Next Article in Journal
Fantastic Downy Mildew Pathogens and How to Find Them: Advances in Detection and Diagnostics
Next Article in Special Issue
Genetic Mapping by Sequencing More Precisely Detects Loci Responsible for Anaerobic Germination Tolerance in Rice
Previous Article in Journal
Somatic Embryogenesis in Olive
Previous Article in Special Issue
Incorporating Drought and Submergence Tolerance QTL in Rice (Oryza sativa L.)—The Effects under Reproductive Stage Drought and Vegetative Stage Submergence Stresses
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mapping of a Major QTL, qBK1Z, for Bakanae Disease Resistance in Rice

1
National Institute of Crop Science, Milyang 50424, Korea
2
Department of Microbiology, Pusan National University, Pusan 46241, Korea
3
International Rice Research Institute, Pili Drive, Los Baños 4031, Laguna, Philippines
4
College of Natural Resources and Life Science, Dong-A University, Pusan 49135, Korea
*
Author to whom correspondence should be addressed.
Plants 2021, 10(3), 434; https://doi.org/10.3390/plants10030434
Submission received: 31 January 2021 / Revised: 21 February 2021 / Accepted: 22 February 2021 / Published: 25 February 2021
(This article belongs to the Special Issue Genomics, Genetics, and Breeding for Rice Crop Improvement)

Abstract

Bakanae disease is a fungal disease of rice (Oryza sativa L.) caused by the pathogen Gibberella fujikuroi (also known as Fusarium fujikuroi). This study was carried out to identify novel quantitative trait loci (QTLs) from an indica variety Zenith. We performed a QTL mapping using 180 F2:9 recombinant inbred lines (RILs) derived from a cross between the resistant variety, Zenith, and the susceptible variety, Ilpum. A primary QTL study using the genotypes and phenotypes of the RILs indicated that the locus qBK1z conferring bakanae disease resistance from the Zenith was located in a 2.8 Mb region bordered by the two RM (Rice Microsatellite) markers, RM1331 and RM3530 on chromosome 1. The log of odds (LOD) score of qBK1z was 13.43, accounting for 30.9% of the total phenotypic variation. A finer localization of qBK1z was delimited at an approximate 730 kb interval in the physical map between Chr01_1435908 (1.43 Mbp) and RM10116 (2.16 Mbp). Introducing qBK1z or pyramiding with other previously identified QTLs could provide effective genetic control of bakanae disease in rice.

1. Introduction

Bakanae disease, which means foolish seedling in Japanese, was firstly identified in 1828 in Japan [1], and is widely distributed in temperate zones as well as tropical environments and occurs throughout rice growing regions of the world [2].
Four Fusarium species including F. andiyazi, F. fujikuroi, F. proliferatum and F. verticillioides in the G. fujikuroi species complex have been associated with bakanae disease in rice [3]. This disease is typically a seed-borne fungus, but may occur when the pathogen is present in plant material or soil. Infected seeds/plants result in secondary infections [4], which spread through wind or water. Bakanae disease has different symptoms such as tall, lanky tillers with pale green flag leaves. Infected plants also have fewer tillers, and plants surviving till maturity bear only empty panicles [5], resulting in yield loss [6,7]. Low plant survival and high spikelet sterility [5] may account for yield losses of up to 50% in Japan [7], 3.0–95% in India [8,9,10], 3.7–14.7% in Thailand, 5–23% in Spain, 40% in Nepal [10], 6.7–58.0% in Pakistan [11], 75% in Iran [12] and to 28.8% in Korea [13]. Germinating rice seeds in seed boxes for mechanical transplantation has caused many problems associated with diseases [14] including bakanae disease, which are not considered serious in direct seeding. Hot water immersion and fungicide treatment are the most common ways of seed disinfection [10,15,16]. However, both the hot water treatment and application of fungicide are insufficient to control bakanae disease. Thermal effect does not reach the pericarp of the severely infected rice seeds. The application of fungicides is not functioning well for destroying the spores of this fungal pathogen, and some pathogen showed resistance to the fungicides [13,17,18,19]. Therefore, the genetic improvement of rice using the quantitative trait loci (QTLs)/genes providing bakanae disease resistance would be a more effective way to control bakanae disease.
Several QTLs associated with bakanae disease resistance have been identified and those can be used for marker-assisted selection in rice breeding as well as for understanding the mechanisms of resistance. Yang et al. [20] identified two QTLs located on chromosome 1 and chromosome 10 by in vitro evaluation of the Chunjiang 06/TN1 doubled haploid population. Hur et al. [21] identified a major QTL, qBK1, on chromosome 1 from 168 BC6F4 near isogenic lines (NILS) generated by crossing the resistant indica variety Shingwang with susceptible japonica variety Ilpum. Lee et al. [22] delimited the location of qBK1 to 35 kb interval between two InDel (Insertion–deletion) markers, InDel 18 (23.637 Mbp) and InDel 19-14 (23.672 Mbp). Fiyaz et al. [23] identified three QTLs (qBK1.1, qBK1.2, and qBK1.3) on chromosome 1 and one QTL (qBK3.1) on chromosome 3 from the highly resistant variety Pusa 1342. Ji et al. [24] mapped a major QTL (qFfR1) in 22.56–24.10 Mbp region on chromosome 1 from a resistant Korean japonica variety Nampyeong. Volante et al. [25] identified qBK1_628091 (0.6–1.0 Mbp on chromosome 1) and qBK4_31750955 (31.1–31.7 Mbp on chromosome 4) by GWAS (genome-wide association study) approach using 138 japonica rice germplasms. Kang et al. [26] discovered the QTL qFfR9 at 30.1 centimorgan (cM) on chromosome 9 from a japonica variety Samgwang. Lee et al. [16] found the QTL qBK1WD located between markers chr01_13542347 (13.54 Mb) and chr01_15132528 (15.13 Mb) from the japonica variety Wonseadaesoo. They also found that resistance of gene pyramided lines harboring two QTLs, qBK1WD and qBK1, was significantly higher than those with only qBK1WD or qBK1. Identifying new resistance genes from diverse sources is important for rice breeding programs to acquire durable resistance against bakanae disease by either enhancing the resistance level, helping to overcome the breakdown of resistance genes, or both. In this study, we aimed to provide a new genetic source, qBK1z with detailed gene locus information for developing resistant rice lines which contains single or multiple major QTLs to enhance bakanae disease resistance.

