Next Article in Journal
Cloning Coconut via Somatic Embryogenesis: A Review of the Current Status and Future Prospects
Next Article in Special Issue
Development of SNP Set for the Marker-Assisted Selection of Guar (Cyamopsis tetragonoloba (L.) Taub.) Based on a Custom Reference Genome Assembly
Previous Article in Journal
The Possibility of Using Paulownia elongata S. Y. Hu × Paulownia fortunei Hybrid for Phytoextraction of Toxic Elements from Post-Industrial Wastes with Biochar
Previous Article in Special Issue
Population Structure and Genetic Diversity of Two-Rowed Barley Accessions from Kazakhstan Based on SNP Genotyping Data
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 10
Issue 10
10.3390/plants10102048
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Introgression of Bacterial Blight Resistance Genes in the Rice Cultivar Ciherang: Response against Xanthomonas oryzae pv. oryzae in the F6 Generation

by
Priya Lal Biswas
1,2,
Ujjal Kumar Nath
3,
Sharmistha Ghosal
2,
Gayatri Goswami
4,
Md. Shalim Uddin
5,
Omar M. Ali
6,*,
Arafat Abdel Hamed Abdel Latef
7,
Alison M. Laing
8,
Yong-Ming Gao
1 and
Akbar Hossain
9,*
1
National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Sciences, Graduate School of Chinese Academy of Agricultural Sciences (GSCAAS), Haidian District, Beijing 100081, China
2
Bangladesh Rice Research Institute (BRRI), Joydevpur, Gazipur 1701, Bangladesh
3
Department of Genetics and Plant Breeding, Bangladesh Agricultural University, Mymensingh 2202, Bangladesh
4
Department of Genetics and Plant Breeding, Patuakhali Science and Technology University, Patuakhali 8600, Bangladesh
5
Bangladesh Agricultural Research Institute, Gazipur 1701, Bangladesh
6
Department of Chemistry, Turabah University College, Turabah Branch, Taif University, P.O. Box 11099, Taif 21944, Saudi Arabia
7
Botany and Microbiology Department, Faculty of Science, South Valley University, Qena 83523, Egypt
8
CSIRO Agriculture & Food, St. Lucia, QLD 4067, Australia
9
Department of Agronomy, Bangladesh Wheat and Maize Research Institute, Dinajpur 5200, Bangladesh
*
Authors to whom correspondence should be addressed.
Plants 2021, 10(10), 2048; https://doi.org/10.3390/plants10102048
Submission received: 24 August 2021 / Revised: 25 September 2021 / Accepted: 27 September 2021 / Published: 29 September 2021
(This article belongs to the Special Issue Selected Articles from the 6th International Scientific Conference “Plant Genetics, Genomics, Bioinformatics and Biotechnology” (PlantGen2021))
Browse Figures
Versions Notes

Abstract

:
Bacterial blight (BB) is caused by Xanthomonas oryzae pv. oryzae and is one of the most important diseases in rice. It results in significantly reduced productivity throughout all rice-growing regions of the world. Four BB resistance genes have been reported; however, introgression of a single gene into rice has not been able to sufficiently protect rice against BB infection. Pyramiding of effective BB resistance genes (i.e., Xa genes) into background varieties is a potential approach to controlling BB infection. In this study, combinations of four BB resistance genes, Xa4, xa5, xa13, and Xa21, were pyramided into populations. The populations were derived from crossing Ciherang (a widespread Indonesian rice variety) with IRBB60 (resistance to BB). Promising recombinants from the F6 generation were identified by scoring the phenotype against three virulent bacterial strains, C5, P6, and V, which cause widespread BB infection in most rice-growing countries. Pyramiding of genes for BB resistance in 265 recombinant introgressed lines (RILs) were confirmed through marker-assisted selection (MAS) of the F5 and F6 generations using gene-specific primers. Of these 265 RILs, 11, 34 and 45 lines had four, three, or two BB resistance genes, respectively. The RILs had pyramiding of two or three resistance genes, with the Xa4 resistance gene showing broad spectrum resistance against Xoo races with higher agronomic performance compared to their donor and recipients parents. The developed BB-resistant RILs have high yield potential to be further developed for cultivation or as sources of BB resistance donor material for varietal improvement in other rice lines.

1. Introduction

Globally, rice accounts for more than 21% of total food intake; it also provides up to two-thirds of the total calories consumed by more than two billion people across Asia, Africa, and Latin America [1,2,3,4]. It is estimated that rice production must increase by 0.6–0.9% annually until 2050 in order to meet the demand of an increasing world population [5]. However, rice yields have plateaued due to biotic and abiotic stresses [6]. Among these, bacterial blight (BB), which is caused by Xanthomonas oryzae pv. Oryzae (Xoo), is one of the most destructive diseases, limiting rice production around the world. BB was first identified in Japan at the beginning of the twentieth century [7]. It can cause damage at any stage of the rice-growing cycle. BB causes yield losses generally ranging between 10 and 30%, but which can be as high as 80%, depending on the location, season, weather, crop growth stage, and cultivar [8,9,10,11]. There are no chemicals or management practices known to reduce the severity of BB [12]. The development of a BB-resistant rice cultivar through a gene introgression breeding program is critically important [13,14,15].
To date, at least 45 genes across 10 of 12 rice chromosomes have been identified which confer resistance to various strains of Xoo [16,17,18,19]. Among these resistance genes, 17 (xa5, xa8, xa13, xa15, xa19, xa20, xa24, xa25, xa26, xa28, xa31, xa32, xa33, xa34, xa41, xa42 and xa44) are recessive, while the remaining 28 are dominant [20,21,22]. All the genes are in the series from Xa1 to Xa45 [17]. Out of the 45 resistance genes, nine (Xa1, Xa3/xa26, xa5, Xa10, xa13, Xa21, Xa23, xa25 and Xa27) have been cloned and twelve (Xa2, Xa4, Xa7, Xa22, Xa30, xa31, xa33, xa34, Xa38, Xa39, Xa40 and Xa42) have been physically mapped [20,21,22,23,24,25,26,27,28,29]. Some of these resistance genes have been successfully incorporated into rice cultivars that are now extensively cultivated in many rice-growing countries [13,15,30]. Most of the resistance genes follow the classic gene-for-gene concept against the race-specific interaction between rice and Xoo [31]. Most of the genes show resistance in all growing stages of rice, while only a few resistance genes, such as xa13, show resistance to Xoo only at mature plant stages, and xa5 and Xa4 show a broad spectrum of resistance to Xoo isolates [32,33,34]. The gene Xa21, which is found in the wild rice species O. longistaminata, shows resistance against BB at the seedling stage [35] and has the potential to be highly effective against BB in South and South-East Asia [32,33,34,36].
Rice lines with multiple BB resistance genes have a wider and more durable level of resistance than those lines that have only a single BB resistance gene [15,26,37,38,39]. Large-scale, long-term cultivation of rice cultivars carrying a single BB resistance gene may not be sufficient to beat the BB pathogen and resistance will not persist in a long time. Conventional breeding approaches are not efficient enough for the rapid identification of BB resistance genes [40,41,42].
The use of molecular markers to select a particular trait has numerous advantages over the morphological markers of conventional plant breeding [14,39]. We examined the potential for marker-assisted selection to identify rice lines with multiple BB resistance genes (i.e., Xa genes). It is possible to develop closely linked molecular markers for each of the resistance genes within the plants, for their easy identification [15,30,43]. Three BB resistance genes (xa5, xa13, and Xa21) were incorporated in the cultivar PR106 through marker-assisted selection (MAS), showing a broad spectrum of resistance against 17 Xoo isolates under field conditions [15]. This study used phenotypic and molecular markers to identify the BB resistance genes Xa4, xa5, xa13, and Xa21 in recombinant inbred lines (RILs) derived from a cross between the rice varieties ‘Ciherang’ and ‘IRBB60’.

