Regulation of Nitrate (NO3) Transporters and Glutamate Synthase-Encoding Genes under Drought Stress in Arabidopsis: The Regulatory Role of AtbZIP62 Transcription Factor
Abstract
:1. Introduction
2. Results
2.1. In Silico Transcription Factor Binding Sites Analysis Identified Cis-Regulatory Elemenents for bZIP TFs in NO3 Transporters and Glutamate Synthase-Encoding Genes
2.2. Prediction of Protein–Protein Interaction Network of Nitrate Transporters and Assimilation
2.3. KEGG Analysis Suggests a Crosstalk between De Novo Pyrimidine Biosynthesis and the Nitrogen Metabolic Pathways
2.4. AtNPF6.2/NRT1.4, AtNPF6.3/NRT1.1 and AtNRT2.2 Were Similarly Regulated in atbzip62 and atpyd1-2 Mutants, While ANRT2.1 Showed Differential Expression Pattern under Drought Stress
2.5. Drought Stress Differentially Regulated AtGLU1 and AtGLU2 Genes
2.6. Proposed Signaling Model of AtbZIP62 TF and NO3 Transporters and Glutamate Synthase under Drought Stress
3. Discussion
3.1. AtbZIP62 Regulates Nitrate Transporter-Encoding Genes in Response to Drought Stress
3.2. AtPYD1 May Play a Role in Mediating Nitrogen Assimilation through Regulation of Glutamate Synthase Encoded Genes under Drought Stress
4. Materials and Methods
4.1. Plant Materials, Growth Conditions, and Drought Stress Induction
4.2. In silico Transcritpion Factor Binding Sites Analysis, Protein–Protein Interaction, and KEGG Pathways Analysis
4.3. Total RNA Isolation, cDNA Synthesis, and qPCR Analysis
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Krapp, A. Plant nitrogen assimilation and its regulation: A complex puzzle with missing pieces. Curr. Opin. Plant Biol. 2015, 25, 115–122. [Google Scholar] [CrossRef] [PubMed]
- Lea, P.J. Primary nitrogen metabolism. Plant Biochem. 1997, 7, 273–313. [Google Scholar]
- Forde, B.G. Nitrate transporters in plants: Structure, function and regulation. Biochim. Bioph. Acta Biom. 2000, 1465, 219–235. [Google Scholar] [CrossRef]
- Fan, X.; Naz, M.; Fan, X.; Xuan, W.; Miller, A.J.; Xu, G. Plant nitrate transporters: From gene function to application. J. Exp. Bot. 2017, 68, 2463–2475. [Google Scholar] [CrossRef] [PubMed]
- Krapp, A.; David, L.C.; Chardin, C.; Girin, T.; Marmagne, A.; Leprince, A.-S.; Chaillou, S.; Ferrario-Méry, S.; Meyer, C.; Daniel-Vedele, F. Nitrate transport and signalling in Arabidopsis. J. Exp. Bot. 2014, 65, 789–798. [Google Scholar] [CrossRef] [PubMed]
- Huang, N.-C.; Liu, K.-H.; Lo, H.-J.; Tsay, Y.-F. Cloning and functional characterization of an Arabidopsis nitrate transporter gene that encodes a constitutive component of low-affinity uptake. Plant Cell 1999, 11, 1381–1392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsay, Y.-F.; Schroeder, J.I.; Feldmann, K.A.; Crawford, N.M.J.C. The herbicide sensitivity gene CHL1 of Arabidopsis encodes a nitrate-inducible nitrate transporter. Cell 1993, 72, 705–713. [Google Scholar] [CrossRef]
- Liu, K.-H.; Huang, C.-Y.; Tsay, Y.-F. CHL1 is a dual-affinity nitrate transporter of Arabidopsis involved in multiple phases of nitrate uptake. Plant Cell 1999, 11, 865–874. [Google Scholar] [CrossRef]
- Filleur, S.; Dorbe, M.-F.; Cerezo, M.; Orsel, M.; Granier, F.; Gojon, A.; Daniel-Vedele, F. An Arabidopsis T-DNA mutant affected in Nrt2 genes is impaired in nitrate uptake. FEBS Lett. 2001, 489, 220–224. [Google Scholar] [CrossRef] [Green Version]
- Cerezo, M.; Tillard, P.; Filleur, S.; Munos, S.; Daniel-Vedele, F.; Gojon, A. Major alterations of the regulation of root NO3− uptake are associated with the mutation of Nrt2.1 and Nrt2.2 genes in Arabidopsis. Plant Physiol. 2001, 127, 262–271. [Google Scholar] [CrossRef] [Green Version]
- Léran, S.; Varala, K.; Boyer, J.-C.; Chiurazzi, M.; Crawford, N.; Daniel-Vedele, F.; David, L.; Dickstein, R.; Fernandez, E.; Forde, B.; et al. A unified nomenclature of NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER family members in plants. Trends Plant Sci. 2014, 19, 5–9. [Google Scholar] [CrossRef] [PubMed]
- Scheurwater, I.; Koren, M.; Lambers, H.; Atkin, O. The contribution of roots and shoots to whole plant nitrate reduction in fast-and slow-growing grass species. J. Exp. Bot. 2002, 53, 1635–1642. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stewart, G.R.; Popp, M.; Holzapfel, I.; Stewart, J.A.; Dickie-Eskew, A. Localization of nitrate reduction in ferns and its relationship to environment and physiological characteristics. New Phytol. 1986, 104, 373–384. [Google Scholar] [CrossRef]
- Wang, X.; Cai, X.; Xu, C.; Wang, Q.; Dai, S. Drought-responsive mechanisms in plant leaves revealed by proteomics. Int. J. Mol. Sci. 2016, 17, 1706. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tcherkez, G.; Hodges, M. How stable isotopes may help to elucidate primary nitrogen metabolism and its interaction with (photo) respiration in C3 leaves. J. Exp. Bot. 2007, 59, 1685–1693. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lea, P.J.; Miflin, B.J. Glutamate synthase and the synthesis of glutamate in plants. Plant Physiol. Biochem. 2003, 41, 555–564. [Google Scholar] [CrossRef]
- Kirkby, E.A.; Knight, A.H. Influence of the level of nitrate nutrition on ion uptake and assimilation, organic acid accumulation, and cation-anion balance in whole tomato plants. Plant Physiol. 1977, 60, 349–353. [Google Scholar] [CrossRef] [Green Version]
- Mundim, F.M.; Pringle, E.G. Whole-plant metabolic allocation under water stress. Front. Plant Sci. 2018, 9, 852. [Google Scholar] [CrossRef]
- Xuan, W.; Beeckman, T.; Xu, G. Plant nitrogen nutrition: Sensing and signaling. Curr. Opin. Plant Biol. 2017, 39, 57–65. [Google Scholar] [CrossRef]
- Ashoub, A.; Baeumlisberger, M.; Neupaertl, M.; Karas, M.; Brüggemann, W. Characterization of common and distinctive adjustments of wild barley leaf proteome under drought acclimation, heat stress and their combination. Plant Mol. Biol. 2015, 87, 459–471. [Google Scholar] [CrossRef]
- Wendelboe-Nelson, C.; Morris, P.C. Proteins linked to drought tolerance revealed by DIGE analysis of drought resistant and susceptible barley varieties. Proteomics 2012, 12, 3374–3385. [Google Scholar] [CrossRef]
- Alberts, B.; Johnson, A.; Lewis, J.; Raff, M.; Roberts, K.; Walter, P. Molecular Biology of the Cell 4th edn (New York: Garland Science). Ann. Bot. 2002, 91, 401. [Google Scholar]
- Watson, D.K.; Kitching, R.; Vary, C.; Kola, I.; Seth, A. Isolation of target gene promoter/enhancer sequences by whole genome PCR method. In Transcription Factor Protocols; Springer: Berlin/Heidelberg, Gemany, 2000; pp. 1–11. [Google Scholar]
- Perry, S.E. Plant Transcription Factors: Methods and Protocols; Humana Press: Totowa, NJ, USA, 2011. [Google Scholar]
- Ali, Z.; Sarwat, S.S.; Karim, I.; Faridi, R.; Jaskani, M.J.; Khan, A.A. Functions of plant’s bZIP transcription factors. Pak. J. Agric. Sci. 2016, 53, 303–314. [Google Scholar]
- Rolly, N.K.; Imran, Q.M.; Shahid, M.; Imran, M.; Khan, M.; Lee, S.-U.; Hussain, A.; Lee, I.-J.; Yun, B.-W. Drought-induced AtbZIP62 transcription factor regulates drought stress response in Arabidopsis. Plant Physiol. Biochem. 2020, 156, 384–395. [Google Scholar] [CrossRef] [PubMed]
- Rolly, N.K.; Imran, Q.M.; Lee, I.-J.; Yun, B.-W. Salinity stress-mediated suppression of expression of salt overly sensitive signaling pathway genes suggests negative regulation by AtbZIP62 transcription factor in Arabidopsis thaliana. Int. J. Mol. Sci. 2020, 21, 1726. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Costa-Broseta, Á.; Castillo, M.; León, J. Nitrite reductase 1 is a target of nitric oxide-mediated post-translational modifications and controls nitrogen flux and growth in Arabidopsis. Int. J. Mol. Sci. 2020, 21, 7270. [Google Scholar] [CrossRef]
- Neill, S.; Barros, R.; Bright, J.; Desikan, R.; Hancock, J.; Harrison, J.; Morris, P.; Ribeiro, D.; Wilson, I. Nitric oxide, stomatal closure, and abiotic stress. J. Exp. Bot. 2008, 59, 165–176. [Google Scholar] [CrossRef] [Green Version]
- Ma, H.; Zhao, J.; Feng, S.; Qiao, K.; Gong, S.; Wang, J.; Zhou, A. Heterologous expression of nitrate assimilation related-protein DsNAR2.1/NRT3.1 affects uptake of nitrate and ammonium in nitrogen-starved Arabidopsis. Int. J. Mol. Sci. 2020, 21, 4027. [Google Scholar] [CrossRef]
- Fang, X.Z.; Fang, S.Q.; Ye, Z.Q.; Liu, D.; Zhao, K.L.; Jin, C.W. NRT1.1 Dual-Affinity Nitrate Transport/Signalling and its Roles in Plant Abiotic Stress Resistance. Front. Plant Sci. 2021, 1817. [Google Scholar] [CrossRef]
- Babst, B.A.; Gao, F.; Acosta-Gamboa, L.M.; Karve, A.; Schueller, M.J.; Lorence, A. Three NPF genes in Arabidopsis are necessary for normal nitrogen cycling under low nitrogen stress. Plant Physiol. Biochem. 2019, 143, 1–10. [Google Scholar] [CrossRef]
- Watanabe, S.; Takahashi, N.; Kanno, Y.; Suzuki, H.; Aoi, Y.; Takeda-Kamiya, N.; Toyooka, K.; Kasahara, H.; Hayashi, K.-i.; Umeda, M.; et al. The Arabidopsis NRT1/PTR FAMILY protein NPF7.3/NRT1.5 is an indole-3-butyric acid transporter involved in root gravitropism. Proc. Natl. Acad. Sci. USA 2020, 117, 31500–31509. [Google Scholar] [CrossRef]
- Liu, W.; Sun, Q.; Wang, K.; Du, Q.; Li, W.X. Nitrogen Limitation Adaptation (NLA) is involved in source-to-sink remobilization of nitrate by mediating the degradation of NRT 1.7 in Arabidopsis. New Phytol. 2017, 214, 734–744. [Google Scholar] [CrossRef] [PubMed]
- Xu, G.; Fan, X.; Miller, A.J. Plant nitrogen assimilation and use efficiency. Ann. Rev. Plant Biol. 2012, 63, 153–182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nadelhoffer, K.J.; Aber, J.D.; Melillo, J.M. Seasonal patterns of ammonium and nitrate uptake in nine temperate forest ecosystems. Plant Soil 1984, 80, 321–335. [Google Scholar] [CrossRef]
- Sorgona, A.; Lupini, A.; Mercati, F.; Di Dio, L.; Sunseri, F.; Abenavoli, M.R. Nitrate uptake along the maize primary root: An integrated physiological and molecular approach. Plant Cell Environ. 2011, 34, 1127–1140. [Google Scholar] [CrossRef] [PubMed]
- Tischner, R. Nitrate uptake and reduction in higher and lower plants. Plant Cell Environ. 2000, 23, 1005–1024. [Google Scholar] [CrossRef]
- Zhang, G.-B.; Meng, S.; Gong, J.-M. The expected and unexpected roles of nitrate transporters in plant abiotic stress resistance and their regulation. Int. J. Mol. Sci. 2018, 19, 3535. [Google Scholar] [CrossRef] [Green Version]
- Fan, S.-C.; Lin, C.-S.; Hsu, P.-K.; Lin, S.-H.; Tsay, Y.-F. The Arabidopsis nitrate transporter NRT1.7, expressed in phloem, is responsible for source-to-sink remobilization of nitrate. Plant Cell 2009, 21, 2750–2761. [Google Scholar] [CrossRef] [Green Version]
- Hu, B.; Wang, W.; Ou, S.; Tang, J.; Li, H.; Che, R.; Zhang, Z.; Chai, X.; Wang, H.; Wang, Y.; et al. Variation in NRT1.1B contributes to nitrate-use divergence between rice subspecies. Nat. Genet. 2015, 47, 834–838. [Google Scholar] [CrossRef] [PubMed]
- Kiba, T.; Krapp, A.J.P.; Physiology, C. Plant nitrogen acquisition under low availability: Regulation of uptake and root architecture. Plant Cell Physiol. 2016, 57, 707–714. [Google Scholar] [CrossRef] [Green Version]
- Kiba, T.; Feria-Bourrellier, A.-B.; Lafouge, F.; Lezhneva, L.; Boutet-Mercey, S.; Orsel, M.; Bréhaut, V.; Miller, A.; Daniel-Vedele, F.; Sakakibara, H.; et al. The Arabidopsis nitrate transporter NRT2.4 plays a double role in roots and shoots of nitrogen-starved plants. Plant Cell 2012, 24, 245–258. [Google Scholar] [CrossRef] [Green Version]
- Li, J.-Y.; Fu, Y.-L.; Pike, S.M.; Bao, J.; Tian, W.; Zhang, Y.; Chen, C.-Z.; Zhang, Y.; Li, H.-M.; Huang, J.; et al. The Arabidopsis nitrate transporter NRT1.8 functions in nitrate removal from the xylem sap and mediates cadmium tolerance. Plant Cell 2010, 22, 1633–1646. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.-Z.; Lv, X.-F.; Li, J.-Y.; Yi, H.-Y.; Gong, J.-M. Arabidopsis NRT1.5 is another essential component in the regulation of nitrate reallocation and stress tolerance. Plant Physiol. 2012, 159, 1582–1590. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Léran, S.; Muños, S.; Brachet, C.; Tillard, P.; Gojon, A.; Lacombe, B. Arabidopsis NRT1.1 is a bidirectional transporter involved in root-to-shoot nitrate translocation. Mol. Plant 2013, 6, 1984–1987. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, W.; Hu, B.; Yuan, D.; Liu, Y.; Che, R.; Hu, Y.; Ou, S.; Liu, Y.; Zhang, Z.; Wang, H.; et al. Expression of the nitrate transporter gene OsNRT1.1A/OsNPF6.3 confers high yield and early maturation in rice. Plant Cell 2018, 30, 638–651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ho, C.-H.; Lin, S.-H.; Hu, H.-C.; Tsay, Y.-F. CHL1 functions as a nitrate sensor in plants. Cell 2009, 138, 1184–1194. [Google Scholar] [CrossRef] [Green Version]
- Krouk, G.; Lacombe, B.; Bielach, A.; Perrine-Walker, F.; Malinska, K.; Mounier, E.; Hoyerova, K.; Tillard, P.; Leon, S.; Ljung, K.; et al. Nitrate-regulated auxin transport by NRT1.1 defines a mechanism for nutrient sensing in plants. Dev. Cell 2010, 18, 927–937. [Google Scholar] [CrossRef]
- Bouguyon, E.; Gojon, A.; Nacry, P. Nitrate sensing and signaling in plants. In Seminars in Cell & Developmental Biology; Academic Press: London, UK, 2012; Volume 23, pp. 648–654. [Google Scholar]
- Mounier, E.; Pervent, M.; Ljung, K.; Gojon, A.; Nacry, P. Auxin-mediated nitrate signalling by NRT 1.1 participates in the adaptive response of A rabidopsis root architecture to the spatial heterogeneity of nitrate availability. Plant Cell Environ. 2014, 37, 162–174. [Google Scholar] [CrossRef]
- Remans, T.; Nacry, P.; Pervent, M.; Filleur, S.; Diatloff, E.; Mounier, E.; Tillard, P.; Forde, B.G.; Gojon, A. The Arabidopsis NRT1.1 transporter participates in the signaling pathway triggering root colonization of nitrate-rich patches. Plant Cell Environ. 2006, 103, 19206–19211. [Google Scholar]
- Zhong, L.; Chen, D.; Min, D.; Li, W.; Xu, Z.; Zhou, Y.; Li, L.; Chen, M.; Ma, Y. AtTGA4, a bZIP transcription factor, confers drought resistance by enhancing nitrate transport and assimilation in Arabidopsis thaliana. Biochem. Bioph. Res. Commun. 2015, 457, 433–439. [Google Scholar] [CrossRef]
- Temple, S.J.; Vance, C.P.; Gantt, J.S. Glutamate synthase and nitrogen assimilation. Trends Plant Sci. 1998, 3, 51–56. [Google Scholar] [CrossRef]
- Charlier, D.; Le Minh, P.N.; Roovers, M. Regulation of carbamoylphosphate synthesis in Escherichia coli: An amazing metabolite at the crossroad of arginine and pyrimidine biosynthesis. Amino Acids 2018, 50, 1647–1661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harb, A.; Pereira, A. Screening Arabidopsis genotypes for drought stress resistance. In Plant Reverse Genetics; Springer: Berlin/Heidlelberg, Germany, 2011; pp. 191–198. [Google Scholar]
- Mun, B.-G.; Lee, S.-U.; Hussain, A.; Kim, H.-H.; Rolly, N.K.; Jung, K.-H.; Yun, B.-W. S-nitrosocysteine-responsive genes modulate diverse regulatory pathways in Oryza sativa: A transcriptome profiling study. Funct. Plant Biol. 2018, 45, 630–644. [Google Scholar] [CrossRef] [PubMed]
Gene Locus ID | TF Name | Target Genes | Position | Strand | p-Value | q-Value | Matched Sequence |
---|---|---|---|---|---|---|---|
AtbZIP62 TF | |||||||
AT1G06070 | AtbZIP69 | AT1G19490 | 1528–1538 | 3.77 10−5 | 0.154 | AACAACTGGCC | |
AT2G40620 | AtbZIP18 | AT1G19490 | 1912–1922 | + | 1.31 10−5 | 0.0546 | ATGAGCTGGCA |
AtPYD1 | |||||||
AT1G06070 | AtbZIP69 | AT3G17810 | 427–437 | + | 2.8 10−5 | 0.115 | TGCAGCTGGAG |
AT1G06070 | AtbZIP69 | AT3G17810 | 427–437 | 6.13 10−5 | 0.126 | TGCAGCTGTTG | |
AtNPF6.2/NRT1.4 | |||||||
AT1G06070 | AtbZIP69 | AT2G26690 | 2934–2944 | 1.04 10−5 | 0.079 | ACCAGCTGGGA | |
AT1G06070 | AtbZIP69 | AT2G26690 | 2935–2945 | + | 4.24 10−5 | 0.109 | CCCAGCTGGTT |
AT1G06070 | AtbZIP69 | AT2G26690 | 1096–1106 | 4.34 10−5 | 0.109 | GACAACTGGTA | |
AT2G40620 | AtbZIP18 | AT2G26690 | 2983–2993 | + | 7.12 10−5 | 0.34 | TCTAGCTGTCT |
AT2G40620 | AtbZIP18 | AT2G26690 | 3469–3479 | + | 8.91 10−5 | 0.34 | GATGGCTGGCT |
AtNPF6.3/NRT1.1 | |||||||
* | * | AT1G12110 | * | * | * | * | * |
* | * | AT1G12110 | * | * | * | * | * |
AtNRT2.1 | |||||||
* | * | AT1G08090 | * | * | * | * | * |
* | * | AT1G08090 | * | * | * | * | * |
AtNRT2.2 | |||||||
AT1G06070 | AtbZIP69 | AT1G08100 | 1761–1771 | 9.28 10−5 | 0.388 | GACAACTGTAT | |
AtGLU1 | |||||||
AT2G40620 | AtbZIP18 | AT5G04140 | 459–469 | + | 8.32 10−5 | 0.348 | TAGGGCTGGCT |
AtGLU2 | |||||||
* | * | AT2G41220 | * | * | * | * | * |
* | * | AT2G41220 | * | * | * | * | * |
Target Proteins | Locus | Description | Reference |
---|---|---|---|
NIR1 | AT2G15620 | Ferredoxin—nitrite reductase, chloroplastic; Involved in the second step of nitrate assimilation. | [28] |
NIA1 | AT1G12110 | Nitrate reductase [NADH] 1; Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. | [29] |
NIA2 | AT1G37130 | Nitrate reductase [NADH] 2; Identified as a mutant resistant to chlorate. Encodes nitrate reductase structural gene. Involved in nitrate assimilation. Has nitrate reductase activity. | [29] |
WR3 | AT1G08100 | High-affinity nitrate transporter 3.1; Acts as a dual component transporter with NTR2.1. Required for high-affinity nitrate transport. May be involved in targeting NRT2 proteins to the plasma membrane. | [30] |
NRT1.1 | AT1G12110 | Protein NRT1/PTR family 6.3; Dual affinity nitrate transporter. Involved in proton- dependent nitrate uptake and in the regulation of the nitrate transporter NRT2.1. Acts also as a nitrate sensor that trigger a specific signaling pathway stimulating lateral root growth and seed germination. The uptake activity is not required for sensor function. | [31] |
NRT1.5 | AT1G32450 | Protein NRT1/PTR FAMILY 7.3; Transmembrane nitrate transporter. Involved in xylem transport of nitrate from root to shoot. Induced in response to nitrate. Not involved in nitrate uptake. Belongs to the PTR2/POT transporter (TC 2.A.17) family | [33] |
NRT1.2 | AT1G69850 | Protein NRT1/PTR family 4.6; Low-affinity proton-dependent nitrate transporter. Involved in constitutive nitrate uptake. Involved in (+)-abscisic acid (ABA) transport. Mediates cellular ABA uptake. Belongs to the PTR2/POT transporter (TC 2.A.17) family | [32] |
NRT1.7 | AT1G69870 | Protein NRT1/PTR family 2.13; Low-affinity proton-dependent nitrate transporter. Involved in phloem loading and nitrate remobilization from the older leaves to other tissues; Belongs to the PTR2/POT transporter (TC 2.A.17) family | [34] |
Gene Name/ Genotype | Locus/SALK | 5′-Forwad Primer-3′ | 5′-Reverse Primer-3′ | GC Content (%) F/R | Amplicon Size (bp) |
---|---|---|---|---|---|
Genotyping primers (Left border and right border) | |||||
atbzip62 | SALK_053908C | TGGCACTTTTAACTTTGTGCC | TACGTTTCCATCGAGTGAACC | - | atbzip62 mutant |
atpyd1-2 | SALK_083897C | TTGGGTGGCAGAACATAGAAC | ATGAATTCAGCGGCATCATAG | - | atpyd1-2 mutant |
Nitrate transporters and assimilation genes in Arabidopsis | |||||
AtNPF6.2 | AT2G26690 | TGGAGAGCAAAGGGAGTTGG | AATGAGAGCGGCAGTGATCC | 55.0/55.0 | 102 |
AtNPF6.3 | AT1G12110 | ATGAAAGGGATGAGCACGGG | CATGGATGAGCTTTCCCGGT | 55.0/55.0 | 110 |
AtNRT2.1 | AT1G08090 | GGCTACGCATCTGACTTTGC | AACGGCAGTTACAAGGGTGT | 55.0/50.0 | 132 |
AtNRT2.2 | AT1G08100 | CTCCGTCTCGGGGAGTATCT | TCATGGAGAACACCGTTGGG | 60.0/55.0 | 119 |
AtGLU1 | AT5G04140 | CTTCTGCATGGGCGACGATA | CCTAAGGGGGTCAATGGCAG | 55.0/60.0 | 118 |
AtGLU2 | AT2G41220 | GCAGCATTTAGCCAACCGTC | AGGCTCAACCTTCCCAACAG | 55.0/55.0 | 94 |
AtActin2 | AT3G18780 | CGCTGACCGTATGAGCAAAG | GGAACCACCGATCCAGACAC | 55.0/60.0 | 106 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rolly, N.K.; Yun, B.-W. Regulation of Nitrate (NO3) Transporters and Glutamate Synthase-Encoding Genes under Drought Stress in Arabidopsis: The Regulatory Role of AtbZIP62 Transcription Factor. Plants 2021, 10, 2149. https://doi.org/10.3390/plants10102149
Rolly NK, Yun B-W. Regulation of Nitrate (NO3) Transporters and Glutamate Synthase-Encoding Genes under Drought Stress in Arabidopsis: The Regulatory Role of AtbZIP62 Transcription Factor. Plants. 2021; 10(10):2149. https://doi.org/10.3390/plants10102149
Chicago/Turabian StyleRolly, Nkulu Kabange, and Byung-Wook Yun. 2021. "Regulation of Nitrate (NO3) Transporters and Glutamate Synthase-Encoding Genes under Drought Stress in Arabidopsis: The Regulatory Role of AtbZIP62 Transcription Factor" Plants 10, no. 10: 2149. https://doi.org/10.3390/plants10102149
APA StyleRolly, N. K., & Yun, B.-W. (2021). Regulation of Nitrate (NO3) Transporters and Glutamate Synthase-Encoding Genes under Drought Stress in Arabidopsis: The Regulatory Role of AtbZIP62 Transcription Factor. Plants, 10(10), 2149. https://doi.org/10.3390/plants10102149