2. Results

2.1. Bakanae Disease Bioassay in Parents and F2:9 RILs

The proportion of healthy Zenith (resistant) and Ilpum (susceptible) plants was evaluated with 10 biological replicates after inoculation of the virulent F. fujikuroi isolate CF283 [27]. Most Zenith plants did not exhibit a thin and yellowish-green phenotype, which is a typical symptom of bakanae disease, unlike Ilpum (Figure 1A).
The proportion of healthy Zenith plants was 63.2 ± 11.8% (ranging from 42.7% to 79.3%), which was significantly different from that of Ilpum (14.3 ± 11.4%, ranging from 3.3% to 37.0%) (Figure 1B). Zenith and Ilpum were further inoculated with green fluorescent protein (GFP)-tagged F. fujikuroi isolate CF283. Ten days after inoculation, plants with typical disease symptom of each variety were subjected to a confocal microscopy analysis. Confocal imaging of radial and longitudinal sections of the basal stem showed that the fungus penetrated and was localized easily and abundantly at vascular bundle, mesophyll tissue and hypodermis in the susceptible Ilpum variety, while only a background level of GPF signal was detected in the resistant Zenith (Figure 2).

2.2. QTL Analysis and Mapping of qBK1z Using 180 F2:9 RILs

Based on the bakanae disease bioassay (proportion of healthy plants), the 180 F2:9 RIL population exhibited continuous distribution (ranged from 0% to 98.0%; Figure 3), which quantitatively confirmed the inheritance of bakanae disease resistance.
We selected 164 markers showing polymorphism between Ilpum and Zenith from 1150 RM markers (http://gramene.org, accessed on 12 August 2018) tested. which covering the whole rice chromosome (Figure A1). The genetic linkage map of Ilpum and Zenith for primary mapping was constructed with 164 polymorphic markers covering a total length of 3140 cM with average interval of 19.14 cM as described by Lee et al. [28]. Primary QTL mapping using the 180 F2:9 populations showed that a significant QTL associated with bakanae disease resistance at the seedling stage was located between the SSR markers, RM1331 and RM3530 on chromosome 1, and it was designated qBK1z. The LOD score of qBK1z was 13.43, which accounted for 30.9% of the total phenotypic variation (Table 1).
A finer localization of qBK1z was determined by analyzing the chromosome segment introgression lines in the region detected from primary mapping. The qBK1z region between RM1331 and RM3530 from primary mapping was narrowed downed with an additional 55 SSR markers and 12 InDel markers designed for the insertion/deletion sites based on the differences between the japonica (http://www.gramene.org, accessed on 12 August 2018) and indica (http://rice.genomics.org.cn, accessed on 12 August 2018) sequences. Four SSR markers and six InDel markers were selected as polymorphic markers between the parents to narrow down the position of the qBK1z region (Table A1). Finally, seven homozygous recombinants were selected from the F2:9 lines using 14 markers in the 2.8 Mb region around the SSR markers RM1331 and RM3530 (Figure 4 and Figure 5).
The proportion of healthy plants of the seven homozygous recombinants was evaluated with three biological replicates according to Duncan’s new multiple range test. Based on this bioassay, lines classified to Group “a” were regarded as resistant, and Group “b” as susceptible (Figure 4). Considering the genotype and the phenotype of the recombinants, it is clear that qBK1Z conferring resistance to bakanae was an approximate 730 kb interval delimited by the physical map between Chr01_1435908 (1.43 Mbp) and RM10116 (2.16 Mbp).

3. Discussion

Rice varieties with a single resistance gene are at an increased risk of being overcome by new pathological races [16,28]. The development of a rice variety with a higher level of resistance against bakanae disease is a major challenge in many countries [21,23,29,30,31]. In this study, we identified qBK1z locus related to bakanae disease resistance based on genotype and phenotype analyses of homozygous recombinants on the recombinant progeny of Ilpum and Zenith, using SSR and newly developed InDel markers.
It was reported that successful infection of Fusarium species is a complex process that includes adhesion, penetration (through wounds, seeds, stomatal pores) and subsequent colonization within and between cells [32,33]. Lee et al. [16] revealed that the fungus F. fujikuroi was more abundant in the stem of the susceptible variety than it was in the resistant one. Elshafey et al. [34] indicated that F. fujikuroi prefer to grow in aerenchyma, pith, cortex and vascular bundle of both sheath and stem of rice. In this study, we examined both the localization and abundance of F. fujikuroi isolate CF283 in the basal stem of rice using GFP-tagged F. fujikuroi isolate CF283 (Figure 2). Consistent with previous reports [16,34], F. fujikuroi isolate CF283 was extensively observed on the vascular bundle, mesophyll tissue and hypodermis of infected stems in susceptible the Ilpum variety, whereas this was rarely observed in resistant Zenith.
Many QTLs on bakanae disease resistance have been identified on chromosome 1. Three QTLs, qBK1z, qBK1.2 and qBK1.3, were found in a similar region in spite of the different source of resistant varieties (Figure 6).
Fiyaz et al. [23] mapped qBK1.1 to a 20 kb region between markers RM9 and RM11232 from the Pusa 1121/Pusa1342 cross. These authors hypothesized that qBK1.1 and qBK1 [21] might be the same QTL as they had overlapping positions. Ji et al. [24] found that QTL qFfR1 was located in a 230 kb region of rice chromosome 1 in Korean japonica variety Nampyeong, and suggested that the three QTLs qBK1, qBK1.1 and qFfR1 might indicate the same gene. Lee et al. [22] narrowed down the position of the qBK1 locus to a 35 kb region between InDel 18 and InDel 19-14, and revealed that location of qBK1 is close to those of qBK1.1 and qFfR1, and do not overlap each other. Two additional QTLs including qB1 from Chunjiang 06 [20] and qBK1WD from Wonseadaesoo [16] were also found on chromosome 1. Gene pyramiding via phenotypic screening assays for crop breeding is considered to be difficult and often impossible due to dominance and epistatic effects of genes governing disease resistance, and the limitation of screenings being all year-round [35]. Pyramiding of multiple resistant QTLs/genes by using marker-assisted breeding (MAB) in a single plant might confer either higher, durable, or both, resistances against bakanae disease. The effects of pyramiding resistance genes have been observed for several plant-microbe interactions. Pyramiding three bacterial blight resistance genes resulted in a high level of resistance and were expected to provide a durable pathogen resistance [36,37]. On the other hand, pyramiding of resistant genes resulted in a level of resistance that was comparable to or even lower to than that of the line with a single gene. For example, Yasuda et al. [38] reported rice lines with pairs of blast resistance genes to be only comparable to lines with a single gene which may have a stronger suppressive effect. Our previous study of bakanae disease resistance [16] revealed that the gene pyramided lines harboring qBK1WD + qBK1 had a much higher levels of resistance than those possessing either qBK1WD or qBK1. The novel QTL, qBK1Z, identified in this study can be utilize in MAB and gene pyramiding to achieve higher resistance in many bakanae disease prone rice growing areas.
In this study, we identified a new major QTL qBK1z conferring bakanae disease resistance from a new genetic source of indica variety, Zenith. Through QTL analysis and fine mapping, we narrowed down the qBK1z locus into 730 kb on the short arm of chromosome 1 which is a novel locus compared with all the previously identified bakanae disease resistance QTLs. Together with the previously identified QTLs of the bakanae disease resistance, the new qBK1z can be introduced to the elite favorable background varieties by a marker-assisted backcrossed breeding. Furthermore, the information of the localization and different abundance on the vascular bundle, mesophyll tissue and hypodermis of infected stems of infected rice between resistant and susceptible varieties will be useful for further studying an interaction between the pathogen (F. fujikuroi) and rice host plants.

4. Materials and Methods

4.1. Plant Materials

Zenith, a medium grain type indica variety from USA released in 1936, was identified as resistant to bakanae disease in a preliminary screening of rice germplasm (data not shown). We generated 180 F2:9 RILs from a cross between susceptible variety, Ilpum, and resistant variety, Zenith, for QTL analysis. The population was developed in the experimental fields of the National Institute of Crop Science in Miryang, Korea.

4.2. Evaluation of Bakanae Resistance and Statistical Analysis

The inoculation and evaluation of bakanae disease were conducted using a method described by Lee et al. [22]. The isolate CF283 of F. fujikuroi was obtained from the National Academy Agricultural Science in Korea. Isolate was inoculated in potato dextrose broth (PDB) and cultured at 26 °C under continuous light for one week. The F. fujikuroi culture was washed by centrifugation with distilled water, and the spore concentration was adjusted to 1 × 106 spores/mL. Forty seeds per each line were placed in a tissue-embedding cassette (M512, Simport, Beloeil, QC, Canada). Before inoculation, the seeds in the tissue-embedding cassette were surface sterilized with hot water (57 °C) for 13 min, then allowed to drain and cool. Subsequently, the seeds were soaked in the spore suspensions (1 × 106 spores/mL) for 3 d for inoculation with gentle shaking four times a day for equilibration. After inoculation, thirty seeds per line were sown in commercial seedling trays, and seedlings were grown in a greenhouse (28 ± 3 °C day/23 ± 3 °C night, 12 h light). Bakanae disease symptom on each line was evaluated by calculating the proportion of healthy plants at 1 month after sowing. The healthy and non-healthy plants are classified as described by Kim et al. [27]. The plants exhibiting elongation with thin and yellowish-green, stunted growth, and dead seedlings were classified as non-healthy plants.
The plants showing the same phenotype as the untreated plants, slight elongation then normal growth without thin and yellowish-green were regarded as healthy plants.
Statistical differences between means were analyzed using Duncan’s multiple range test after one-way analysis of variance (ANOVA). The level of significance was designated as p < 0.05 and was determined using the SAS Enterprise Guide 4.3 program (SAS Institute Inc., Cary, NC, USA).

4.3. Localization of F. fujikuroi in Zenith and Ilpum Plants

Shoot bases of 10-day-old seedlings derived from Zenith and Ilpum seeds inoculated by GFP-tagged F. fujikuroi isolate CF283 [16] were observed under confocal laser-scanning microscopy (LSM-800, Zeiss, Germany) at GFP channel, and images were obtained using Zeiss LSM Image Browser. All experiments were conducted twice with at least three replicates.

4.4. DNA Extraction and Polymerase Chain Reaction

Genomic DNA from young leaf tissue was prepared according to the CTAB method [39] with minor modifications. Polymerase chain reaction (PCR) was performed in 25-µL reaction mixture containing 25 ng template DNA, 10 pmol of each primer, 10× e-Taq reaction buffer, 25 mM MgCl2, 10 mM dNTP mix and 0.02 U of SolGent e-Taq DNA polymerase (SolGent, Daejeon, South Korea). The reaction conditions were set as follows: initial denaturation at 94 °C for 2 min; 35 cycles of denaturation at 94 °C for 20 s, annealing at 57 °C for 40 s and extension at 72 °C for 40 s; and a final extension at 72 °C for 7 min. The amplification products were electrophoresed on a 3% (w/v) agarose gel and visualized by ethidium bromide staining.

4.5. QTL Analysis of the F2:9 Population and Development of InDel Markers for Fine Mapping

Polymorphic SSR markers (n = 164) that were evenly distributed on rice chromosomes were selected from the Gramene database (http://www.gramene.org, accessed on 12 August 2018). These markers were used to construct a linkage map and for QTL analysis of the F2:9 populations. The linkage map was constructed using Mapmaker/Exp v.3.0, and the genetic distance was obtained using the Kosambi map function [40]. Putative QTLs were detected using the composite interval mapping (CIM) function in WinQTLcart v.2.5 (WinQTL cartographer software [41]. A logarithm of the odds (LOD) ratio threshold of 3.0 was used to confirm the significance of a putative QTL. InDel markers were developed based on the fragment size differences in the sequence (in the range of 20 bp) between japonica (Gramene database http://www.gramene-.org, accessed on 12 August 2018) and indica (BGI-RIS; http://rice.genomics.org.cn, accessed on 12 August 2018) in the target region on chromosome 1. The primers were designed using Primer3 software (http://web.-bioneer.co.kr/cgi-bin/primer/primer3.cgi, accessed on 12 August 2018).

5. Conclusions

In this study, we identified a new major QTL qBK1z conferring bakanae disease resistance from a new genetic source of indica variety, Zenith. Through QTL analysis and fine mapping, we narrowed down the qBK1z locus to 730 kb on the short arm of chromosome 1 which is a novel locus compared with all the previously identified bakanae disease resistance QTLs. This new qBK1z can be introduced to the elite favorable background varieties by a marker-assisted backcrossed breeding together with the previously identified QTLs of the bakanae disease resistance. Furthermore, the information of the localization and different abundance on the vascular bundle, mesophyll tissue and hypodermis of infected stems of infected rice between resistant and susceptible varieties will be useful for further studying the interaction between the pathogen (F. fujikuroi) and rice host plants.

Author Contributions

Conceptualization, D.-S.P.; data curation, S.-B.L. and N.K.; funding acquisition, D.-S.P.; investigation, S.J., J.-W.K., Y.-C.S. and M.B.; methodology, Y.-S.S., J.L., Y.-J.H. and J.-Y.L.; project administration and supervision, J.-M.K.; validation, J.-H.C. and J.-H.L.; writing—original draft, D.-S.P. and S.-R.K.; writing—review and editing, M.B. and S.-R.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Rural Development Administration, Republic of Korea, grant number PJ01477401 (Project title: QTL mapping for development of functional rice with bakanae disease resistance).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Figure A1. Linkage map constructed with 180 F2:9 recombinant inbred lines (RILs) derived from a cross between Zenith and Ilpum.
Figure A1. Linkage map constructed with 180 F2:9 recombinant inbred lines (RILs) derived from a cross between Zenith and Ilpum.
Plants 10 00434 g0a1
Table A1. InDel and SSR markers used for the fine mapping of qBKz.
Table A1. InDel and SSR markers used for the fine mapping of qBKz.
Primer IDForward Primer (5′–3′)Reverse Primer (5′–3′)Location
Chr01_416669ACGCACCGTTTAGCAGTTTGTGCATGCAACCTAATGACCC416,669
Chr01_1435908GTTCTTCATGGTCGACAGCGCCTTATAATTTGGGATGGAGGG1,435,908
Chr01_2104309AAGCAAGTGGGAAACGAACCGCATGATGTTTAAATGTGATGATTG2,104,309
RM10116TCCCACTTGCAGACGTAGGTAGGCACTGATCTGATGCAACTGTTTGG2,169,222
Chr01_2319384GTTTGCGGGGCTAAGTTCTCCTTCAGAAAAGAGGGTGGGC2,319,384
Chr01_2898689CTCAAGCCTGTTGGTGTAGCAAAAACCAACAACCTTAGGCCA2,898,689
RM10208CGGAGCTCAATCGAATCTAGACCTTCCTCATATCCTCCAGCTCTTAGC3,946,894
RM10226GATCATCATCATCCATCCATCCAAGGGAGAAATTGGTGGAGAGC4,005,199
RM10287GTATTCCTTGCTGCTGCTGATGGGACTGGAGATGTGATCGGAAACC4,966,447
Chr01_5426210TGATGGCCTACACGATATGGATGTTACAAACAGGCGCAACA5,426,210

References

  1. Ito, S.; Kimura, J. Studies on the ‘bakanae’ disease of the rice plant. Rep. Hokkaido Natl. Agric. Exp. Stat. 1931, 27, 1–95. [Google Scholar]
  2. Gupta, A.K.; Solanki, I.S.; Bashyal, B.M.; Singh, Y.; Srivastava, K. Bakanae of rice—An emerging disease in Asia. J. Anim. Plant Sci. 2015, 25, 1499–1514. [Google Scholar]
  3. Wulff, E.G.; Sørensen, J.L.; Lübeck, M.; Nielsen, K.F.; Thrane, U.; Torp, J. Fusarium spp. associated with rice Bakanae: Ecology, genetic diversity, pathogenicity and toxigenicity. Environ. Microbiol. 2010, 12, 649–657. [Google Scholar] [CrossRef] [Scilit]
  4. Ora, N.; Faruq, A.N.; Islam, M.T.; Akhtar, N.; Rahman, M.M. Detection and identification of seed borne pathogens from some cultivated hybrid rice varieties in Bangladesh. Middle-East J. Sci. Res. 2011, 10, 482–488. [Google Scholar]
  5. Singh, R.; Sunder, S. Foot rot and bakanae disease of rice: An overview. Rev. Plant Pathol. 2012, 5, 565–604. [Google Scholar]
  6. Mew, T.W.; Gonzales, P.G. A Handbook of Rice Seedborne Fungi; International Rice Research Institute; Science Publishers, Inc.: Enfield, NH, USA; Los Baños, Philippines, 2002. [Google Scholar]
  7. Ou, S.H. Rice Diseases, 2nd ed.; Commonwealth Mycological Institute: Kew, UK, 1985. [Google Scholar]
  8. Sunder, S.; Virk, K.S. Studies on correlation between bakanae incidence and yield loss in paddy. Indian Phytopathol. 1997, 50, 99–101. [Google Scholar]
  9. Fiyaz, R.A.; Gopala Krishnan, S.; Rajashekara, H.; Yadav, A.K.; Bashyal, B.M.; Bhowmick, P.K.; Singh, N.K.; Prabhu, K.V.; Singh, A.K. Development of high throughput screening protocol and identification of novel sources of resistance against Bakanae disease in rice (Oryza sativa L.). Indian J. Genet. 2014, 74, 414–422. [Google Scholar]
  10. Singh, R.; Sunder, S. Foot rot and bakanae of rice: Retrospects and prospects. Intern. J. Trop. Plant Dis. 1997, 15, 153–176. [Google Scholar]
  11. Yasin, S.I.; Khan, T.Z.; Akhtar, K.M.; Muhammad, A.; Mushtaq, A. Economic evaluation of bakanae disease of rice. Mycopath 2003, 1, 115–117. [Google Scholar]
  12. Saremi, H.; Ammarellou, A.; Marefat, A.; Okhovat, S.M. Binam a rice cultivar, resistant for root rot disease on rice caused by Fusarium moniliforme in North-West, Iran. Intern. J. Bot. 2008, 4, 383–389. [Google Scholar] [CrossRef] [Scilit]
  13. Park, W.S.; Choi, H.W.; Han, S.S.; Shin, D.B.; Shim, H.K.; Jung, E.S.; Lee, S.W.; Lim, C.K.; Lee, Y.H. Control of bakanae disease of rice by seed soaking into the mixed solution of procholraz and fludioxnil. Res. Plant Dis. 2009, 15, 94–100. [Google Scholar] [CrossRef] [Scilit]
  14. Rosales, A.M.; Mew, T.W. Suppression of Fusarium moniliforme in rice by rice associated antagonistic bacteria. Plant Dis. 1997, 81, 49–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Hayasaka, T.; Ishiguro, K.; Shibutani, K.; Namai, T. Seed disinfection using hot water immersion to control several seed-borne diseases of rice plants. Jpn. J. Phytopathol. 2001, 67, 26–32. [Google Scholar] [CrossRef] [Scilit]
  16. Lee, S.B.; Hur, Y.J.; Cho, J.H.; Lee, J.H.; Kim, T.H.; Cho, S.M.; Song, Y.C.; Seo, Y.S.; Lee, J.K.; Kim, T.S.; et al. Molecular mapping of qBK1WD, a major QTL for bakanae disease resistance in rice. Rice 2018, 11, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Ogawa, K. Damage by “Bakanae” disease and its chemical control. Jpn. Pestic. Inf. 1988, 52, 13–15. [Google Scholar]
  18. Kim, J.M.; Hong, S.K.; Kim, W.G.; Lee, Y.K.; Yu, S.H.; Choi, H.W. Fungicide resistance of Gibberella fujikuroi isolates causing rice bakanae disease and their progeny isolates. Kor. J. Mycol. 2010, 38, 75–79. [Google Scholar] [CrossRef] [Scilit]
  19. Lee, Y.H.; Lee, M.J.; Choi, H.W.; Kim, S.T.; Park, J.W.; Myung, I.S.; Park, K.S.; Lee, S.W. Development of in vitro seedling screening method for selection of resistant rice against bakanae disease. Res. Plant Dis. 2011, 17, 288–294. [Google Scholar] [CrossRef] [Scilit]
  20. Yang, C.D.; Guo, L.B.; Li, X.M.; Ji, Z.J.; Ma, L.Y.; Qian, Q. Analysis of QTLs for resistance to rice bakanae disease. Chin. J. Rice Sci. 2006, 6, 657–659. [Google Scholar]
  21. Hur, Y.J.; Lee, S.B.; Kim, T.H.; Kwon, T.; Lee, J.H.; Shin, D.J.; Park, S.K.; Hwang, U.H.; Cho, Y.H.; Yoon, Y.N.; et al. Mapping of qBK1, a major QTL for bakanae disease resistance in rice. Mol. Breed. 2015, 35. [Google Scholar] [CrossRef] [Scilit]
  22. Lee, S.B.; Kim, N.; Hur, Y.J.; Cho, S.M.; Kim, T.H.; Lee, J.Y.; Cho, J.H.; Lee, J.H.; Song, Y.C.; Seo, Y.S.; et al. Fine mapping of qBK1, a major QTL for bakanae disease resistance in rice. Rice 2019, 12, 36. [Google Scholar] [CrossRef] [Scilit]
  23. Fiyaz, R.A.; Yadav, A.K.; Krishnan, S.G.; Ellur, R.K.; Bashyal, B.M.; Grover, N.; Bhowmick, P.K.; Nagarajan, M.; Vinod, K.K.; Singh, N.K.; et al. Mapping quantitative trait loci responsible for resistance to Bakanae disease in rice. Rice 2016, 9, 3–10. [Google Scholar] [CrossRef] [Scilit]
  24. Ji, H.; Kim, T.H.; Lee, G.S.; Kang, H.J.; Lee, S.B.; Suh, S.C.; Kim, S.L.; Choi, I.; Baek, J.; Kim, K.H. Mapping of a major quantitative trait locus for bakanae disease resistance in rice by genome resequencing. Mol. Gen. Genom. 2017. [Google Scholar] [CrossRef] [Scilit]
  25. Volante, A.; Tondelli, A.; Aragona, M.; Valente, M.T.; Biselli, C.; Desiderio, F.; Bagnaresi, P.; Matic, S.; Gullino, M.L.; Infantino, A.; et al. Identification of bakanae disease resistance loci in japonica rice through genome wide association study. Rice 2017, 10. [Google Scholar] [CrossRef] [Scilit]
  26. Kang, D.Y.; Cheon, K.S.; Oh, J.; Oh, H.; Kim, S.L.; Kim, N.; Lee, E.; Choi, I.; Baek, J.; Kim, K.H.; et al. Rice genome resequencing reveals a major quantitative trait locus for resistance to bakanae disease caused by Fusarium fujikuroi. Int. J. Mol. Sci. 2019, 20, 2598. [Google Scholar] [CrossRef] [Scilit]
  27. Kim, M.H.; Hur, Y.J.; Lee, S.B.; Kwon, T.M.; Hwang, U.H.; Park, S.K.; Youn, Y.N.; Lee, J.H.; Cho, J.H.; Shin, D.J.; et al. Large-scale screening of rice accessions to evaluate resistance to bakanae disease. J. Gen. Plant Pathol. 2014, 80, 408–414. [Google Scholar] [CrossRef] [Scilit]
  28. Lee, S.B.; Hur, Y.J.; Lee, J.H.; Kwon, T.M.; Shin, D.J.; Kim, T.H.; Han, S.I.; Choi, J.H.; Yoon, Y.N.; Kiswara, K.; et al. Molecular mapping of a quantitative trait locus qSTV11Z harboring rice stripe virus resistance gene, Stv-b. Plant Breed. 2017, 136, 61–66. [Google Scholar] [CrossRef] [Scilit]
  29. Cumagun, C.J.R.; Arcillas, E.; Gergon, E. UP-PCR analysis of the seedborne pathogen Fusarium fujikuroi causing bakanae disease in rice. Int. J. Agric. Biol. 2011, 13, 1029–1032. [Google Scholar]
  30. Bashyal, B.M.; Aggarwal, R.; Banerjee, S.; Gupta, S.; Sharma, S. Pathogenicity, ecology and genetic diversity of the Fusarium spp. associated with an emerging bakanae disease of rice (Oryza sativa L.) in India. In Microbial Diversity and Biotechnology in Food Security; Kharwar, R.N., Upadhyay, R., Dubey, N., Raghuwanshi, R., Eds.; Springer: New Delhi, India, 2014; pp. 307–314. [Google Scholar]
  31. Hur, Y.J.; Lee, S.B.; Shin, D.J.; Kim, T.H.; Cho, J.H.; Han, S.I.; Oh, S.H.; Lee, J.Y.; Son, Y.B.; Lee, J.H.; et al. Screening of rice germplasm for Bakanae disease resistance in rice. Korean J. Breed. Sci. 2016, 48, 22–28. [Google Scholar] [CrossRef] [Scilit]
  32. Rana, A.; Sahgal, M.; Johri, B.N. Fusarium oxysporum: Genomics, Diversity and Plant–Host Interaction. In Developments in Fungal Biology and Applied Mycology; Springer: Singapore, 2017; pp. 159–199. [Google Scholar]
  33. Jansen, C.; VonWettstein, D.; Schäfer, W.; Kogel, K.H.; Felk, A.; Maier, F.J. Infection patterns in barley and wheat spikes inoculated with wild-type and trichodiene synthase gene disrupted Fusarium graminearum. Proc. Natl. Acad. Sci. USA 2005, 102, 16892–16897. [Google Scholar] [CrossRef] [Scilit]
  34. Elshafey, R.A.S.; Tahoon, A.M.; El-Emary, F.A. Analysis of varietal response to bakanae infection Fusarium fujikuroi and gibberellic acid through morphological, anatomical and hormonal changes in three rice varieties. J. Phytopathol. Pest Manag. 2018, 5, 63–87. [Google Scholar]
  35. Sundaram, R.M.; Vishnupriya, M.R.; Laha, G.S.; Rani, N.S.; Rao, P.S.; Balachandran, S.M.; Reddy, G.A.; Sharma, N.P.; Sonti, R.V. Introduction of bacterial blight resistance into Triguna, a high yielding, mid-early duration rice variety. Biotechnology 2009, 4, 400–407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Singh, S.; Sidhu, J.S.; Huang, N.; Vikal, Y.; Li, Z.; Brar, D.S.; Dhaliwal, H.S.; Khush, G.S. Pyramiding three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106. Theor. Appl. Genet. 2001, 102, 1011–1015. [Google Scholar] [CrossRef] [Scilit]
  37. Pradhan, S.K.; Nayak, D.K.; Mohanty, S.; Behera, L.; Barik, S.R.; Pandit, E.; Lenka, S.; Anandan, A. Pyramiding of three bacterial blight resistance genes for broad-spectrum resistance in deepwater rice variety, Jalmagna. Rice 2015, 8, 2–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Yasuda, N.; Mitsunaga, T.; Hayashi, K.; Koizumi, S.; Fujita, Y. Effects of pyramiding quantitative resistance genes pi21, Pi34, and Pi35 on rice leaf blast disease. Plant Dis. 2015, 99, 904–909. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Lander, E.S.; Green, P.; Abrahamson, J.; Barlow, A.; Daly, M.J.; Lincoln, S.E.; Newburg, L. MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1987, 1, 174–181. [Google Scholar] [CrossRef] [Scilit]
  41. Wang, S.; Basten, C.J.; Zeng, Z.B. Windows QTL Cartographer 2.5. 2007. Available online: http://statgen.ncsu.edu/qtlcart/WQTLCart.htm (accessed on 12 August 2018).
Figure 1. Phenotype (A) and proportion of healthy plants (B) in Ilpum and Zenith infected with the Fusarium fujikuroi isolate CF283. ** Significant at the 1 % level.
Figure 1. Phenotype (A) and proportion of healthy plants (B) in Ilpum and Zenith infected with the Fusarium fujikuroi isolate CF283. ** Significant at the 1 % level.
Plants 10 00434 g001
Figure 2. Confocal imaging of Zenith and Ilpum rice plants infected with CF283GFP Fusarium fujikuroi isolates. (A) Radial and (B) longitudinal sections of the basal stem (Scale bar = 50 μm).
Figure 2. Confocal imaging of Zenith and Ilpum rice plants infected with CF283GFP Fusarium fujikuroi isolates. (A) Radial and (B) longitudinal sections of the basal stem (Scale bar = 50 μm).
Plants 10 00434 g002
Figure 3. Frequency distribution of the proportion of healthy F2:9 plants derived from a cross between Ilpum and Zenith after bakanae disease inoculation. The mean proportion of healthy plants of Ilpum and Zenith are indicated by black arrow heads.
Figure 3. Frequency distribution of the proportion of healthy F2:9 plants derived from a cross between Ilpum and Zenith after bakanae disease inoculation. The mean proportion of healthy plants of Ilpum and Zenith are indicated by black arrow heads.
Plants 10 00434 g003
Figure 4. Quantitative trait locus (QTL) analysis of qBK1Z on chromosome 1 using recombinant inbred lines (RILs) derived from a cross between Ilpum and Zenith. (A) In primary mapping, qBK1Z was founded in the 2.8 Mb region between the RM1331 and RM3530 markers on chromosome 1. (B) Location of qBK1Z was narrowed down to 730 kb region between the markers Chr01_1435908 and RM10116 in secondary mapping using seven selected homozygous recombinants. Black bars show the homozygous regions for Zenith alleles; white bars indicate the homozygous regions for Ilpum alleles; R, resistant to bakanae disease; S, susceptible to bakanae disease. The proportion of healthy plant was calculated from three biological replications. Values (%) of the proportion of healthy plant with different letters are significantly different by Duncan’s multiple range test at p = 0.05.
Figure 4. Quantitative trait locus (QTL) analysis of qBK1Z on chromosome 1 using recombinant inbred lines (RILs) derived from a cross between Ilpum and Zenith. (A) In primary mapping, qBK1Z was founded in the 2.8 Mb region between the RM1331 and RM3530 markers on chromosome 1. (B) Location of qBK1Z was narrowed down to 730 kb region between the markers Chr01_1435908 and RM10116 in secondary mapping using seven selected homozygous recombinants. Black bars show the homozygous regions for Zenith alleles; white bars indicate the homozygous regions for Ilpum alleles; R, resistant to bakanae disease; S, susceptible to bakanae disease. The proportion of healthy plant was calculated from three biological replications. Values (%) of the proportion of healthy plant with different letters are significantly different by Duncan’s multiple range test at p = 0.05.
Plants 10 00434 g004
Figure 5. Phenotypic responses to bakanae disease infection in seven homozygous recombinants for secondary mapping.
Figure 5. Phenotypic responses to bakanae disease infection in seven homozygous recombinants for secondary mapping.
Plants 10 00434 g005
Figure 6. Physical locations of bakanae disease resistance quantitative trait loci on chromosome 1.
Figure 6. Physical locations of bakanae disease resistance quantitative trait loci on chromosome 1.
Plants 10 00434 g006
Table 1. Putative quantitative trait locus (QTL) associated with bakanae disease resistance detected at the seedling stage by composite interval mapping of the 180 F2:9 populations derived from a cross between Ilpum and Zenith.
Table 1. Putative quantitative trait locus (QTL) associated with bakanae disease resistance detected at the seedling stage by composite interval mapping of the 180 F2:9 populations derived from a cross between Ilpum and Zenith.
QTLChromosomePosition
(cM)
Marker IntervalLOD aPVE b (%)Additive EffectDominant Effect
qBK1Z14.0RM1331–RM353013.4330.93−22.10−1.09
a LOD: log of odds score; b PVE: percentage of phenotypic variation explained.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Lee, S.-B.; Kim, N.; Jo, S.; Hur, Y.-J.; Lee, J.-Y.; Cho, J.-H.; Lee, J.-H.; Kang, J.-W.; Song, Y.-C.; Bombay, M.; et al. Mapping of a Major QTL, qBK1Z, for Bakanae Disease Resistance in Rice. Plants 2021, 10, 434. https://doi.org/10.3390/plants10030434

AMA Style

Lee S-B, Kim N, Jo S, Hur Y-J, Lee J-Y, Cho J-H, Lee J-H, Kang J-W, Song Y-C, Bombay M, et al. Mapping of a Major QTL, qBK1Z, for Bakanae Disease Resistance in Rice. Plants. 2021; 10(3):434. https://doi.org/10.3390/plants10030434

Chicago/Turabian Style

Lee, Sais-Beul, Namgyu Kim, Sumin Jo, Yeon-Jae Hur, Ji-Youn Lee, Jun-Hyeon Cho, Jong-Hee Lee, Ju-Won Kang, You-Chun Song, Maurene Bombay, and et al. 2021. "Mapping of a Major QTL, qBK1Z, for Bakanae Disease Resistance in Rice" Plants 10, no. 3: 434. https://doi.org/10.3390/plants10030434

APA Style

Lee, S.-B., Kim, N., Jo, S., Hur, Y.-J., Lee, J.-Y., Cho, J.-H., Lee, J.-H., Kang, J.-W., Song, Y.-C., Bombay, M., Kim, S.-R., Lee, J., Seo, Y.-S., Ko, J.-M., & Park, D.-S. (2021). Mapping of a Major QTL, qBK1Z, for Bakanae Disease Resistance in Rice. Plants, 10(3), 434. https://doi.org/10.3390/plants10030434

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop