Developing and Testing Molecular Markers in Cannabis sativa (Hemp) for Their Use in Variety and Dioecy Assessments
Abstract
:1. Introduction
2. Results and Discussion
2.1. Overall Genetic Diversity
2.2. Population Structure of Cannabis Germplasms and Cluster Analysis
2.3. Sex Determination and Linkage Disequilibrium
3. Materials and Methods
3.1. Plant Materials of Cannabis
3.2. Analysis of the SSR Marker Loci
3.3. Molecular Data Analysis
3.4. Prediction of Plant Sex through the SCAR119 Marker and Linkage Disequilibrium Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Soler, S.; Gramazio, P.; Figàs, M.R.; Vilanova, S.; Rosa, E.; Llosa, E.R.; Borràs, D.; Plazas, M.; Prohens, J. Genetic structure of Cannabis sativa var. indica cultivars based on genomic SSR (gSSR) markers: Implications for breeding and germplasm management. Ind. Crops Prod. 2017, 104, 171–178. [Google Scholar] [CrossRef] [Green Version]
- Kovalchuk, I.; Pellino, M.; Rigault, P.; van Velzen, R.; Ebersbach, J.; Ashnest, J.R.; Mau, M.; Schranz, M.E.; Alcorn, J.; Laprairie, R.B.; et al. The Genomics of Cannabis and Its Close Relatives. Annu. Rev. Plant Biol. 2020, 71, 713–739. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schultes, R.E. Random Thoughts and Queries on the Botany of Cannabis; Joyce, C.R.B., Curry, S.H., Eds.; J.A.Churchill: London, UK, 1970. [Google Scholar]
- Small, E.; Cronquist, A. A Practical and Natural Taxonomy for Cannabis; International Association for Plant Taxonomy (IAPT), Ed.; Taxon 25: Hoboken, NJ, USA, 1976; Volume 25. [Google Scholar]
- Schultes, R.E.; Hofmann, A. The Botany and Chemistry of Hallucinogens, 2nd ed.; Charles C Thomas Pub Ltd.: Springfield, IL, USA, 1980. [Google Scholar]
- Hazekamp, A.; Tejkalová, K.; Papadimitriou, S. Cannabis: From cultivar to chemovar II—A metabolomics approach to Cannabis classification. Cannabis Cannabinoid Res. 2016, 1, 202–215. [Google Scholar] [CrossRef]
- Piomelli, D.; Russo, E.B. The Cannabis sativa Versus Cannabis indica Debate: An Interview with Ethan Russo. MD. Cannabis Cannabinoid Res 2016, 1, 4–46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cerrato, A.; Citti, C.; Cannazza, G.; Capriotti, A.L.; Cavaliere, C.; Grassi, G.; Marini, F.; Montone, C.M.; Paris, R.; Piovesana, S.; et al. Phytocannabinomics: Untargeted metabolomics as a tool for cannabis chemovar differentiation. Talanta 2021, 230, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Barcaccia, G.; Palumbo, F.; Scariolo, F.; Vannozzi, A.; Borin, M.; Bona, S. Potentials and Challenges of Genomics for Breeding Cannabis Cultivars. Front. Plant Sci. 2020, 11, 1472. [Google Scholar] [CrossRef]
- Clarke, C. Marijuana Botany. An Advanced Study: The Propagation and Breeding of Distinctive Cannabis; Ronin Publishing: Berkeley, CA, USA, 1981; Volume 13, ISBN 9780914171782. [Google Scholar]
- Ming, R.; Bendahmane, A.; Renner, S.S. Sex chromosomes in land plants. Ann. Rev. Plant Biol. 2011, 62, 485–514. [Google Scholar] [CrossRef] [Green Version]
- Razumova, O.; Aleksandrov, O.; Divashuk, M.; Sukhorada, T.; Karlov, G. Molecular cytogenetic analysis of monoecious hemp (Cannabis sativa L.) cultivars reveals its karyotype variations and sex chromosomes constitution. Protoplasma 2015, 253, 895–901. [Google Scholar] [CrossRef]
