted proteins are present in plant parasitic nematodes and play an important role in plant-nematode interactions, allowing the penetration, migration and evasion of host defenses [
6,
7,
8,
9,
10,
11,
12,
13]. In plant parasitic nematodes, these enzymes have been acquired by horizontal gene transfer (HGT) from bacteria or fungi [
14,
15]. So far, a few complete endoglucanase genes (
engs), along with many partial sequences from 
Pratylenchus species, have been reported [
9,
11,
12,
13,
16,
17]. No information on the cell wall-modifying enzymes in the tea nematode 
Pratylenchus loosi Loof 1960 [
18] is reported in the literature. 
Pratylenchus loosi is considered a serious nematode pest causing yield losses in tea plantations in Iran and all over the world [
19]. The present study reports on the isolation of three fragments coding for 
engs, named 
Pl-eng-2, 
Pl-eng-3 and 
Pl-eng-4, and the functional characterization of 
Pl-eng-2. Phylogenetic analyses revealed the occurrence of multiple genes that underwent, after duplication, rapid diversification, as shown by the position of 
Pl-Engs in different groups.
  2. Results
  2.1. Molecular Characterization of Pl-engs in Pratylenchus loosi
PCR amplification performed on the genomic DNA of 
P. loosi using ENG1 and ENG2-degenerated primers [
5] generated a product of about 460 bp. This fragment was cloned and sequenced. Sequence analyses of several clones revealed the presence of three different fragments of 460 bp, 427 bp and 389 bp in length. BLASTX analyses revealed that all three fragments showed similarities with 
Pratylenchus endoglucanases—in particular, the 460-bp fragment showed 90% similarity (275/306 identities and 287/306 positives) with 
P. coffeae endoglucanase and 83-84% with 
Pv-eng-2 and 
Pv-eng-1 of 
P. vulnus. The 427-bp fragment showed 60% similarity with 
Meloidogyne endoglucanases; the 389-bp fragment showed 53% similarity with 
Ditylenchus destructor and 51% with 
Meloidogyne incognita. Based on the similarity with the 
engs available in the database, the three different fragments were named 
Pl-eng-2, 
Pl-eng-3 and 
Pl-eng-4. The 460-bp fragment of 
Pl-eng-2 showed one intron and differed from the 427-bp fragment of 
Pl-eng-3 for the presence of an intron in a different position, while no intron was present in the 389-bp fragment of 
Pl-eng-4. Pairwise comparisons between the three partial 
eng sequences revealed a 59% similarity between 
Pl-eng-2 and 
Pl-eng-3 and 48% with the intron-less 
Pl-eng-4, while 
Pl-eng-3 and 
Pl-eng-4 showed a 54% similarity.
The full-length cDNA of Pl-eng-2 was obtained by 3′/5′ RACE experiments and contained 1152 nucleotides (excluding the poly (dA) tail) with an open reading frame (ORF) of 984 bp.
The cDNA contained a 16 bp 5′ UTR and a 152 bp 3′ UTR, which encompassed the cytoplasmic polyadenylation element (CPE; TTTTTAT) located upstream from the polyadenylation signal (AATAAA) and signals (TAAAT) involved in the regulation of stability and translation at the mRNA level. The ORF encoded a deduced protein of 327 amino acids with a calculated molecular weight of 35.37 kDa and a pI of 8.21. A secretion signal sequence terminated immediately upstream of a protease cleavage site between amino acids Gly21 and Ala22 and was predicted by the Signal P 4.0 World Wide Web Server [
20]. No putative N-glycosylation site was present in the sequence.
The enzyme is composed of a catalytic domain, but the linker and carbohydrate-binding module (CBM) are not encompassed. A glycoside hydrolases family 5 signature extends from residues 150 to 159.
  2.2. Gene Structure
The amplification of P. loosi gDNA, using primers located in the UTR regions for cDNA, produced a fragment of 1065 bp for Pl-eng-2.
The alignment of the Pl-eng-2 genomic sequence with the corresponding cDNA sequence revealed the presence of only two exons and one intron. The intron size is 69 bp, and the intron–exon junctions GT and AG were conserved. The intron size of Pl-eng-3 is 32 bp, and the intron–exon junctions GT and AG were also conserved.
The comparison of the gene structure of 
Pl-eng-2 with the partial 
Pl-eng-3 and 
Pl-eng-4 from 
P. loosi, along with the 
Pratylenchus spp. 
engs available in the database (
Figure 1), revealed that the intron position of 
Pl-eng-2 is conserved among 
Pratylenchus spp. [
11,
12], in contrast with the intron position of 
Pl-eng-3, which is only conserved in a few 
Pratylenchus engs present in the database (
Figure 1).
  2.3. Phylogenetic Analysis
The phylogenetic analysis revealed that 
Pl-eng-2, 
Pl-eng-3 and 
Pl-eng-4 proteins were grouped into three separate subgroupings (
Figure 2) according to their evolutionary relationships. 
Pl- 
eng-2 was closely related to 
P. coffeae eng-1 and 
P. vulnus eng-8 and, all together, clustered in a large group containing 
Pl-
eng-3 and 
Pl-
eng-4 from 
P. loosi and most of the 
Pratylenchus engs, along with several 
Meloidogyne, 
Radopholus, Aphelenchoides avenae, 
Globodera rostochiensis and 
Heterodera glycines engs. Furthermore, the 
Pl-
eng-3 results were closely related to 
CelB-
eng of 
B. subtilis and 
G. rostochiensis eng-3 and 
eng-4 and 
H. glycines eng-5, while the 
Pl-
eng-4 results were closely related with 
A. besseyi eng-1, 
Pv-
eng-2, 
Rr-
eng-1, 
Hg-
eng-6, 
Pg-
eng-1 and 
Ppr-
eng-2. 
Bursaphelenchus xylophilus eng-1 and 
eng-3, belonging to the GHF45 family, are positioned at the basal position of the phylogenetic tree. 
  2.4. Expression Profile by Real Time-PCR (qRT-PCR)
Expression profile of 
Pl-eng-2 in different developmental stages was analyzed by using gene-specific primers in qRT-PCR on the total RNA from juveniles and adult females and males. The transcript levels of 
Pl-eng-2 were highest in the adult males (eight-fold) and females (seven-fold) compared to the juveniles (
Figure 3).
  2.5. In Situ Localization of Pl-eng-2 Transcript 
The tissue localization of the 
Pl-eng-2 transcription in the 
P. loosi mixed stages was analyzed by in-situ hybridization on the fixed nematode sections. The antisense 
Pl-eng-2 probe specifically hybridized in the esophageal gland cells of the nematodes (
Figure 4A), whereas no signal was observed with the control sense probe (
Figure 4B).
  2.6. Silencing of Pl-eng-2
The effect of RNAi silencing was detected by quantitative PCR methods (qPCR) after soaking P. loosi nematodes for 24h in Pl-eng-2 dsRNA. A specific region of the 18S rRNA gene was used as an endogenous reference for normalization. The relative expression of Pl-eng-2 in the nematodes soaked in Pl-eng-2 dsRNA was compared with the relative expression of Pl-eng-2 in the control nematodes soaked in the soaking buffer and in gfp dsRNA.
The expression of 
Pl-eng-2 in nematodes treated with 
Pl-eng-2 dsRNA decreased by 60% (
p < 0.01) compared with the untreated nematodes (
Figure 4). Such a decrease in 
Pl-eng-2 expression was more evident when nematodes treated with 
Pl-eng-2 dsRNA were compared with 
gfp dsRNA-treated nematodes (83%) (
Figure 5).
The phenotype effect of gene silencing on the nematodes was determined. Nematodes phenotype observation with a microscope after nematode soaking in 
Pl-eng-2 dsRNA revealed the phenomenon of a straight shape and behavioral aberration after 24-h incubation. This phenomenon was less evident after nematode soaking in 
gfp dsRNA (
Figure 6).
The effect of Pl-eng-2 silencing in P. loosi was studied, and the ability of nematodes to reproduce was determined after transferring untreated and dsRNA-treated nematodes on mini-carrot discs. The nematode progenies were counted and compared 45 days after inoculation.
The total number of eggs and larval stages after 45 days showed a reduction (
p < 0.05) of 35% (
Figure 7) compared with that retrieved from discs infected with untreated nematodes. No differences were observed in the number of males and females (
Figure 7). 
  3. Discussion
The current study reports on the characterization of Pl-eng-2 gene in the tea nematode P. loosi, along with two partial sequences named Pl-eng-3 and Pl-eng-4, all encoding ß-1,4 endoglucanases. The Pl-eng-2 fragment was fully characterized at the genomic and cDNA levels, revealing the presence of a signal peptide for secretion and the catalytic domain directly joined to the 3′UTR region. The 3′UTR of Pl-eng-2 is 152 bp in length, similar to those of other nematode engs without a linker region and cellulose-binding domain but shorter compared to those of engs with a linker and cellulose-binding domain. It is well-known that the length of the 3′UTR region is strictly related with mRNA stability, gene expression and cellular proliferation. Thus, shorter 3′UTR are more stable, with a higher transcription capacity and higher potential for protein production. This finding further demonstrates the important role of the 3′UTR of engs without a carbohydrate-binding domain during parasitism, allowing nematodes to quickly adapt to specific host plants. 
The 
Pl-eng-2, 
Pl-eng-3 and 
Pl-eng-4 genes in 
P. loosi showed high sequence dissimilarities each other and, also, gene structures. Both 
Pl-eng-2 and partial 
Pl-eng-3 sequences contained one intron differing in sequence and position, while the partial 
Pl-eng-4 sequence showed no intron (
Figure 1). The single intron of 
Pl-eng-2 was in a conserved position in most of 
eng genes of 
Pratylenchus spp., suggesting that this intron was already present in the corresponding ancestral gene before the duplication event occurred. Furthermore, the existence of multiple genes for endoglucanases and the retention of duplicated genes in root-lesion nematodes may be correlated to the ability of these nematodes to freely move inside the roots and to parasitize a large number of plant hosts [
11,
12,
13,
17,
21]. A phylogenetic analysis using the GHF5 catalytic cellulase domains of plant parasitic nematodes revealed that 
P. loosi ENGs grouped into different subgroupings (
Figure 2), confirming that, after the HGT event, the gene was immediately duplicated, and sequence diversification occurred even if the function was maintained. 
Pl-e
ng-2 showed sister relationships in the phylogenetic tree based on the catalytic cellulose domains with other nematode ENGs with and without CBM, confirming that most of the nematode ENGs have lost this domain during evolution in order to quickly adapt to new host plants. Moreover, the close relationships of 
Pl-eng-3 with 
CelB of 
B. subtilis and the occurrence of 
Pl-eng-2 in the same large grouping with other nematode ENGS confirms that 
Pratylenchus engs were also acquired from bacteria by horizontal gene transfer. The phylogenetic data and the different gene organization of 
Pl-
engs demonstrated that, immediately after duplication, the ancestral gene underwent diversification, as shown by different intron positions between 
Pl-eng-2 and 
Pl-eng-3 and the absence of an intron in the 
Pl-eng-4 partial sequence. The conservation of the intron position of 
Pl-eng-2 in most 
engs of 
Pratylenchus (
Figure 1) suggests that this intron may occur in the common ancestral gene. Interestingly, the intron position of the partial 
Pl-eng-3 is conserved in a few 
Pratylenchus species, confirming that the sequence and gene diversification immediately occurred after duplication.
Pl-eng-2 is expressed in all life stages of 
P. loosi, but its level is higher in adult stages, confirming the active role in both the male and female stages of 
P. loosi during parasitism, as also found in 
P. vulnus [
11,
12]. This finding was furtherly confirmed by the in-situ localization of 
Pl-eng-2 in the pharyngeal gland cells both in females and males. To prove further the role of 
Pl-eng-2 during parasitism, the gene was knocked down by using RNAi [
12,
22,
23,
24]. Silenced nematodes, after 24 h of incubation, showed a 60% reduction of 
Pl-eng-2 expression by using qRT-PCR (
Figure 5) and a straight shape at a microscopy observation (
Figure 6), confirming the effect of dsRNA. Then, untreated and silenced nematodes were incubated on carrot discs, and, after 45 days, a significant reduction of eggs and larval stages (35%) was observed compared to the control (
Figure 7), while the ratio between males and females was identical to that of the nematode control (
Figure 7). This result strongly suggests that the silencing effect of 
Pl-eng-2 is not durable and the involvement of 
Pl-eng-2 in the migration and feeding of adult stages inside the roots, as well as nematode reproduction. In conclusion, our data demonstrated that 
P. loosi also contains several 
eng genes, such as other 
Pratylenchus species. Furthermore, our observation that most of 
Pratylenchus effectors without CBM contain shorter 3′UTR region allows us to speculate that both features are needed to attack several host plants and to quickly adapt to them. Finally, this basic knowledge on 
Pratylenchus engs can contribute to more insights into how to develop novel molecular strategies to control RLN.
   4. Materials and Methods
  4.1. Nematode Collection
A 
P. loosi population from Iran was isolated from tea plant roots and, starting from single females, reared on sterile carrot discs. Every two months, mixed stage nematodes, recovered from carrot cultures, were sterilized with 0.02% ethoxyethyl mercury and 0.1% streptomycin sulphate solutions for 2 and 24 h, respectively, and rinsed twice with sterilized water. Under aseptic conditions, fresh carrots were treated with 20% NaOCl solution for 5 min, flamed and then peeled and sliced transversely (10-mm thick, 30–40-mm diameter). Sterilized nematodes (100–200) were transferred onto a single carrot disc into a sterile 50-mm Petri dish and then grown at 23 °C in the dark for up to 8 weeks [
11,
25]. Nematodes were recovered from carrot discs by cutting the discs into smaller pieces with a sharp sterile scalpel and submerging in water in Petri dishes. The dishes were then incubated at room temperature for 24 h. The suspended nematodes were collected by sterile Pasteur pipettes, cleaned by repeated washes with sterile water and decanted into a glass beaker. The nematodes were counted under a dissecting microscope.
  4.2. DNA and RNA Isolation
Total genomic DNA and RNA of P. loosi mixed life stages were extracted using AllPrep DNA/RNA kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. Genomic DNA and total RNA were quantified using Nanodrop.
  4.3. Genomic DNA Amplification
Degenerate primer set (ENG1/ENG2 [
6].) were used to amplify the conserved catalytic domain for endoglucanases. PCR assay was conducted as described by Fanelli et al., [
11].
Cycling conditions used were: an initial denaturation at 94 °C for 2 min, followed by 35 cycles of denaturation at 94 °C for 20 s; annealing at 65 °C for 5 s, 60 °C for 5 s, 55 °C for 5 s, 50 °C for 5 s and extension at 68 °C for 1 min and a final step at 68 °C for 15 min. PCR products were gel purified using the protocol listed by the manufacturer (NucleoSpin Gel and PCR Clean-up, Machery Nagel, Dueren, Germany) and, subsequently, ligated into the pGEM T-easy vector (Promega, Madison, Wisconsin, USA) and used to transform JM109 (Promega, Kilkenny, Ireland) chemically competent Escherichia coli cells, which were spread on LB-agar plates with ampicillin and grown overnight at 37 °C. Three insert-positive clones were grown in 3 mL of LB overnight at 37 °C, followed by plasmid DNA extraction (QIAprep Spin Miniprep kit; QIAGEN, Hilden, Germany), and sequenced by Eurofins (Rosenow, Germany). Sequences were analyzed by the BLAST tool at NCBI.
  4.4. Rapid Amplification of cDNA Ends (RACE)
The 3′/5′ RACE of Pl-eng-2 was carried out on 1 µg of total RNA from nematode mixed stages with SMARTer® RACE 5′/3′ (Clontech, California, USA) according to the manufacturer’s instructions. The 3′ end of Pl-eng-2 was amplified using the gene specific primer 3′RACE Pl5 eng 3 (CGTGGATGTGGTGGCGGCGA) and a long universal primer UPM.
Nested PCR, using the short universal primer UPS and 3′RACE Pl5 eng 2 (GCCAGTGTTGTGAAGCCATACC) specific primers, generated a band that was cloned and sequenced.
The 5′ end of Pl-eng-2 was generated using the gene specific primer 5′RACE Pl5 eng 3 (TCGCCGCCACCACATCCACG) and a long UPM. Nested PCR, using the short universal primer UPS and gene specific primers 5′RACE Pl5 eng 2 (GGTATGGCTTCACAACACTGGC), generated a band that was cloned and sequenced. 5′/3′ PCR reactions were performed as follows: 94 °C for 2 min; 30 cycles at 94 °C for 30 sec, 66 °C for 30 s, and 72 °C for 3 min and a final extension step at 72 °C for 7 min.
  4.5. Sequence Analysis
The nucleotide and translated amino acid sequences were analyzed for similarities to other genes and proteins using BLAST analyses against the NCBI nonredundant nucleotide and protein databases (
http://www.ncbi.nlm.nih.gov/, accessed on 17 March 2021). Furthermore, protein sequence analyses were conducted using SIGNALP v. 4.0 to predict protein signal peptide [
20] and ExPASy, the bioinformatics resource portal, to predict the protein molecular mass and the theoretical isoelectric point.
  4.6. Phylogenetic Analysis
Protein sequences of catalytic cellulose domains of nematode ENGs were retrieved from the GenBank database according to their accession numbers. Seventy-two sequences, including several clones of 
Pl-eng-2, 
Pl-eng-3 and 
Pl-eng-4 from 
P. loosi, were aligned using MAFFT [
26]. The final alignment was checked manually to correct the potential inconsistencies. Sequence alignments were manually edited using BioEdit in order to improve the multi-alignment. Outgroup taxa, 
B. subtilis CelB [
27] and 
B. xylophilus eng-1 and 
eng-3 [
28], were chosen according to the results of previously published data. Phylogenetic trees were performed with the Maximum Likelihood (ML) method using MEGA package version X software [
29]. The phylograms were bootstrapped 1000 times to assess the degree of support for the phylogenetic branching indicated by the optimal tree for each method.
  4.7. Expression Pattern Analysis
To investigate the expression pattern of Pl-eng-2 transcript among the different developmental stages, RT-PCR experiments were performed with 100 Juveniles (J2) and 50 females and 50 males of P. loosi that were handpicked under the microscope. Total RNA was extracted using the RNeasy Tissue Mini Kit following the manufacturer’s instructions (Qiagen) and further treated with an RNase-free DNase I set (Qiagen) to eliminate any contaminating genomic DNA. First-strand cDNA was synthesized starting from 150 ng of total RNA using a QuantiTect Reverse transcription kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions.
The relative expression among the life stages was calculated by using the ΔΔCt method. A portion of 18S rRNA gene was used as the endogenous control using specific primers: q18SPlfor (AAGCCGACAATGAACCAGTAC) and q18SPl rev (ATGAGAGGGCAAGTCTGGTG).
Real-time PCR was performed in 25 µL volumes containing 10 ng of cDNA, 12.5 µl 2 × Fast Start SYBR Green master mix (Roche) and 10 pmol of each specific primer.
Gene-specific primers Plengfor5 (GATTGGTGGACTTTCCTCGA) and Plengrev3 (CGCATTTTTCACTCTGCTGCC) were used to determine the expression profile.
The thermal profile for real-time PCR was 10 min at 95 °C, followed by 40 cycles at 95° C for 30 s, 56 °C for 30 s and 72 °C for 40 s. Dissociation curve analysis of the amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected. The real-time experiments were conducted on a Stratagene thermal cycler, and fluorescent real-time PCR data were analyzed with MX3000P software.
  4.8. In-Situ Hybridization
To assess the localization of the 
Pl-eng-2 transcript, whole-mount in-situ hybridizations were performed in all stages of 
P. loosi following the protocol of de Boer et al. (1998) [
30].
For in-situ hybridization, oligonucleotides Pl_Eng_for3_int(GATTCGGTGCTGACTGCATC) and Pl_Engrev2_stop (CTCTGCTGCCCTTTTCAGCC) were used to synthesize a 100-bp fragment of Pl-eng-2. Digoxygenin-11-dUTP-labeled DNA probes were synthesized in sense and antisense directions using the PCR DIG Probe Synthesis kit (Roche Applied Science). Briefly, P. loosi mixed life stages were fixed in 2% paraformaldehyde for 18 h at 5 °C, followed by a second incubation for 4 h at room temperature. The nematodes were resuspended in 0.2% paraformaldehyde; cut into sections and permeabilized with proteinase K, acetone and methanol. The sections were hybridized overnight at 50 °C with the sense and antisense probes. The sections were washed three times at 50 °C in 4 × SSC and three times in 0.1 × SSC and 0.1% SDS. The hybridized probes within the nematode tissues were detected using anti-DIG antibody conjugated to alkaline phosphatase and its substrate. Nematode sections were then observed using a microscope.
  4.9. RNAi of Pl-eng-2
Templates for dsRNA were made by PCR on cDNA generated from RNA extracted from mixed stages of P. loosi using a RNeasy kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions.
Two separate PCR reactions were performed in which Pl-eng-2 was amplified with a T7 promoter sequence incorporated at the 5′ end of either the sense or antisense strand.
The Pl-eng-2 primer sequences used for the reactions were T7PlEngfor5 (TAATACGACTCACTATAGGGGATTGGTGGACTTTCCTCGA) and PlEngrev2stop (CTCTGCTGCCCTTTTCAGCC) in one reaction and PlEngfor5 (GATTGGTGGACTTTCCTCGA) and T7 PlEngrev2stop (TAATACGACTCACTATAGGG CTCTGCTGCCCTTTTCAGCC) in the second reaction.
Nonspecific control dsRNA (green fluorescent protein gene, gfp, 250 bp) was amplified by using specific primers GFPFOR (CACATGAAGCAGCACGACT) and GFPREV (GATATAGACGTTGTGGCTGT) from the cloning vector pA7-GFP.
PCR products were cleaned using a PCR purification kit (QIAGEN, Hilden, Germany), and 600–800 ng of each PCR product was used for in vitro transcription using a Megascript kit (Ambion, Huntingdon, England) according to the manufacturer’s instructions. The RNA generated in the two reactions was annealed to generate dsRNA. DNA and single-stranded RNA were removed by nuclease digestion (Megascript kit; Ambion, Huntingdon, England). dsRNA was purified using filter cartridges (Ambion, Huntingdon, England) and eluted in 50 µL elution solution (Ambion, Huntingdon, England). The dsRNA was verified by 1% agarose gel electrophoresis and quantified using a NanoDrop spectrophotometer. Two hundred P. loosi females and 100 males grown on carrot discs were both collected and soaked in 40 µL Pl-eng-2 dsRNA solution (1 µL/µL) for 24 h. Meanwhile, controls were incubated in either elution buffer or with gfp dsRNA. Treated and control nematodes were cleaned three times with DEPC-treated water, and total RNA was then extracted. qPCR was used to analyze the transcript suppression after RNAi treatment. All experiments were performed three times.
A specific portion of 18S rRNA gene was used as the endogenous control. Real-time PCR was performed in 25 µL volumes containing 10 ng of cDNA, 12.5 µL 2 × Fast Start SYBR Green master mix (Roche, Basel, Switzerland) and 10 pmol of each specific primer.
Gene-specific primers used to analyze the Pl-eng-2 transcript suppression were 3racePl5Eng3 (CGTGGATGTGGTGGCGGCGA) and 5PlEngrev4 (TTGTTCAACGCAGTTTGTGCC).
PCR was 10 min at 95 °C, followed by 40 cycles at 95 °C for 30 s, 58 °C for 30 s and 72 °C for 40 s. Dissociation curve analysis of the amplification products was also performed. 
  4.10. Effect of Silencing on Reproduction of the Nematodes
The effect of gene silencing on nematode reproduction was determined. For the reproduction test, 30 treated and untreated nematodes (20 females and 10 males) were washed three times with sterile water and inoculated on carrot discs for 45 days, one life cycle of P. loosi. The nematodes were maintained at 23 ± 1°C. Each treatment was repeated 10 times. The number of Pl-eng-2 RNAi-treated and -untreated nematode progenies were counted and compared. The sum of the number of eggs, juveniles, females and males was considered as the final nematode population density (Pf) and was used to determine the reproduction factor.