2. Results

2.1. Response of RILs toward BB Races

To assess the level of virulence of the isolates, the leaf area progressed with BB and the percentage of resistance in RILs were examined (Figure 1). Of the three races (i.e., C5 (GD1358), V, and P6 (PX099)), P6 and V were more virulent than C5. Of the total of 265 RILs, only 93 and 94 showed resistance against the P6 and V races, respectively, while 149 RILs were resistant against C5 (Figure 2).
Eighty-five RILs (32%) were moderately resistant against the P6 race, 76 (29%) moderately resistant against V, while 36 RILs (14%) had moderately resistant against C5. In contrast, the number of susceptible or moderately susceptible RILs against each of the races was 92 (35%) for V, 86 (32%) for P6, and 80 (30%) for C5. Both the susceptible check (IR24) and the recipient parent (Ciherang) showed susceptibility against all the tested races. The resistance checks (IRBB5, IRBB13, and IRBB21) and their donor parent (IRBB60) showed resistance or moderately resistant against all three races, and the Xa4 resistance gene bearing the IRBB4 genotype showed resistance against the C5 and P6 races, but was moderately susceptible to V, indicating race-specific resistance of the Xa4 gene. Of the 265 RILs, only three lines were highly susceptible to race V. One was highly susceptible to P6, and no lines were highly susceptible to C5. We identified a higher amount of RILs resistant to C5 than in the other two races (Figure 2), indicating that C5 was comparatively weaker than the V and P6 races.
Two hundred and seventeen RILs (82% of all RILs) were resistant to moderately resistant against single to multiple BB races. Against the three tested races, 55 RILs were resistant and a further eight were moderately resistant (Table 1).

2.2. Molecular Marker Analysis for Characterizing the RILs

A total of 265 RILs were screened by PCR using molecular markers to identify the BB resistance genes (Xa4, xa5, xa13, and Xa21). These RILs had a combination of single, double, triple and quadruple resistance genes in different combination (Table 2). For all the tested markers, the recipient parent ‘Ciherang’ produced a PCR amplicon identical to that of the susceptibility check IR24, while the BB resistant donor parent ‘IRBB60’ generated a PCR amplicon identical to that of the four resistance checks.
Overall, 217 RILs were phenotypically identified as resistant against the three tested races. Of these, 203 RILs had at least one marker amplified by the PCR: a single marker was amplified in 118 RILs and in the remaining 85 RILs, multiple markers were amplified. PCR amplicons were found in 41 RILs for the Xa4 gene, in 23 RILs for the xa5 gene, in 29 RILs for the xa13 gene, and in 25 RILs for the Xa21 gene (Figure 3a). The PCR results identified 100 RILs that carried the Xa4 gene, either alone or in combination with other genes (Figure 3b). Of these, 41 RILs carried only the Xa4 gene, while 19, 29 and 11 RILs amplified the Xa4 gene in combination with one, two or three other resistance genes, respectively (Figure 3b). Seventy-two RILs produced PCR amplicons of the xa5 gene; of these, 23 carried only the xa5 gene, and 20 and 29 RILs amplified the xa5 gene in combination with one or more than one other gene, respectively. Eighty-six RILs carried the xa13 gene both in solely or in combination with other loci; of these, 29 RILs carried only the xa13 gene and the remaining 57 RILs had amplicons with two or more genes. In terms of the Xa21 gene, 25 RILs carried Xa21 alone and 61 RILs had amplicons with two or more genes (Figure 3b). The RILs that carried dominant genes generally combined with other dominant genes, while those with recessive genes combined with other recessive-gene RILs.
A total of 85 pyramided lines with multiple resistance genes was identified from 203 RILs with R genes. Of these, PCR amplification identified 40, 34, and 11 RILs with two, three, or four resistance genes, respectively. Nineteen of the 85 pyramided lines carried one or more heterozygous alleles of the BB resistance gene(s). These pyramided RILs were evaluated in a pedigree nursery up to the F7 generation, and the resistance reaction against BB races was observed. The pyramided RILs that contained four specific resistance genes are shown in Figure 4 along with their parent lines and the resistance and susceptibility checks.

2.3. Agronomic Performance of Pyramided Lines

The 85 pyramided RILs previously identified were categorized into 11 groups (G1 to G11) on the basis of the number and combination of the resistance genes (Table 3). These groups were evaluated under field conditions in Beijing to assess their agronomic performance.
There were significant differences between the pyramiding RIL groups in terms of plant height, panicle length, 1000-grain weight, spikelets per panicle, and the length-to-width ratio of the spikelet (Table 4).
RILs were grouped based on the number and combination of different resistance genes present in the RIL genotypes. Most of the selected RILs were combinations of the IRBB60 and Ciherang gene pools, which showed positive resistance against Xoo races. In comparison with the donor and recipient parents, the RILs showed better agronomic performance. RILs contained the Xa4 resistance gene in combination with other any of the resistance genes showed higher agronomic performance for all the studied traits. These data indicates that RILs with three to four introgressed resistance genes had no adverse effect on the agronomic traits. Although one or two resistance genes in combination with the dominant resistance gene Xa4 were sufficient to resistance response against all three tested virulent Xoo races.

2.4. Associations between the Number and Combinations of Pyramided Resistance Genes and Disease Reaction against Different BB Races

A principal component analysis of the reaction in different BB races in the RILs identified three principal components (PCs) with eigenvalues near to unity (Table 5). The first three PCs together explained 96.9% of the total variance in BB disease reaction in the RILs: 65.8% of the variance was explained by PC1, 21.3% by PC2 and 9.7% by PC3 (Table 5).
The variation accounted for by PC1 was a result of the higher positive coefficients of the resistance reactions of the combinations of the pyramided genes and the strength of the C5 race in combination with the P6 and V races, compared to the high negative coefficients of the individual resistance genes xa5, xa13, Xa4, and Xa21, as well as the weaker disease reaction in RILs in the P6 and V races (Figure 5).
PC1 clearly distinguished between resistant and susceptible RILs (although the identification of moderately resistant RILs was less distinct). This clear distinction corresponded to strong disease-resistance reactions in the pyramided genes in the RILs, either against strong virulent individual races or in a combination of strong and weaker races. Moderately resistant RILs had at least one resistance gene and were moderately resistant against the weaker BB races; therefore these RILs were classified as ‘susceptible’ (Figure 5). These results were applied to the selection of resistant RILs to create the next generation, by excluding those with only moderately resistant.
PC2 divided RILs into resistant and susceptible groups, along with their respective resistant individual or pyramided gene(s) (Figure 5). The susceptible group included those RILs which had no resistance gene; these RILs had mean PC scores of +7.1 and −2.1 from the resistant and susceptible parents, IRBB60 and Ciherang, respectively.