- Lynch, R.C.; Vergara, D.; Tittes, S.; White, K.; Schwartz, C.; Gibbs, M.J.; Ruthenburg, T.C.; Decesare, K.; Land, D.P.; Kane, N.C. Genomic and chemical diversity in cannabis. Crit. Rev. Plant Sci. 2016, 35, 349–363. [Google Scholar] [CrossRef] [Green Version]
- Hennink, S. Optimisation of Breeding for Agronomic Traits in Fibre Hemp (Cannabis Sativa L.). Euphytica 1994, 78, 69–76. [Google Scholar] [CrossRef]
- Palumbo, F.; Galla, G.; Vitulo, N.; Barcaccia, G. First draft genome sequencing of fennel (Foeniculum Vulgare Mill.): Identification of simple sequence repeats and their application in marker-assisted breeding. Mol. Breed 2018, 38, 1–17. [Google Scholar] [CrossRef]
- Patella, A.; Scariolo, F.; Palumbo, F.; Barcaccia, G. Genetic structure of cultivated varieties of radicchio (Cichorium intybus l.): A comparison between f1 hybrids and synthetics. Plants 2018, 8, 213. [Google Scholar] [CrossRef] [Green Version]
- Patella, A.; Palumbo, F.; Galla, G.; Barcaccia, G. The molecular determination of hybridity and homozygosity estimates in breeding populations of lettuce (Lactuca sativa L.). Genes 2019, 10, 916. [Google Scholar] [CrossRef] [Green Version]
- Jindal, S.K.; Dhaliwal, M.S.; Meena, O.P. Molecular advancements in male sterility systems of capsicum: A review. Plant Breed. 2020, 139, 42–64. [Google Scholar] [CrossRef] [Green Version]
- Hesami, M.; Pepe, M.; Alizadeh, M.; Rakei, A.; Baiton, A.; Phineas Jones, A.M. Recent advances in cannabis biotechnology. Ind. Crops Prod. 2020, 158, 113026. [Google Scholar] [CrossRef]
- Zhang, L.; Yuan, M.; Tao, A.; Xu, J.; Lin, L.; Fang, P.; Qi, J. Genetic structure and relationship analysis of an association population in jute (Corchorus spp.) evaluated by SSR markers. PLoS ONE 2015, 10, e0128195. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gonzaga, Z.J.; Aslam, K.; Septiningsih, E.M.; Collard, B.C.Y. Evaluation of SSR and SNP Markers for Molecular Breeding in Rice. Plant Breed. Biotechnol. 2015, 3, 139–152. [Google Scholar] [CrossRef] [Green Version]
- Ghedina, A.; Galla, G.; Cadalen, T.; Hilbert, J.L.; Caenazzo, S.T.; Barcaccia, G. A method for genotyping elite breeding stocks of leaf chicory (Cichorium intybus L.) by assaying mapped microsatellite marker loci Genetics. BMC Res. Notes 2015, 8, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gilmore, S.; Peakall, R.; Robertson, J. Short tandem repeat (STR) DNA markers are hypervariable and informative in Cannabis sativa: Implications for forensic investigations. Forensic Sci. Int. 2003, 131, 65–74. [Google Scholar] [CrossRef]
- Hsieh, H.M.; Hou, R.J.; Tsai, L.C.; Wei, C.S.; Liu, S.W.; Huang, L.H.; Kuo, Y.C.; Linacre, A.; Lee, J.C.I. A highly polymorphic STR locus in Cannabis sativa. Forensic Sci. Int. 2003, 131, 53–58. [Google Scholar] [CrossRef]
- Alghanim, H.J.; Almirall, J.R. Development of microsatellite markers in Cannabis sativa for DNA typing and genetic relatedness analyses. Anal. Bioanal. Chem. 2003, 376, 1225–1233. [Google Scholar] [CrossRef]
- Hillig, K.W. Genetic evidence for speciation in Cannabis (Cannabaceae). Genet. Resour. Crop Evol. 2005, 52, 161–180. [Google Scholar] [CrossRef]
- Gao, C.; Xin, P.; Cheng, C.; Tang, Q.; Chen, P.; Wang, C.; Zang, G.; Zhao, L. Diversity analysis in Cannabis sativabased on large-scale development of expressed sequence tag-derived simple sequence repeat markers. PLoS ONE 2014, 9, e0110638. [Google Scholar] [CrossRef] [Green Version]
- Sawler, J.; Stout, J.M.; Gardner, K.M.; Hudson, D.; Vidmar, J.; Butler, L.; Page, J.E.; Myles, S. The genetic structure of marijuana and hemp. PLoS ONE 2015, 10, e0133292. [Google Scholar] [CrossRef] [Green Version]
- Dufresnes, C.; Jan, C.; Bienert, F.; Goudet, J.; Fumagalli, L. Broad-scale genetic diversity of cannabis for forensic applications. PLoS ONE 2012, 12, e0170522. [Google Scholar] [CrossRef] [Green Version]
- Soorni, A.; Fatahi, R.; Haak, D.C.; Salami, S.A.; Bombarely, A. Assessment of genetic diversity and population structure in Iranian cannabis germplasm. Sci. Rep. 2017, 7, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Grassa, C.J.; Weiblen, G.D.; Wenger, J.P.; Dabney, C.; Poplawski, S.G.; Timothy Motley, S.; Michael, T.P.; Schwartz, C.J. A new Cannabis genome assembly associates elevated cannabidiol (CBD) with hemp introgressed into marijuana. New Phytol. 2021, 230, 1665–1679. [Google Scholar] [CrossRef] [PubMed]
- Hu, Z.-G.; Guo, H.-Y.; Hu, X.-L.; Chen, X.; Liu, X.-Y.; Guo, M.-B.; Zhang, Q.-Y.; Xu, Y.-P.; Guo, L.-F.; Yang, M. Genetic Diversity Research of Hemp( Cannabis sativa L ) Cultivar Based on AFLP Analysis. J. Plant Genet. Resour. 2012, 13, 555–561. [Google Scholar]
- Zhang, Q.; Chen, X.; Guo, H.; Trindade, L.M.; Salentijn, E.M.; Guo, R.; Guo, M.; Xu, Y.; Yang, M. Latitudinal adaptation and genetic insights into the origins of Cannabis sativa L. Front. Plant Sci. 2018, 9, 1876. [Google Scholar] [CrossRef] [Green Version]
- Mendel, P.; Lalge, A.B.; Vyhnanek, T.; Trojan, V.; Maassen, H.; Havel, L. Progress in Early Sex Determination of Cannabis Plant by Dna Markers. MendelNet2016 2016, 1, 731–735. [Google Scholar]
- Törjék, O.; Bucherna, N.; Kiss, E.; Homoki, H.; Finta-Korpelová, Z.; Bócsa, I.; Nagy, I.; Heszky, L. Novel male-specific molecular markers (MADC5, MADC6) in hemp. Euphytica 2002, 127, 209–218. [Google Scholar] [CrossRef]
- Faux, A.M.; Berhin, A.; Dauguet, N.; Bertin, P. Sex chromosomes and quantitative sex expression in monoecious hemp (Cannabis sativa L.). Euphytica 2014, 196, 183–197. [Google Scholar] [CrossRef]
- Raman, V.; Lata, H.; Chandra, S.; Khan, I.A.; ElSohly, M.A. Morpho-anatomy of marijuana (Cannabis sativa L.). In Cannabis sativa L.—Botany and Biotechnology; Springer: New York, NY, USA, 2017; pp. 123–136. ISBN 9783319545646. [Google Scholar]
- Slatkin, M. Linkage disequilibrium-understanding the evolutionary past and mapping the medical future. Nat. Rev. Genet. 2008, 9, 477–485. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Botstein, D.; White, R.L.; Skolnick, M. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Maria, P.; Štiasna, K.; Vyhnánek, T.; Trojan, V.; Mrkvicova, E.; Hřivna, L.; Havel, L. Analysis of microsatellite markers in hemp (Cannabis sativa L.). In Proceedings of the MendelNet; International Ph.D. Students Conference on MendelNet 2015: Brno, Czech Republic, 2015. [Google Scholar]
- Kayis, S.A.; Hakki, E.E.; Pinarkara, E. Comparison of effectiveness of ISSR and RAPD markers in genetic characterization of seized marijuana (Cannabis sativa L.) in Turkey. African J. Agric. Res. 2010, 5, 2925–2933. [Google Scholar]
- Oddou-Muratorio, S.; Vendramin, G.G.; Buiteveld, J.; Fady, B. Population estimators or progeny tests: What is the best method to assess null allele frequencies at SSR loci? Conserv. Genet. 2009, 10, 1343–1347. [Google Scholar] [CrossRef]
- Schwabe, A.L.; McGlaughlin, M.E. Genetic tools weed out misconceptions of strain reliability in Cannabis sativa: Implications for a budding industry. J. Cannabis Res. 2019, 1, 1–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Palumbo, F.; Galla, G.; Barcaccia, G. Developing a Molecular Identification Assay of Old Landraces for the Genetic Authentication of Typical Agro-Food Products: The Case Study of the Barley “Agordino. ” Food Technol. Biotechnol. 2017, 55, 29–39. [Google Scholar] [CrossRef] [PubMed]
- Evanno, G.; Regnaut, S. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 20. [Google Scholar] [CrossRef] [Green Version]
- Pisanti, S.; Bifulco, M. Medical Cannabis: A plurimillennial history of an evergreen. J. Cell. Physiol. 2019, 234, 8342–8351. [Google Scholar] [CrossRef]
- Charlesworth, D.; Charlesworth, B.; Marais, G. Steps in the evolution of heteromorphic sex chromosomes. Heredity 2005, 95, 118–128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ren, G.; Zhang, X.; Li, Y.; Ridout, K.; Serrano-Serrano, M.L.; Yang, Y.; Liu, A.; Ravikanth, G.; Nawaz, M.A.; Mumtaz, A.S.; et al. Large-scale whole-genome sequencing unravels the domestication history of Cannabis sativa. Sci. Adv. 2021, in press. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Yan, J.; Huang, S.; Pan, G.; Chang, L.; Li, J.; Zhang, C.; Tang, H.; Chen, A.; Peng, D.; et al. Genetic Diversity and Population Structure of Cannabis Based on the Genome-Wide Development of Simple Sequence Repeat Markers. Front. Genet. 2020, 11, 958. [Google Scholar] [CrossRef] [PubMed]
- Vyhnánek, T.; Nevrtalová, E.; Bjelková, M.; Balgová, B. SSR loci survey of technical hemp cultivars: The optimization of a cost-effective analyses to study genetic variability. Plant Sci. 2020, 298, 110551. [Google Scholar] [CrossRef]
- Toth, J.A.; Stack, G.M.; Cala, A.R.; Carlson, C.H.; Wilk, R.L.; Crawford, J.L.; Viands, D.R.; Philippe, G.; Smart, C.D.; Rose, J.K.C.; et al. Development and validation of genetic markers for sex and cannabinoid chemotype in Cannabis sativa L. GCB Bioenergy 2020, 12, 213–222. [Google Scholar] [CrossRef] [Green Version]
- Prentout, D.; Razumova, O.; Rhoné, B.; Badouin, H.; Henri, H.; Feng, C.; Käfer, J.; Karlov, G.; Marais, G.A.B. An efficient RNA-seq-based segregation analysis identifies the sex chromosomes of Cannabis sativa. Genome Res. 2020, 30, 164–172. [Google Scholar] [CrossRef]
- Schuelke, M. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 2000, 18, 233–234. [Google Scholar] [CrossRef]
- Yeh, F.C.; Boyle, T.J.B. Population Genetic Analysis of Codominant and Dominant Markers and Quantitative Traits. Belgian, J. Bot. 1997, 129, 157–163. [Google Scholar]
- Levene, H. On a matching problem arising in genetics. Ann Math Stat. 1949, 20, 91–94. [Google Scholar] [CrossRef]
- Wright, S. The interpretation of population structure by F-statistics with special regard to systems of mating. Evolution. 1965, 19, 395–420. [Google Scholar] [CrossRef]
- Wright, S. Variability within and among Natural Populations. Evolution and the Genetics of Populations, 4th ed.; University of Chicago Press: Chicago, IL, USA, 1978. [Google Scholar]
- Lewontin, R.C. The Genetic Basis of Evolutionary Change; Columbia, U., Ed.; Columbia University Press: New York, NY, USA, 1974. [Google Scholar]
- McDonald, B.A.; McDermott, J.M. Population genetics of plant pathogenic fungi. Bioscience 1993, 43, 9. [Google Scholar] [CrossRef]
- Rohlf, F.J. NTSYSpc: Numerical Taxonomy and Multivariate Analysis System Ver. 2.2; Exeter Publishing: New York, NY, USA, 2009; ISBN 0925031313. [Google Scholar]
- Dice, L.R. Measurement of the amount of ecological association between species. Ecology 1945, 26, 297–302. [Google Scholar] [CrossRef]
- Swofford, D.L. PUAP: Phylogenetic Analysis Using Parsimong, Ver. 4.0b; Sinauer Associates, Inc.: Sunderland, MA, USA, 2000. [Google Scholar]
- Øyvind, H.; Harper, D.A.T.; Ryan, P.D. PAST: Paleontological statistics software package for education and data analysis. Palaeontol. Electron. 2001, 4, 9. [Google Scholar]
- Falush, D.; Stephens, M. Inference of population structure using multilocus genotype data: Linked loci and correlated allele frequencies. Genetics 2003, 131, 87. [Google Scholar]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic analysis for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weir, B.S. Genetic Data Analysis II; Sinauer Associates, Inc.: Sunderland, MA, USA, 1997; Volume 53, ISBN 978-0878939022. [Google Scholar]
Locus | General Statistics | H-Statistics | F-Statistics | Nm | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Na | pi | PIC | Ho | He | Ha | Fis | Fit | Fst | ||
SSR_6–3 | 7 | 0.54 | 0.57 | 0.50 | 0.62 | 0.25 | 0.00 | 0.22 | 0.22 | 0.86 |
SSR_2–2 | 7 | 0.55 | 0.58 | 0.42 | 0.63 | 0.21 | 0.16 | 0.37 | 0.25 | 0.60 |
SSR_X-1 | 28 | 0.13 | 0.91 | 0.53 | 0.92 | 0.25 | 0.42 | 0.46 | 0.07 | 1.40 |
SSR_4–2 | 11 | 0.43 | 0.70 | 0.22 | 0.74 | 0.10 | 0.73 | 0.76 | 0.10 | 0.69 |
SSR_2–3 | 24 | 0.25 | 0.88 | 0.70 | 0.89 | 0.34 | 0.18 | 0.24 | 0.08 | 1.69 |
SSR_7–3 | 17 | 0.21 | 0.88 | 0.83 | 0.89 | 0.41 | 0.03 | 0.10 | 0.07 | 1.67 |
SSR_3–3 | 23 | 0.20 | 0.90 | 0.70 | 0.91 | 0.34 | 0.19 | 0.26 | 0.09 | 1.47 |
SSR_2–1 | 7 | 0.77 | 0.35 | 0.07 | 0.38 | 0.03 | 0.74 | 0.84 | 0.37 | 0.23 |
SSR_4–1 | 11 | 0.70 | 0.47 | 0.20 | 0.50 | 0.09 | 0.68 | 0.72 | 0.13 | 0.42 |
SSR_8–2 | 20 | 0.17 | 0.90 | 0.84 | 0.91 | 0.39 | 0.07 | 0.16 | 0.10 | 1.33 |
SSR_5–2 | 21 | 0.14 | 0.91 | 0.32 | 0.92 | 0.13 | 0.67 | 0.73 | 0.17 | 0.37 |
SSR_6–1 | 14 | 0.18 | 0.86 | 0.35 | 0.88 | 0.14 | 0.64 | 0.69 | 0.14 | 0.78 |
SSR_X-3 | 25 | 0.13 | 0.92 | 0.70 | 0.93 | 0.29 | 0.31 | 0.37 | 0.10 | 0.87 |
SSR_1–4 | 8 | 0.62 | 0.56 | 0.57 | 0.59 | 0.26 | 0.16 | 0.21 | 0.06 | 2.78 |
SSR_3–1 | 15 | 0.16 | 0.88 | 0.52 | 0.90 | 0.22 | 0.45 | 0.53 | 0.14 | 1.05 |
SSR_8–4 | 17 | 0.16 | 0.88 | 0.41 | 0.90 | 0.18 | 0.56 | 0.61 | 0.12 | 0.78 |
SSR_9–4 | 17 | 0.23 | 0.88 | 0.63 | 0.89 | 0.27 | 0.35 | 0.41 | 0.09 | 1.24 |
SSR_1–1 | 18 | 0.23 | 0.87 | 0.36 | 0.88 | 0.14 | 0.63 | 0.69 | 0.15 | 0.63 |
SSR_5–5 | 8 | 0.70 | 0.46 | 0.08 | 0.49 | 0.03 | 0.86 | 0.89 | 0.21 | 0.51 |
SSR_6–4 | 3 | 0.67 | 0.40 | 0.38 | 0.47 | 0.17 | 0.29 | 0.42 | 0.17 | 1.05 |
Mean | 15.05 | 0.36 | 0.74 | 0.47 | 0.76 | 0.21 | 0.41 | 0.48 | 0.14 | 1.02 |
St. Dev. | 7.12 | 0.23 | 0.20 | 0.23 | 0.19 | 0.11 | 0.27 | 0.24 | 0.08 | 0.13 |
Variety | N | General Statistics | H-Statistics | F-Statistics | Nm | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
P | I | SM (%) | GS (%) | No | Ne | Ho | He | Ha | Fis | Fit | Fst | |||
ITA1 | 10 | 0.90 | 1.19 ± 0.13 | 65.68 ± 4.42 | 88.68 ± 1.71 | 4.90 ± 0.56 | 3.11 ± 0.32 | 0.59 ± 0.05 | 0.62 ± 0.06 | 0.26 ± 0.16 | 0.13 | 0.12 | 0.56 | 0.19 |
ITA2 | 9 | 0.95 | 1.15 ± 0.12 | 64.21 ± 4.80 | 89.16 ± 1.62 | 4.40 ± 0.48 | 3.15 ± 0.36 | 0.58 ± 0.05 | 0.63 ± 0.06 | 0.20 ± 0.17 | 0.27 | 0.36 | 0.68 | 0.12 |
ITA3 | 10 | 1.00 | 1.49 ± 0.09 | 67.96 ± 3.76 | 86.62 ± 1.55 | 6.15 ± 0.47 | 4.00 ± 0.36 | 0.70 ± 0.03 | 0.74 ± 0.03 | 0.25 ± 0.14 | 0.26 | 0.29 | 0.64 | 0.14 |
HUN1 | 11 | 1.00 | 1.15 ± 0.11 | 67.50 ± 5.67 | 89.96 ± 1.67 | 4.60 ± 0.46 | 3.03 ± 0.32 | 0.59 ± 0.05 | 0.62 ± 0.05 | 0.19 ± 0.13 | 0.31 | 0.40 | 0.70 | 0.11 |
HUN2 | 10 | 1.00 | 1.35 ± 0.13 | 67.36 ± 3.31 | 87.09 ± 1.47 | 5.75 ± 0.63 | 3.80 ± 0.49 | 0.64 ± 0.04 | 0.68 ± 0.05 | 0.22 ± 0.13 | 0.24 | 0.35 | 0.68 | 0.12 |
FIN | 11 | 0.85 | 1.41 ± 0.17 | 69.76 ± 2.97 | 87.54 ± 1.27 | 6.15 ± 0.74 | 4.43 ± 0.55 | 0.63 ± 0.07 | 0.66 ± 0.07 | 0.22 ± 0.17 | 0.34 | 0.32 | 0.66 | 0.13 |
NED | 13 | 0.90 | 1.15 ± 0.14 | 65.67 ± 5.88 | 89.37 ± 1.77 | 4.60 ± 0.50 | 3.29 ± 0.40 | 0.57 ± 0.06 | 0.59 ± 0.06 | 0.18 ± 0.15 | 0.35 | 0.38 | 0.69 | 0.11 |
POL | 8 | 1.00 | 1.04 ± 0.12 | 64.16 ± 4.91 | 89.91 ± 1.34 | 3.95 ± 0.41 | 2.77 ± 0.32 | 0.54 ± 0.05 | 0.58 ± 0.05 | 0.21 ± 0.16 | 0.22 | 0.26 | 0.63 | 0.15 |
FRA1 | 10 | 0.95 | 1.22 ± 0.14 | 63.57 ± 6.13 | 88.27 ± 2.15 | 4.70 ± 0.51 | 3.57 ± 0.42 | 0.60 ± 0.06 | 0.64 ± 0.06 | 0.18 ± 0.16 | 0.31 | 0.45 | 0.73 | 0.09 |
FRA2 | 9 | 1.00 | 1.39 ± 0.12 | 63.36 ± 4.30 | 86.26 ± 1.81 | 5.45 ± 0.56 | 4.02 ± 0.50 | 0.67 ± 0.04 | 0.72 ± 0.04 | 0.21 ± 0.13 | 0.32 | 0.40 | 0.70 | 0.11 |
FRA3 | 3 | 0.65 | 0.56 ± 0.11 | 49.86 ± 9.43 | 91.08 ± 2.13 | 2.10 ± 0.25 | 1.89 ± 0.21 | 0.34 ± 0.06 | 0.48 ± 0.09 | 0.17 ± 0.16 | 0.02 | 0.09 | 0.54 | 0.21 |
SCAR | SSR_ 1–1 | SSR_ 1–4 | SSR_ 2–1 | SSR_ 2–2 | SSR_ 2–3 | SSR_ 3–1 | SSR_ 3–3 | SSR_ 4–1 | SSR_ 4–2 | SSR_ 5–2 | SSR_ 5–5 | SSR_ 6–1 | SSR_ 6–3 | SSR_ 6–4 | SSR_ 7–3 | SSR_ 8–2 | SSR_ 8–4 | SSR_ 9–4 | SSR_ X-1 | SSR_ X-3 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
SCAR | × | ** | ** | ||||||||||||||||||
SSR_1–1 | 0.025 | × | ** | ** | ** | ** | ** | ** | ** | ||||||||||||
SSR_1–4 | 0.533 | 0.167 | × | ||||||||||||||||||
SSR_2–1 | 0.008 | 0.002 | 0.031 | × | ** | ** | ** | ** | ** | ** | *** | ** | ** | ** | ** | *** | *** | ||||
SSR_2–2 | 0.115 | 0.062 | 0.097 | 0.003 | × | ** | ** | ** | ** | ||||||||||||
SSR_2–3 | 0.900 | 0.032 | 0.871 | 0.002 | 0.410 | × | |||||||||||||||
SSR_3–1 | 0.092 | 0.005 | 0.053 | 0.003 | 0.029 | 0.132 | × | *** | ** | *** | *** | *** | ** | ** | *** | ** | |||||
SSR_3–3 | 0.103 | 0.036 | 0.254 | 0.051 | 0.121 | 0.617 | 0.044 | × | ** | ** | ** | ** | |||||||||
SSR_4–1 | 0.014 | 0.019 | 0.215 | 0.008 | 0.005 | 0.056 | 0.013 | 0.006 | × | *** | ** | ** | ** | ||||||||
SSR_4–2 | 0.014 | 0.005 | 0.015 | 0.002 | 0.002 | 0.194 | <0.001 | 0.002 | <0.001 | × | *** | *** | ** | ** | ** | *** | ** | ** | |||
SSR_5–2 | 0.058 | 0.013 | 0.227 | 0.005 | 0.021 | 0.238 | 0.009 | 0.030 | 0.016 | <0.001 | × | ** | ** | ** | |||||||
SSR_5–5 | 0.003 | 0.002 | 0.016 | <0.001 | 0.001 | 0.014 | <0.001 | 0.005 | 0.003 | <0.001 | 0.001 | × | ** | *** | ** | *** | ** | ** | *** | *** | ** |
SSR_6–1 | 0.028 | 0.048 | 0.026 | 0.004 | 0.004 | 0.082 | <0.001 | 0.046 | 0.042 | 0.004 | 0.011 | 0.002 | × | ** | ** | ** | ** | ||||
SSR_6–3 | 0.253 | 0.135 | 0.916 | 0.028 | 0.103 | 0.484 | 0.308 | 0.342 | 0.018 | 0.003 | 0.037 | <0.001 | 0.021 | × | |||||||
SSR_6–4 | 0.089 | 0.012 | 0.333 | 0.007 | 0.047 | 0.790 | 0.100 | 0.111 | 0.063 | 0.020 | 0.118 | 0.002 | 0.007 | 0.294 | × | ||||||
SSR_7–3 | 0.285 | 0.016 | 0.518 | 0.006 | 0.019 | 0.138 | <0.001 | 0.090 | 0.014 | 0.001 | 0.015 | <0.001 | 0.002 | 0.243 | 0.100 | × | ** | ||||
SSR_8–2 | 0.806 | 0.019 | 0.486 | 0.006 | 0.078 | 0.170 | 0.051 | 0.107 | 0.122 | 0.014 | 0.026 | 0.010 | 0.120 | 0.369 | 0.431 | 0.168 | × | ||||
SSR_8–4 | 0.060 | 0.003 | 0.058 | 0.011 | 0.078 | 0.042 | 0.001 | 0.019 | 0.015 | <0.001 | 0.007 | 0.009 | 0.032 | 0.113 | 0.069 | 0.040 | 0.085 | × | ** | ** | ** |
SSR_9–4 | 0.083 | 0.008 | 0.070 | <0.001 | 0.126 | 0.250 | 0.002 | 0.010 | 0.019 | 0.002 | 0.046 | <0.001 | 0.008 | 0.144 | 0.162 | 0.225 | 0.447 | 0.010 | × | ** | |
SSR_X-1 | 0.035 | 0.006 | 0.180 | <0.001 | 0.102 | 0.041 | <0.001 | 0.084 | 0.003 | 0.016 | 0.057 | <0.001 | 0.007 | 0.063 | 0.132 | 0.003 | 0.145 | 0.007 | 0.003 | × | |
SSR_X-3 | 0.205 | 0.034 | 0.529 | 0.018 | 0.160 | 0.380 | 0.007 | 0.024 | 0.003 | 0.003 | 0.004 | 0.001 | 0.015 | 0.197 | 0.350 | 0.051 | 0.209 | 0.004 | 0.184 | 0.015 | × |
Variety | Origin | N. of Samples | Sex Behavior of the Samples | Leaf | ||
---|---|---|---|---|---|---|
Dioecious (Male) | Dioecious (Female) | Monoecious | ||||
ITA1 | Italy | 10 | 7 | 3 | | |
ITA2 | Italy | 9 | 4 | 5 | | |
ITA3 | Italy | 10 | 2 | 8 | | |
HUN1 | Hungary | 11 | 6 | 5 | | |
HUN2 | Hungary | 10 | 5 | 5 | | |
FIN | Finland | 11 | 3 | 8 | | |
NED | Netherlands | 13 | 13 | | ||
POL | Poland | 8 | 8 | | ||
FRA1 | France | 10 | 10 | | ||
FRA2 | France | 9 | 9 | | ||
FRA3 | France | 3 | 3 | |
Locus Name | Start | End | Expected Size | Multiplex | Fluo Dye | Ta (°C) | Motif | Forward Primer | Reverse Primer |
---|---|---|---|---|---|---|---|---|---|
SSR_6–3 | 35,062,092 | 35,062,261 | 180–200 | 1 | M13 | 55 | (AAT)10 | ATCTCATTTTCCGTACCTGTT | CTAATTCTCAACTTAACCGCG |
SSR_2–2 | 27,019,093 | 27,019,345 | 250–270 | 1 | M13 | 55 | (TGA)12 | TAGTAGTAGTAGTGCCTGAGG | ACCTTAACAACACCACAACTA |
SSR_X-1 | 12,090,959 | 12,091,352 | 390–450 | 1 | M13 | 55 | (TC)40 | TTGTCAAGGGAGCTTAGTTAG | ATGTGTATTTCTCGCCTGTTA |
SSR_4–2 | 38,738,240 | 38,738,472 | 230–260 | 1 | PAN1 | 55 | (AT)17 | CAGAGTTTGGTCCTTTTCAAA | CACGGATTTTAAGCATTGGAT |
SSR_2–3 | 49,240,375 | 49,240,744 | 350–410 | 1 | PAN1 | 55 | (GA)22 | CTCCCTGCCATTAGACAAATA | CCAGGAGGTAATTTTCTGCTA |
SSR_7–3 | 51,776,452 | 51,776,692 | 230–280 | 1 | PAN2 | 55 | (CT)22 | ACTGTGAACTGTCCTTTTACA | AACAACCTGAAATCCGAAAAG |
SSR_3–3 | 59,258,629 | 59,258,880 | 250–300 | 1 | PAN3 | 55 | (AG)21 | CAAAGAAAGCAGGCATTAGTT | CTCTCTGTGAATGTGATCTGT |
SSR_2–1 | 15,695,145 | 15,695,388 | 240–260 | 2 | M13 | 55 | (AAT)11 | GGCAGGAAAAATCTCAAACAT | ACATTGGAATTAGACAGAGCA |
SSR_4–1 | 3,414,697 | 3,414,947 | 230–270 | 2 | PAN1 | 55 | (ATA)21 | GTTGGTTATGTGTTAGGGTCT | GTTATGGACAAACAATGCATG |
SSR_8–2 | 13,924,026 | 13,924,199 | 180–220 | 2 | PAN2 | 55 | (CT)21 | CATCACACCAGGTACCAATAT | CATGAAACAACGTTGGGTTAT |
SSR_5–2 | 34,558,385 | 34,558,643 | 250–300 | 2 | PAN2 | 55 | (CT)32 | TGGCTGAAAGTAAGAAAAGAC | TTATCGCTCAAAACACTCAAC |
SSR_6–1 | 3,764,859 | 3,765,058 | 200–270 | 2 | PAN3 | 55 | (AT)17 | ACTTCACATGAGATTGAGAACA | TCCTTTGGATTCATTAAGTTGT |
SSR_X-3 | 71,305,129 | 71,305,410 | 280–350 | 2 | PAN3 | 55 | (TC)41 | ACAGTAGTTTTCAGGGTTGAA | TCACACCAATATCTATCAGCC |
SSR_1–4 | 86,039,144 | 86,039,328 | 180–220 | 3 | M13 | 55 | (TTA)17 | TCAAGTTACGTAATCCCCAAA | CCTAAGCACAAGGTTAAATCAT |
SSR_3–1 | 12,247,530 | 12,247,829 | 300–340 | 3 | M13 | 55 | (TC)32 | TGATTTTGCGACCCTTTTATG | CTTTTGCAGGTACATCCAAAA |
SSR_8–4 | 50,925,135 | 50,925,396 | 280–330 | 3 | PAN1 | 55 | (TC)22 | TATGCATCCATTGTACCTGTT | TAATGTTTGTGTGTGTGCAAA |
SSR_9–4 | 58,895,568 | 58,895,670 | 110–150 | 4 | PAN1 | 57 | (CT)16 | TTTCCTGCTCACCTTAAACC | AACCTATATTGAGACGAACCG |
SSR_1–1 | 12,756,851 | 12,757,030 | 180–220 | 4 | PAN1 | 57 | (TC)33 | AAACTGACAGCTTAAGCATTC | TGGGCATGTACTCTATCACTA |
SSR_5–5 | 82,565,436 | 82,565,719 | 270–290 | 4 | PAN2 | 57 | (GA)18 | AGAGGAAGGAAAGAGAGCTAT | CACGAGGGAGCCTTATTAATA |
SSR_6–4 | 63,517,285 | 63,517,456 | 170–180 | 4 | PAN3 | 57 | (CT)30 | ACGAGACTTTACAGAGAACAA | AGATAGGGAAGAACACAACAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Borin, M.; Palumbo, F.; Vannozzi, A.; Scariolo, F.; Sacilotto, G.B.; Gazzola, M.; Barcaccia, G. Developing and Testing Molecular Markers in Cannabis sativa (Hemp) for Their Use in Variety and Dioecy Assessments. Plants 2021, 10, 2174. https://doi.org/10.3390/plants10102174
Borin M, Palumbo F, Vannozzi A, Scariolo F, Sacilotto GB, Gazzola M, Barcaccia G. Developing and Testing Molecular Markers in Cannabis sativa (Hemp) for Their Use in Variety and Dioecy Assessments. Plants. 2021; 10(10):2174. https://doi.org/10.3390/plants10102174
Chicago/Turabian StyleBorin, Marcello, Fabio Palumbo, Alessandro Vannozzi, Francesco Scariolo, Gio Batta Sacilotto, Marco Gazzola, and Gianni Barcaccia. 2021. "Developing and Testing Molecular Markers in Cannabis sativa (Hemp) for Their Use in Variety and Dioecy Assessments" Plants 10, no. 10: 2174. https://doi.org/10.3390/plants10102174