3. Discussion

More than half of the global population eats rice to meet their daily dietary requirements. The demand for rice production is increasing, and many studies have reported that global rice production needs to double by 2050 to meet this growing demand [44]. Additionally, there are many biotic and abiotic stresses which affect both the yield quantity and quality of rice crops. To address these constraints and to increase rice production, it is necessary to develop high-yielding cultivars enriched with disease-resistance genes. The development of rice varieties with broad-spectrum resistance against bacterial blight (BB) (caused by the Xoo bacteria) is hugely challenging due to the presence of several genetically distinct virulent Xoo strains in different rice growing locations in the world [45]. There is little published literature on the development of multiple-race-resistant cultivars. To improve the sustainable cultivation of rice we have planned and executed the introgression of four BB (Xa4, xa5, xa13, and Xa21) resistance genes/QTLs into a Ciherang × IRBB60 cross in order to achieve multiple-BB race resistance in rice. We observed distinct polymorphism with four co-dominant markers linked to the BB resistance genes from the Ciherang (recipient) parent and IRBB60 (donor) parent material (Figure 4).
The main objective of this study was to identify and successfully demonstrate the function of the four BB resistance genes (Xa4, xa5, xa13, and Xa21) in the RILs of the F6 generation. These four target BB resistance genes were identified through bioassays against three BB races (C5, P6, and V) and an effective foreground selection was undertaken using gene-specific markers in 265 RILs in two consecutive generations (F5 and F6). These markers were MP, xa5, xa13, and pTA248 for the Xa4, xa5, xa13, and Xa21 genes, respectively. PCR products showed approximately 140 bp band for the Xa4 gene [46,47], 198 bp band for the xa5 gene, 500 bp for the xa13 gene [48], and 980 bp for the Xa21 gene [46,49,50]; these were confirmed by the resistance checks IRBB4, IRBB5, IRBB13 and IRBB21 (Figure 4).
Of 265 lines, 203 had one or more of the targeted BB resistance genes in different combinations (Figure 3), and 40, 34 and 11 lines had two, three, or four BB resistance genes. These recombinant lines exhibited a high level of resistance against three virulent BB isolates, which correlates with the results of [51]. Mundt [52] also reported that the effectiveness of a combination two or more genes is higher than that of a single gene in defeating simultaneous pathogen mutations for virulence, therefore assembling several resistance genes into a host plant is a viable and practical strategy.
We observed inheritance of some unfavorable characteristics (i.e., biomass growth and grain weight) along with some favorable traits while pyramiding genes/QTLs from the parent IRBB60 variety. A “pull” of undesirable genes from the parent occurred when the Xa21, xa13, and xa5 genes were introgressed from the SS1113 variety [30]. Ramalingam et al. [53] assessed the homozygous improved pyramiding lines (BC3F3 generation) that harbored the xa5 + xa13 + Xa21 + Pi54 + qSBR7-1 + qSBR11-1 + qSBR11-2 genes in terms of physical resistance under greenhouse conditions and suggested that pyramiding three BB resistance genes resulted in higher resistance levels than the lines with only one or two BB resistance genes.
In our bioassay study, 85 pyramided lines which carried at least two BB resistance genes showed a high level of resistance (Figure 3 and Figure 4). Eleven pyramided lines (RIL 12, RIL 15, RIL 32, RIL 44, RIL 51, RIL 53, RIL 155, RIL 156, RIL 166, RIL 215 and RIL 232), all of which had Xa4 + xa5 + xa13 + Xa21 in combination, had higher resistance performance than the RILS with combinations of other genes (Figure 4) [51,54,55,56,57,58]. These 11 RILs had an average of 1.57 cm of diseased leaf area infected with the three BB races (Figure 6), which is similar to results from other reports [41,47,51,57,59,60]. The enhanced resistance due to the combination of two or more genes compared to the resistance from a single gene is known as synergistic action, or quantitative complementation [61]. This result is also further confirmed and explained by our PC analysis.
The pyramided lines were categorized into 11 groups determined by the number and combinations of genes. These pyramided RILs were significantly different in terms of plant height, panicle length, 1000-grain weight, and the spikelet length-to-width ratio, indicating that these pyramided lines have diverse yield potentiality. The field evaluation of improved pyramided lines of the F7 generation demonstrated that selected lines had equivalent yield, agro-morphological, and quality traits and equivalent pyramided genes for BB. This higher level of resistance to BB disease observed in different races without yield penalty is a positive outcome from our approach of integrated genotypic and phenotypic selection methods.

4. Materials and Methods

4.1. Plant Materials

In this study, we used 265 RILs at the F6 generation of the ‘Ciherang × IRBB60’ cross, which were recombinant of recipient and donor parents, four gene-specific BB resistant cultivars (viz. IRBB4, IRBB5, IRBB13, IRBB21) and one BB susceptible line (IR24) (Figure 7). Among these genotypes, the recipient parent ‘Ciherang’, Oryza sativa ssp. indica, is a variety popular in Indonesia which is susceptible to BB, and the donor parent ‘IRBB60’ was developed by the International Rice Research Institute (IRRI) through the pyramiding of four BB resistance genes (Xa4, xa5, xa13, and Xa21) into the existing IR24 variety. The plant materials were evaluated up to the F7 generation for agronomic traits and the segregation of the pyramided BB resistance genes was followed by molecular markers. A rice breeding flowchart is presented in Figure 8 to illustrate the selection work of each generation of the pyramiding rice lines against three BB races.

4.2. Preparation of Inocula to Infect Rice Plants

Three BB races—C5 (GD1358) and V, which are newly virulent strains in China [62], and P6 (PX099), which contained TALE PthXo7 [63] collected from the Philippines—were grown in Wakimoto semi-solid medium (potato 300 g, sucrose 20 g, Na2HPO4·2H2O2 2 g, Ca(NO3)2·4H2O 0.5 g, agar 25 g,) per liter at 25 °C for 72 h and preserved at 4 °C following the standard methodology [64,65,66]. A single colony was further sub-cultured in Wakimoto liquid medium with agitation at room temperature for 72 h and the cell suspension diluted to 108 cells per milliliter of distilled water, which was confirmed by measurement using a spectrophotometer (BOECO MODELS S-200 VIS & S-220 UV/VIS, Hamburg, Germany) with A600 OD. This sub-culture was used to inoculate the F7 rice plants grown in the field.

4.3. Inoculation of Rice Plants with BB Races/Isolates

Seeds of the RILs, their parent varieties, and the check varieties were sown in a 50 × 50 cm seedbed. After 22 days, rice seedlings were manually transplanted into experimental plots in Hainan (18.30 N, 109.30 E). Each plot consisted of two rows with 10 plants per row; spacing was 20 cm row-to-row and 17.5 plant-to-plant. The field experiment was conducted using a randomized complete block design with three replicates. The F5 generation of all varieties and RILs were inoculated with the C5 bacterial race at the reproductive stage (i.e., onset of heading) by clipping 2–3 cm from the tip of the flag leaves and removing all other leaves [67]. In each plot, four hills per row were randomly selected and inoculated.
Subsequently, the F6 generation of RILs, parents, and check varieties were moved to Beijing (40.20 N, 116.20 E) and inoculated with the V and P6 races. To do this, four hills were randomly selected from the first row of each plot and inoculated with the P6 race; a further four hills were inoculated with the V race. The middle two hills in each row were left without inoculation to avoid contamination of the bacterial races.

4.4. Assessment of Disease Response and Scoring

Disease scoring was conducted two weeks after inoculation, following the protocol recommended by the international rice research institute, IRRI [68]. The percentage of diseased leaf area (DLA) was calculated as the lesion length (LL) per total leaf length (TLL) × 100. DLA was categorized as resistant (R) if DLA was 5% or less; as moderately resistant (MR) if DLA was between 6and 12%; as moderately susceptible (MS) if DLA was between 13 and 25%; as susceptible (S) if DLA was between 26 and 50%; and as highly susceptible (HS) if DLA was greater than 50% [68].

4.5. DNA Isolation and PCR Analysis

DNA was extracted from leaf samples of four week old seedlings using the CTAB method [69]. The gene-specific and gene-linked markers MP1, MP2, xa5, xa13 prom, and pTA248, which are linked to genes Xa4, xa5, xa13, and Xa21, were synthesized by the Open Lab of the Chinese Academy of Agricultural Sciences (Table 6) and used to confirm the presence of resistance genes [70]. The polymerase chain reaction (PCR) was performed using 25 µL mixture, which contained 1 µL of 50 ng DNA, 1 µL of 5 µM of each forward and reverse primers, 0.5 µL of 5.0 mM dNTPs, 2.5 µL of 10× PCR buffer (500 mM KCL, 100 mM Tris-HCl pH 8.4, 15 mM MgCl2, 0.1% gelatin), 1.8 µL of 25 mM MgCl2, 1.0~0.75 units/µL Taq polymerase, and 16.2 µL sterile distilled H2O, for the MP1, MP2, xa13 prom and pTA248 markers.
A reaction mixture of 20 µL, consisting of 5 µL DNA (50 ng/µL), 2 µL of 5 µM of each forward and reverse primers, 0.4 µL of 10 mM dNTPs, 2 µL of 10× PCR buffer, 1.6 µL of 25 mM MgCl2, 0.4 of 5 units/µL Taq polymerase and 6.6 µL sterile distilled H2O, was used for the xa5 marker. For the MP1 and MP2 markers, the PCR profile was followed with the initial denaturation at 94 °C for 4 min followed by 35 cycles of denaturation for 1 min at 94 °C, annealing for 1 min at 56 °C and extension for 2 min at 72 °C, with the final extension for 8 min at 72 °C. The PCR profile was followed with the initial denaturation for 5 min at 94 °C followed by 35 cycles of denaturation for 30 s at 94 °C and annealing for 30 s for the xa13 gene; at 1.4 min for the pTA248 markers targeted to the Xa21 gene at 55 °C with a final extension for 10 min at 72 °C. For the for xa5 gene, the PCR was followed with an initial denaturation for 5 min at 94 °C, followed by 35 cycles of denaturation for 1 min at 94 °C, annealing for 1 min at 68 °C and extension for 1 min at 72 °C, with a final elongation for 4 min at 72 °C.
PCR amplicons were mixed with 5 µL loading dye (loading dye:SYBR = 3:1) and visualized under UV-light after electrophoresis with an 8% polyacrylamide gel for Xa4, with 1.5% agarose gel for the xa13 gene, and a 2% agarose gel for the Xa21 and xa5 genes.

4.6. Data Collection and Analysis

Five plants were sampled from each pyramided line at maturity stage, from which yield and yield-contributing traits were measured. These traits were the number of days until 50% heading was achieved, plant height, the number of effective tillers per hill, panicle length, the number of spikelets per panicle, the percentage of spikelets which were fertile, the spikelet length-to-width ratio, the 1000-grain weight, and the grain yield per plant. Data were analyzed using Microsoft Office Excel 2007 and Statistix 10 software (http://www.biosci.global/softwar-en/genstat/, accessed on 15 July 2021).

5. Conclusions

This study aimed to identify bacterial blight-resistant pyramided rice lines in RILs of the F6 generation derived from a cross between the Ciherang and IRBB60 parent varieties. Eighty-five pyramided lines (carrying two to four combinations of the BB resistance genes Xa4, xa5, xa13, and Xa21) were analyzed using phenotypic and MAS techniques. We observed improved agronomic performance of the pyramided lines compared to that of their parent lines or of the check varieties. These pyramided rice lines have potential to be used as agronomic cultivars and/or potential source for increased BB resistance in future breeding programs.

Author Contributions

Conceptualization, P.L.B., U.K.N., S.G., G.G. and Y.-M.G.; methodology and visualization, P.L.B.; software, P.L.B.; validation, P.L.B., S.G. and U.K.N.; formal analysis, P.L.B., M.S.U. and A.H.; investigation, P.L.B., U.K.N., S.G., G.G. and Y.-M.G.; resources, U.K.N., S.G., O.M.A. and Y.-M.G.; data curation, P.L.B., M.S.U. and A.H.; writing—original draft preparation, P.L.B., U.K.N., S.G., G.G., A.M.L. and M.S.U.; writing—review and editing, U.K.N., S.G., O.M.A., A.A.H.A.L., A.H. and A.M.L.; supervision and project administration, U.K.N., S.G., O.M.A. and Y.-M.G.; funding acquisition, O.M.A., A.H., A.A.H.A.L. and Y.-M.G. All authors have read and agreed to the published version of the manuscript in the journal.

Funding

This work was supported by the National Basic Research Program of China (2014AA10A604).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Most of the data are available in all Tables and Figures of the manuscripts.

Acknowledgments

The authors would like to acknowledge the Taif University Researchers Supporting Project number (TURSP-2020/81), Taif University, Taif, Saudi Arabia.

Conflicts of Interest

The authors would hereby like to declare that there is no conflict of interest for the article.

References

  1. Cottyn, B.; Debode, J.; Regalado, E.; Mew, T.; Swings, J. Phenotypic and genetic diversity of rice seed-associated bacteria and their role in pathogenicity and biological control. J. Appl. Microbiol. 2009, 107, 885–897. [Google Scholar] [CrossRef] [PubMed]
  2. Virmani, S.S. Hybrid rice. In Advances in Agronomy; Academic Press: Cambridge, MA, USA, 1996; Volume 57, pp. 377–462. [Google Scholar]
  3. Fitzgerald, M.A.; McCouch, S.R.; Hall, R.D. Not just a grain of rice: The quest for quality. Trends Plant Sci. 2009, 14, 133–139. [Google Scholar] [CrossRef] [PubMed]
  4. Miura, K.; Ashikari, M.; Matsuoka, M. The role of QTLs in the breeding of high-yielding rice. Trends Plant Sci. 2011, 16, 319–326. [Google Scholar] [CrossRef] [PubMed]
  5. Carriger, S.; Vallée, D. More crop per drop. Rice Today 2007, 6, 10–13. [Google Scholar]
  6. Peng, S.; Huang, J.; Sheehy, J.E.; Laza, R.C.; Visperas, R.M.; Zhong, X.; Centeno, G.S.; Khush, G.S.; Cassman, K.G. Rice yields decline with higher night temperature from global warming. Proc. Natl. Acad. Sci. USA 2004, 101, 9971–9975. [Google Scholar] [CrossRef] [Green Version]
  7. Horino, O.; Siwi, B.H.; Miah, S.A.; Mew, T.W. Virulence of Xanthomonas campestris pv. oryzae isolated in Indonesia and Bangladesh. Jpn. J. Phytopathol. 1983, 49, 191–199. [Google Scholar] [CrossRef] [Green Version]
  8. Mew, T.; Cruz, V.; Medalla, E. Changes in race frequency of Xanthomonas oryzae pv. oryzae in response to rice cultivars planted in the Philippines. Plant Dis. 1992, 76, 1029–1032. [Google Scholar] [CrossRef]
  9. Noh, T.-H.; Lee, D.-K.; Park, J.-C.; Shim, H.-K.; Choi, M.-Y.; Kang, M.-H.; Kim, J.-D. Effects of bacterial leaf blight occurrence on rice yield and grain quality in different rice growth stage. Res. Plant Dis. 2007, 13, 20–23. [Google Scholar] [CrossRef] [Green Version]
  10. Reddy, A. Bacterial blight: Crop loss assessment and disease management. In Proceedings of the International Workshop on Bacterial Blight of Rice 1989; International Rice Research Institute: Manila, Philippines, 1989; pp. 79–88. [Google Scholar]
  11. Shin, M.; Shin, H.; Jun, B.; Choi, B. Effects of inoculation of compatible and incompatible bacterial blight races on grain yield and quality of two rice cultivars. Korean J. Breed. 1992, 24, 264–267. [Google Scholar]
  12. Schantz, S.L.; Gasior, D.M.; Polverejan, E.; McCaffrey, R.J.; Sweeney, A.M.; Humphrey, H.; Gardiner, J.C. Impairments of memory and learning in older adults exposed to polychlorinated biphenyls via consumption of Great Lakes fish. Environ. Health Perspect. 2001, 109, 605–611. [Google Scholar] [CrossRef]
  13. Huang, N.; Angeles, E.; Domingo, J.; Magpantay, G.; Singh, S.; Zhang, G.; Kumaravadivel, N.; Bennett, J.; Khush, G. Pyramiding of bacterial blight resistance genes in rice: Marker-assisted selection using RFLP and PCR. Theor. Appl. Genet. 1997, 95, 313–320. [Google Scholar] [CrossRef]
  14. Jena, K.; Mackill, D. Molecular markers and their use in marker-assisted selection in rice. Crop. Sci. 2008, 48, 1266–1276. [Google Scholar] [CrossRef]
  15. Singh, S.; Sidhu, J.; Huang, N.; Vikal, Y.; Li, Z.; Brar, D.; Dhaliwal, H.; Khush, G. Pyramiding three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106. Theor. Appl. Genet. 2001, 102, 1011–1015. [Google Scholar] [CrossRef]
  16. Rao, S.R.; Priyanka, M.; Kumar, M.A.; Ramanaiah, C.; Yashwanth, B.; Mohan, K.M.; Chandra, B.V.; Venkateshwarlu, V.; Gandhi, D.; Rao, N.J.M. Marker-assisted breeding for bacterial blight resistance in parental lines of hybrid rice. J. Plant Pathol. 2017, 99, 691–701. [Google Scholar]
  17. Neelam, K.; Mahajan, R.; Gupta, V.; Bhatia, D.; Gill, B.K.; Komal, R.; Lore, J.S.; Mangat, G.S.; Singh, K. High-resolution genetic mapping of a novel bacterial blight resistance gene xa-45 (t) identified from Oryza glaberrima and transferred to Oryza sativa. Theor. Appl. Genet. 2020, 133, 689–705. [Google Scholar] [CrossRef] [PubMed]
  18. Kim, S.-M.; Reinke, R.F. A novel resistance gene for bacterial blight in rice, Xa43 (t) identified by GWAS, confirmed by QTL mapping using a bi-parental population. PLoS ONE 2019, 14, e0211775. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Kim, S.-M. Identification of novel recessive gene xa44 (t) conferring resistance to bacterial blight races in rice by QTL linkage analysis using an SNP chip. Theor. Appl. Genet. 2018, 131, 2733–2743. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  20. Kim, S.-M.; Suh, J.-P.; Qin, Y.; Noh, T.-H.; Reinke, R.F.; Jena, K.K. Identification and fine-mapping of a new resistance gene, Xa40, conferring resistance to bacterial blight races in rice (Oryza sativa L.). Theor. Appl. Genet. 2015, 128, 1933–1943. [Google Scholar] [CrossRef] [PubMed]
  21. Bhasin, H.; Bhatia, D.; Raghuvanshi, S.; Lore, J.S.; Sahi, G.K.; Kaur, B.; Vikal, Y.; Singh, K. New PCR-based sequence-tagged site marker for bacterial blight resistance gene Xa38 of rice. Mol. Breed. 2012, 30, 607–611. [Google Scholar] [CrossRef]
  22. Kumar, P.N.; Sujatha, K.; Laha, G.; Rao, K.S.; Mishra, B.; Viraktamath, B.; Hari, Y.; Reddy, C.; Balachandran, S.; Ram, T. Identification and fine-mapping of Xa33, a novel gene for resistance to Xanthomonas oryzae pv. oryzae. Phytopathology 2012, 102, 222–228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Song, W.-Y.; Pi, L.-Y.; Wang, G.-L.; Gardner, J.; Holsten, T.; Ronald, P.C. Evolution of the rice Xa21 disease resistance gene family. Plant Cell 1997, 9, 1279–1287. [Google Scholar] [PubMed]
  24. Yang, D.; Sanchez, A.; Khush, G.; Zhu, Y.; Huang, N. Construction of a BAC contig containing the xa5 locus in rice. Theor. Appl. Genet. 1998, 97, 1120–1124. [Google Scholar] [CrossRef]
  25. Sun, X.; Yang, Z.; Wang, S.; Zhang, Q. Identification of a 47-kb DNA fragment containing Xa4, a locus for bacterial blight resistance in rice. Theor. Appl. Genet. 2003, 106, 683–687. [Google Scholar] [CrossRef] [PubMed]
  26. Gu, K.; Yang, B.; Tian, D.; Wu, L.; Wang, D.; Sreekala, C.; Yang, F.; Chu, Z.; Wang, G.-L.; White, F.F. R gene expression induced by a type-III effector triggers disease resistance in rice. Nature 2005, 435, 1122. [Google Scholar] [CrossRef]
  27. Nino-Liu, D.O.; Ronald, P.C.; Bogdanove, A.J. Xanthomonas oryzae pathovars: Model pathogens of a model crop. Mol. Plant Pathol. 2006, 7, 303–324. [Google Scholar] [CrossRef]
  28. Cheema, K.K.; Grewal, N.K.; Vikal, Y.; Sharma, R.; Lore, J.S.; Das, A.; Bhatia, D.; Mahajan, R.; Gupta, V.; Bharaj, T.S. A novel bacterial blight resistance gene from Oryza nivara mapped to 38 kb region on chromosome 4L and transferred to Oryza sativa L. Genet. Res. 2008, 90, 397–407. [Google Scholar] [CrossRef]
  29. Zhang, F.; Zhuo, D.L.; Huang, L.Y.; Wang, W.S.; Xu, J.L.; Vera Cruz, C.; Li, Z.K.; Zhou, Y.L. Xa39, a novel dominant gene conferring broad-spectrum resistance to Xanthomonas oryzae pv. oryzae in rice. Plant Pathol. 2015, 64, 568–575. [Google Scholar] [CrossRef]
  30. Sundaram, R.M.; Vishnupriya, M.R.; Biradar, S.K.; Laha, G.S.; Reddy, G.A.; Rani, N.S.; Sarma, N.P.; Sonti, R.V. Marker assisted introgression of bacterial blight resistance in Samba Mahsuri, an elite indica rice variety. Euphytica 2008, 160, 411–422. [Google Scholar] [CrossRef]
  31. Flor, H.H. Current status of the gene-for-gene concept. Annu. Rev. Phytopathol. 1971, 9, 275–296. [Google Scholar] [CrossRef]
  32. Adhikari, T.B.; Cruz, C.; Zhang, Q.; Nelson, R.; Skinner, D.; Mew, T.; Leach, J. Genetic Diversity of Xanthomonas oryzae pv. oryzae in Asia. Appl. Environ. Microbiol. 1995, 61, 966–971. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Arif, M.; Jaffar, M.; Babar, M.; Sheikh, M.A.; Kousar, S.; Arif, A.; Zafar, Y. Identification of bacterial blight resistance genes Xa4 in Pakistani rice germplasm using PCR. Afr. J. Biotechnol. 2008, 7, 541–545. [Google Scholar]
  34. Garris, A.J.; McCOUCH, S.R.; Kresovich, S. Population structure and its effect on haplotype diversity and linkage disequilibrium surrounding the xa5 locus of rice (Oryza sativa L.). Genetics 2003, 165, 759–769. [Google Scholar] [CrossRef]
  35. Sidhu, G.; Khush, G.S.; Mew, T. Genetic analysis of bacterial blight resistance in seventy-four cultivars of rice, Oryza sativa L. Theor. Appl. Genet. 1978, 53, 105–111. [Google Scholar] [CrossRef]
  36. Zhang, Q.; Ling, S.; Zhao, B.; Wang, C.; Yang, W.; Zhao, K.; Zhu, L.; Li, D.; Chen, C. A new gene for resistance to bacterial blight from Oryza rufipogon. In Advances in Rice Genetics: (In 2 Parts); World Scientific: Singapore, 2003; pp. 143–145. [Google Scholar]
  37. Jeung, J.; Heu, S.; Shin, M.; Vera Cruz, C.; Jena, K. Dynamics of Xanthomonas oryzae pv. oryzae populations in Korea and their relationship to known bacterial blight resistance genes. Phytopathology 2006, 96, 867–875. [Google Scholar] [CrossRef] [Green Version]
  38. Kim, K.; Shin, M.; Kim, W.; Mo, Y.; Nam, J.; Noh, T.; Kim, B.; Ko, J. Effective combination of resistance genes against rice bacterial blight pathogen. Korean J. Breed. Sci. 2009, 41, 244–251. [Google Scholar]
  39. Suh, J.-P.; Noh, T.-H.; Kim, K.-Y.; Kim, J.-J.; Kim, Y.-G.; Jena, K.K. Expression levels of three bacterial blight resistance genes against K3a race of Korea by molecular and phenotype analysis in japonica rice (O. sativa L.). J. Crop. Sci. Biotechnol. 2009, 12, 103–108. [Google Scholar] [CrossRef]
  40. Joseph, M.; Gopalakrishnan, S.; Sharma, R.; Singh, V.; Singh, A.; Singh, N.; Mohapatra, T. Combining bacterial blight resistance and Basmati quality characteristics by phenotypic and molecular marker-assisted selection in rice. Mol. Breed. 2004, 13, 377–387. [Google Scholar] [CrossRef]
  41. Rajpurohit, D.; Kumar, R.; Kumar, M.; Paul, P.; Awasthi, A.; Basha, P.O.; Puri, A.; Jhang, T.; Singh, K.; Dhaliwal, H.S. Pyramiding of two bacterial blight resistance and a semidwarfing gene in Type 3 Basmati using marker-assisted selection. Euphytica 2011, 178, 111–126. [Google Scholar] [CrossRef]
  42. Sundaram, R.M.; Vishnupriya, M.; Laha, G.S.; Rani, N.S.; Rao, P.S.; Balachandran, S.M.; Reddy, G.A.; Sarma, N.P.; Sonti, R.V. Introduction of bacterial blight resistance into Triguna, a high yielding, mid-early duration rice variety. Biotechnol. J. Healthc. Nutr. Technol. 2009, 4, 400–407. [Google Scholar] [CrossRef] [PubMed]
  43. Shanti, M.; Shenoy, V.; Devi, G.L.; Kumar, V.M.; Premalatha, P.; Kumar, G.N.; Shashidhar, H.; Zehr, U.; Freeman, W. Marker-assisted breeding for resistance to bacterial leaf blight in popular cultivar and parental lines of hybrid rice. J. Plant Pathol. 2010, 495–501. [Google Scholar]
  44. Ray, D.K.; Mueller, N.D.; West, P.C.; Foley, J.A. Yield trends are insufficient to double global crop production by 2050. PLoS ONE 2013, 8, e66428. [Google Scholar] [CrossRef] [Green Version]
  45. Das, G.; Rao, G.J.; Varier, M.; Prakash, A.; Prasad, D. Improved Tapaswini having four BB resistance genes pyramided with six genes/QTLs, resistance/tolerance to biotic and abiotic stresses in rice. Sci. Rep. 2018, 8, 2413. [Google Scholar]
  46. Luo, Y.; Sangha, J.S.; Wang, S.; Li, Z.; Yang, J.; Yin, Z. Marker-assisted breeding of Xa4, Xa21 and Xa27 in the restorer lines of hybrid rice for broad-spectrum and enhanced disease resistance to bacterial blight. Mol. Breed. 2012, 30, 1601–1610. [Google Scholar] [CrossRef]
  47. Suh, J.-P.; Jeung, J.-U.; Noh, T.-H.; Cho, Y.-C.; Park, S.-H.; Park, H.-S.; Shin, M.-S.; Kim, C.-K.; Jena, K.K. Development of breeding lines with three pyramided resistance genes that confer broad-spectrum bacterial blight resistance and their molecular analysis in rice. Rice 2013, 6, 5. [Google Scholar] [CrossRef] [Green Version]
  48. Kumar, G.S.; Kumari, K.A.; Rani, C.V.D.; Sundaram, R.; Vanisree, S.; Jamaloddin, M.; Swathi, G. Study of simple sequence repeat (SSR) polymorphism for biotic stress resistance in elite rice variety JGL 1798. Afr. J. Biotechnol. 2013, 12, 5833–5838. [Google Scholar]
  49. Davierwala, A.; Reddy, A.; Lagu, M.; Ranjekar, P.; Gupta, V. Marker assisted selection of bacterial blight resistance genes in rice. Biochem. Genet. 2001, 39, 261–278. [Google Scholar] [CrossRef] [PubMed]
  50. Xu, J.; Jiang, J.; Dong, X.; Ali, J.; Mou, T. Introgression of bacterial blight (BB) resistance genes Xa7 and Xa21 into popular restorer line and their hybrids by molecular marker-assisted backcross (MABC) selection scheme. Afr. J. Biotechnol. 2012, 11, 8225–8233. [Google Scholar]
  51. Dokku, P.; Das, K.; Rao, G. Pyramiding of four resistance genes of bacterial blight in Tapaswini, an elite rice cultivar, through marker-assisted selection. Euphytica 2013, 192, 87–96. [Google Scholar] [CrossRef]
  52. Mundt, C. Probability of mutation to multiple virulence and durability of resistance gene pyramids. Phytopathology 1990, 80, 221–223. [Google Scholar] [CrossRef]
  53. Ramalingam, J.; Raveendra, C.; Savitha, P.; Vidya, V.; Chaithra, T.L.; Velprabakaran, S.; Saraswathi, R.; Ramanathan, A.; Pillai, M.P.A.; Arumugachamy, S. Gene pyramiding for achieving enhanced resistance to bacterial blight, blast, and sheath blight diseases in rice. Front. Plant Sci. 2020, 11, 1662. [Google Scholar] [CrossRef] [PubMed]
  54. Finatto, T.; de Oliveira, A.C.; Chaparro, C.; Da Maia, L.C.; Farias, D.R.; Woyann, L.G.; Mistura, C.C.; Soares-Bresolin, A.P.; Llauro, C.; Panaud, O. Abiotic stress and genome dynamics: Specific genes and transposable elements response to iron excess in rice. Rice 2015, 8, 1–18. [Google Scholar] [CrossRef] [Green Version]
  55. Mew, T. Current status and future prospects of research on bacterial blight of rice. Annu. Rev. Phytopathol. 1987, 25, 359–382. [Google Scholar] [CrossRef]
  56. Zhai, W.; Zhu, L. Rice bacterial blight resistance genes and their utilization in molecular breeding. Adv. Biotechnol. 1999, 19, 9–15. [Google Scholar]
  57. Dokku, P.; Das, K.; Rao, G. Genetic enhancement of host plant-resistance of the Lalat cultivar of rice against bacterial blight employing marker-assisted selection. Biotechnol. Lett. 2013, 35, 1339–1348. [Google Scholar] [CrossRef] [PubMed]
  58. Dash, A.K.; Rao, R.N.; Rao, G.; Verma, R.L.; Katara, J.L.; Mukherjee, A.K.; Singh, O.N.; Bagchi, T.B. Phenotypic and marker-assisted genetic enhancement of parental lines of Rajalaxmi, an elite rice hybrid. Front. Plant Sci. 2016, 7, 1005. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Das, G.; Rao, G. Molecular marker assisted gene stacking for biotic and abiotic stress resistance genes in an elite rice cultivar. Front. Plant Sci. 2015, 6, 698. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  60. Pradhan, S.K.; Nayak, D.K.; Mohanty, S.; Behera, L.; Barik, S.R.; Pandit, E.; Lenka, S.; Anandan, A. Pyramiding of three bacterial blight resistance genes for broad-spectrum resistance in deepwater rice variety, Jalmagna. Rice 2015, 8, 19. [Google Scholar] [CrossRef]
  61. Sanchez, A.; Brar, D.; Huang, N.; Li, Z.; Khush, G. Sequence tagged site marker-assisted selection for three bacterial blight resistance genes in rice. Crop. Sci. 2000, 40, 792–797. [Google Scholar] [CrossRef]
  62. Jialing, L.; Chunchao, W.; Dan, Z.; Jianmin, L.; Xiaorong, S.; Yingyao, S.; Yongli, Z. Genome-wide association study dissects resistance loci against bacterial blight in a diverse rice panel from the 3000 rice genomes project. Rice 2021, 14, 22. [Google Scholar]
  63. Sugio, A.; Yang, B.; Zhu, T.; White, F.F. Two type III effector genes of Xanthomonas oryzae pv. oryzae control the induction of the host genes OsTFII Agamma1 and OsTFX1 during bacterial blight of rice. Proc. Natl. Acad. Sci. USA 2007, 104, 10720–10725. [Google Scholar] [CrossRef] [Green Version]
  64. Ou, S.H. Rice Diseases; IRRI: Los Banos, Philippines, 1985. [Google Scholar]
  65. Chien, C.; Shieh, L. Pathogenic Groups of Xanthomonas campestris pv. oryzae in Taiwan. J. Agric. Res. 1989, 38, 216–228. [Google Scholar]
  66. Hsieh, L.; Chang, Y.; Hsieh, T. Improvement of resistant screening techniques for bacterial leaf blight of rice caused by Xanthomonas oryzae pv. oryzae. J. Taiwan Agric. Res. 2005, 54, 15–22. [Google Scholar]
  67. Kauffman, H. An improved technique for evaluat-ing resistance of rice varieties to Xanthomonas oryzae. Plant Dis. Rep. 1973, 57, 537–541. [Google Scholar]
  68. IRRI. Training Module: Stress and Disease Tolerance; IRRI: Los Banos, Philippines, 2006; Available online: http://www.knowledgebank.irri.org (accessed on 12 May 2021).
  69. Xu, G.-W.; Magill, C.; Schertz, K.; Hart, G. A RFLP linkage map of Sorghum bicolor (L.) Moench. Theor. Appl. Genet. 1994, 89, 139–145. [Google Scholar] [CrossRef] [PubMed]
  70. IRRI. A Report on Bacterial Blight Resistance Genes Xa4, xa5, Xa7, xa13, Xa21, Xa23, and Xa27 Detection Protocol Using Gene-Based and Linked Markers; IRRI: Los Banos, Philippines, 2013; pp. 1–14. [Google Scholar]
  71. Kottapalli, K.R.; Narasu, M.L.; Jena, K.K. Effective strategy for pyramiding three bacterial blight resistance genes into fine grain rice cultivar, Samba Mahsuri, using sequence tagged site markers. Biotechnol. Lett. 2010, 32, 989–996. [Google Scholar] [CrossRef] [PubMed]
Plants 10 02048 g001 550
Figure 1. Disease scoring of infected leaves fourteen days after inoculation with three BB races. DLA—diseased leaf area, R—resistant, MR—moderately resistant, MS—moderately susceptible, S—susceptible, HS—highly susceptible.
Figure 1. Disease scoring of infected leaves fourteen days after inoculation with three BB races. DLA—diseased leaf area, R—resistant, MR—moderately resistant, MS—moderately susceptible, S—susceptible, HS—highly susceptible.
Plants 10 02048 g001
Plants 10 02048 g002 550
Figure 2. Response of plants in RIL to inoculation of fungus. Data are the average of 3 replications with disease scored from 5 leaves in each replication. Mean separation was performed by Tukey test (p ≤ 0.05). The notation indicates resistant (R), moderately resistant (MR), moderately susceptible (MS), susceptible (S) and highly susceptible (HS).
Figure 2. Response of plants in RIL to inoculation of fungus. Data are the average of 3 replications with disease scored from 5 leaves in each replication. Mean separation was performed by Tukey test (p ≤ 0.05). The notation indicates resistant (R), moderately resistant (MR), moderately susceptible (MS), susceptible (S) and highly susceptible (HS).
Plants 10 02048 g002
Plants 10 02048 g003 550
Figure 3. Molecular characterization of the RILs using gene-based and gene-linked markers: (a) number of RILs with a single resistance gene, (b) the RILs which possessed more than one resistance gene in combination.
Figure 3. Molecular characterization of the RILs using gene-based and gene-linked markers: (a) number of RILs with a single resistance gene, (b) the RILs which possessed more than one resistance gene in combination.
Plants 10 02048 g003
Plants 10 02048 g004 550
Figure 4. Molecular markers analysis of selected RILs along with their parent lines and resistant and susceptible checks, showing the homozygous condition of the BB resistance genes Xa4, xa5, xa13, and Xa21. R = resistant; S = susceptible.
Figure 4. Molecular markers analysis of selected RILs along with their parent lines and resistant and susceptible checks, showing the homozygous condition of the BB resistance genes Xa4, xa5, xa13, and Xa21. R = resistant; S = susceptible.
Plants 10 02048 g004
Plants 10 02048 g005 550
Figure 5. Distribution of RILs in terms of resistant, moderately resistant, moderately susceptible, susceptible, and highly susceptible groups, with their BB resistance genes individually or in pyramided conditions, and the disease reaction against individual or combinations of BB races. The combinations of the four BB resistance genes in the figure are: A: Xa4 + xa5; B: Xa4 + xa13; C: Xa4 + Xa21; D: xa5 + xa13; E: xa5 + Xa21; F: xa13 + Xa21; G: Xa4 + xa5 + xa13; H: Xa4 + xa5 + Xa21; I: Xa4 + xa13 + Xa21; J: xa5 + xa13 + Xa21 and K: Xa4 + xa5 + xa13 + Xa21.
Figure 5. Distribution of RILs in terms of resistant, moderately resistant, moderately susceptible, susceptible, and highly susceptible groups, with their BB resistance genes individually or in pyramided conditions, and the disease reaction against individual or combinations of BB races. The combinations of the four BB resistance genes in the figure are: A: Xa4 + xa5; B: Xa4 + xa13; C: Xa4 + Xa21; D: xa5 + xa13; E: xa5 + Xa21; F: xa13 + Xa21; G: Xa4 + xa5 + xa13; H: Xa4 + xa5 + Xa21; I: Xa4 + xa13 + Xa21; J: xa5 + xa13 + Xa21 and K: Xa4 + xa5 + xa13 + Xa21.
Plants 10 02048 g005
Plants 10 02048 g006 550
Figure 6. Percentage of disease infection of the 11 groups of pyramided lines with different combinations of genes.
Figure 6. Percentage of disease infection of the 11 groups of pyramided lines with different combinations of genes.
Plants 10 02048 g006
Plants 10 02048 g007 550
Figure 7. Morphological features of the recipient (Ciherang), donor (IRBB60) parents and their recombinant lines (RILs).
Figure 7. Morphological features of the recipient (Ciherang), donor (IRBB60) parents and their recombinant lines (RILs).
Plants 10 02048 g007
Plants 10 02048 g008 550
Figure 8. Rice breeding flowchart to illustrate the selection work of each generation of the pyramiding lines against different BB races.
Figure 8. Rice breeding flowchart to illustrate the selection work of each generation of the pyramiding lines against different BB races.
Plants 10 02048 g008
Table
Table 1. Phenotypic disease response of 265 RILs against different BB races of rice considering single and multiple races together.
Table 1. Phenotypic disease response of 265 RILs against different BB races of rice considering single and multiple races together.
RacesPhenotypes
RMRMSS
C5384210
P681700
V7600
C5 + P6275100
C5 + V29740
P6 + V3300
C5 + P6 + V558112
Total21748
Table
Table 2. Phenotypic and genotypic status of 265 RILs assessed by bioassay against three BB races screened with four markers.
Table 2. Phenotypic and genotypic status of 265 RILs assessed by bioassay against three BB races screened with four markers.
Phenotypic StatusGenic Status *RILs with Different Genes
Xa4xa5xa13Xa21
Single locus41232925
ResistantDouble loci19201922
Triple loci29182728
Quadruple loci11111111
SusceptibleNo amplification165193179179
Total265265265265
* Single locus: presence of any one gene out of targeted four pyramiding loci; Double loci: presence of any 2 genes out of targeted four pyramiding loci; Triple loci: presence of any 3 genes out of targeted four pyramiding loci; and Quadruple loci: presence of any 4 genes out of targeted four pyramiding loci.
Table
Table 3. Grouping of the pyramided RILs with more than one resistance gene.
Table 3. Grouping of the pyramided RILs with more than one resistance gene.
GroupR GenesNumber of RILs with Tag Number within Parenthesis
G1Xa4 + xa54 (68, 78, 163, 219)
G2Xa4 + xa133 (107, 121, 128)
G3Xa4 + Xa2112 (16, 28, 63, 66, 69, 91, 126, 164, 180, 189, 212, 255)
G4xa5 + xa1311 (39, 43, 52, 61, 71, 117, 144, 182, 202, 210, 253)
G5xa5 + Xa215 (109, 134, 143, 213, 252)
G6xa13 + Xa215 (11, 77, 191, 211, 248)
G7Xa4 + xa5 + xa136 (47, 58, 64, 206, 235, 262)
G8Xa4 + xa5 + Xa217 (7, 34, 74, 94, 186, 207, 199)
G9Xa4 + xa13 + Xa2116 (3, 31, 35, 40, 42, 49, 57, 79, 118, 122, 127, 141, 161, 162, 194, 247)
G10xa5 + xa13 + Xa215 (133, 174, 221, 222, 223)
G11Xa4 + xa5 + xa13 + Xa2111 (12, 15, 32, 44, 51, 53, 155, 156, 166, 215, 232)
Table
Table 4. Agronomic performance of the 85 BB resistance RILs relative to their donor and recipient parents, data represent average of 3 replications and number of RILs in a particular group.
Table 4. Agronomic performance of the 85 BB resistance RILs relative to their donor and recipient parents, data represent average of 3 replications and number of RILs in a particular group.
GenotypeHDPHTNPLS/PSF%L/WTGWY
Ciherang108.00i83.33f9.67ab20.09i114.33f79.83c–e3.25b–d24.15c–f16.10i
IRBB60117.00c–e82.13f9.27a–c21.85h125.27ef86.57ab2.76e23.51e–g17.24gh
G1119.17a–c90.57de7.00gh23.75d–f189.30ab77.32e3.41ab23.41f–h19.38bc
G2120.78a90.42de8.01c–g23.06fg117.70ef83.49a–d3.42ab23.56e–g22.64a
G3120.44ab94.58cd6.85gh24.22c–e163.05b–d78.89de3.47a25.29ab19.92b
G4114.91e–g100.82ab8.66b–f25.26a186.13ab85.48ab3.43a24.48b–f18.56c–e
G5116.47d–f96.12b–d7.77d–g24.52a–d193.21a85.45ab3.45a25.27a–c18.68fg
G6116.60de95.37b–d8.83b–e24.20c–e172.03ab79.71de3.49a23.87d–f16.63hi
G7118.11cd103.59a7.91c–g25.31a187.23ab83.55a–d3.43a25.15a–c18.16ef
G8113.10gh99.91a–c7.94c–g23.56ef190.78a81.54b–e3. 41ab24.58a–e19.08cd
G9116.67de100.18a–c8.85b–e25.04ab191.44a85.21a–c3.38a–c24.72a–d19.29bc
G10116.80de96.33b–d10.36a24.72a–c142.67de87.46a3.53a25.64a18.29d–f
G11116.55d–f101.36ab9.16a–d25.20ab171.65a–c88.26a3.42ab24.76a–d18.57c–e
IRBB4114.33fg88.00ef7.67e–h23.21fg140.00df79.67de3.17d22.36hi18.45d–f
IRBB5115.67ef85.44ef7.00gh23.32fg128.33ef83.28a–d3.08d22.13i17.63fg
IRBB13111.00h86.00ef6.67gh23.50e–f128.67ef83.00a–d3.19d22.70g–i16.89g–i
IRBB21118.33b–d86.56ef7.33f–h24.45b–d120.00ef83.53a–d3.20cd22.60g–i18.26d–f
IR24115.33ef99.00a–c6.33h22.58gh144.33c–e69.67f3.08d22.28hi16.11i
p (≤0.05)0.010.010.010.010.010.010.010.010.01
St dev (±)0.722.000.460.269.001.780.060.370.27
HD = days to 50% heading, PH = plant height (cm), TN = number of effective tillers, PL = panicle length (cm), S/P = spikelets per panicle, SF% = percentage of spikelet fertility, L/W = length-to-width spikelet ratio, TGW = 1000-grain weight (g), and Y = yield per plant (g).
Table
Table 5. Component loadings and mean principal component (PC) scores, showing (1) the association between resistant, moderately resistant, moderately susceptible, susceptible, and highly susceptible groups, along with their BB resistance gene(s) individually or in pyramiding conditions; and (2) the disease reaction in BB races (individually or in combinations) as determined using the principal component analysis. The combinations of resistance genes are grouped alphabetically for easier representation in Figure 5.
Table 5. Component loadings and mean principal component (PC) scores, showing (1) the association between resistant, moderately resistant, moderately susceptible, susceptible, and highly susceptible groups, along with their BB resistance gene(s) individually or in pyramiding conditions; and (2) the disease reaction in BB races (individually or in combinations) as determined using the principal component analysis. The combinations of resistance genes are grouped alphabetically for easier representation in Figure 5.
VariablesPC1PC2PC3
C50.189−0.1450.11
P6−0.084−0.0410.644
V−0.1230.210.514
C5 P60.234−0.0960.201
C5V0.242−0.0630.191
P6 V−0.1170.2830.436
C5 P6 V0.260.0210.091
Xa40.0090.454−0.09
xa5−0.060.44−0.092
xa13−0.0470.445−0.092
Xa21−0.0360.448−0.092
Xa4 + xa5 (A)0.2590.0610.006
Xa4 + xa13 (B)0.2590.0610.006
Xa4 + Xa21 (C)0.2590.0610.006
xa5 + xa13 (D)0.2590.0610.006
xa5 + Xa21 (E)0.2590.0610.006
xa13 + Xa21 (F)0.2590.0610.006
Xa4 + xa5 + xa13 (G)0.2590.0610.006
Xa4 + xa5 + Xa21 (H)0.2590.0610.006
Xa4 + xa13 + Xa21 (I)0.2590.0610.006
xa5 + xa13 + Xa21 (J)0.2590.0610.006
Xa4 + xa5 + xa13 + Xa21 (K)0.2590.0610.006
Eigenvalue14.4744.6892.145
Proportion0.6580.2130.097
Cumulative0.6580.8710.969
Table
Table 6. Gene-specific DNA markers linked to BB resistance genes which were used in screening and selection of pyramided lines.
Table 6. Gene-specific DNA markers linked to BB resistance genes which were used in screening and selection of pyramided lines.
GeneChr No.Marker NamePrimer SequencesExpected Size (bp)References
Xa411MP1ForwardATCGATCGATCTTCACGAGG150[69]
MP2ReverseTGCTATAAAAGGCATTCGGG
xa55xa5ForwardGCTCGCCATTCAAGTTCTTGAG198[70]
ReverseCCTTGATAGAAACCT TGCCTTGAC
xa138xa13 promForwardCCTGATATGTGAGGTAGT500[22]
ReverseGAGAAAGGCTTAAGTGC
Xa2111pTA248ForwardCGATCGGTATAACAGCAAAAC1000[71]
ReverseAGACGCGGTAATCGAAAGATGAAA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Biswas, P.L.; Nath, U.K.; Ghosal, S.; Goswami, G.; Uddin, M.S.; Ali, O.M.; Latef, A.A.H.A.; Laing, A.M.; Gao, Y.-M.; Hossain, A. Introgression of Bacterial Blight Resistance Genes in the Rice Cultivar Ciherang: Response against Xanthomonas oryzae pv. oryzae in the F6 Generation. Plants 2021, 10, 2048. https://doi.org/10.3390/plants10102048

AMA Style

Biswas PL, Nath UK, Ghosal S, Goswami G, Uddin MS, Ali OM, Latef AAHA, Laing AM, Gao Y-M, Hossain A. Introgression of Bacterial Blight Resistance Genes in the Rice Cultivar Ciherang: Response against Xanthomonas oryzae pv. oryzae in the F6 Generation. Plants. 2021; 10(10):2048. https://doi.org/10.3390/plants10102048

Chicago/Turabian Style

Biswas, Priya Lal, Ujjal Kumar Nath, Sharmistha Ghosal, Gayatri Goswami, Md. Shalim Uddin, Omar M. Ali, Arafat Abdel Hamed Abdel Latef, Alison M. Laing, Yong-Ming Gao, and Akbar Hossain. 2021. "Introgression of Bacterial Blight Resistance Genes in the Rice Cultivar Ciherang: Response against Xanthomonas oryzae pv. oryzae in the F6 Generation" Plants 10, no. 10: 2048. https://doi.org/10.3390/plants10102048

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop