Next Article in Journal
Comparative Proteomic Analysis of Gonadal Tissue in Solea senegalensis Reveals Reproductive Deregulation Associated with F1 Individuals
Previous Article in Journal
In Vivo Evaluation of Oxidative Stress Induced by Intraperitoneal Administration of Mannosylerythritol Lipid Biosurfactant in Swiss Mice
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomolecules
Volume 16
Issue 2
10.3390/biom16020311
biomolecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

gga-let-7c-3p Inhibits Chicken Abdominal Adipogenesis by Regulating PPARD Gene

by
Xi Cheng
1,
Shuohan Li
1,
Ke Zhang
1,
Yulong Guo
1,2,3,
Hong Li
1,2,3,
Zhuanjian Li
1,2,3,
Yadong Tian
1,2,3,
Xiangtao Kang
1,2,3,
Xiaojun Liu
1,2,3,* and
Weihua Tian
1,2,3,*
1
College of Animal Science and Technology, Henan Agricultural University, Zhengzhou 450046, China
2
Key Laboratory of Livestock and Poultry Resources (Poultry) Evaluation and Utilization of Ministry of Agriculture and Rural Affairs, Henan Agricultural University, Zhengzhou 450046, China
3
Henan Innovative Engineering Research Center of Poultry Germplasm Resource, Zhengzhou 450046, China
*
Authors to whom correspondence should be addressed.
Biomolecules 2026, 16(2), 311; https://doi.org/10.3390/biom16020311
Submission received: 22 December 2025 / Revised: 4 February 2026 / Accepted: 14 February 2026 / Published: 16 February 2026
(This article belongs to the Section Molecular Genetics)
Browse Figures
Versions Notes

Abstract

MicroRNAs (miRNAs) have been increasingly involved in mammalian lipid metabolism. However, their regulatory roles and molecular mechanisms in abdominal fat deposition in chicken remain largely unexplored. In this study, based on the previous miRNA transcriptome data during chicken abdominal preadipocytes’ adipogenic differentiation, we explored the biological functions and regulatory mechanisms of a differentially expressed miRNA, gga-let-7c-3p, in adipogenesis. Gain- and loss-of-function assays elucidated that gga-let-7c-3p significantly decreased viability, proliferation, cell cycle progression, intracellular lipid droplet accumulation and triglyceride content, as well as the mRNA expression of proliferation- and lipid metabolism-related genes in chicken abdominal preadipocytes. Dual-luciferase reporter assay confirmed that gga-let-7c-3p could directly interact with the 3′UTR of the transcription factor—peroxisome proliferator activated the receptor delta (PPARD) gene and thus inhibited its post-transcriptional expression. The PPARD gene significantly decreased viability, proliferation, and cell cycle progression, while it increased intracellular lipid droplet accumulation and triglyceride content of chicken abdominal preadipocytes, paralleling with the mRNA expression of proliferation- and lipid metabolism-related genes. Collectively, gga-let-7c-3p could inhibit the proliferation and adipogenic differentiation of chicken abdominal preadipocytes, at least by targeting the PPARD gene. These findings reveal the regulatory mechanisms of the gga-let-7c-3p/PPARD axis in chicken abdominal adipogenesis, and could provide potential molecular markers for lean line broiler breeding.

1. Introduction

Chickens (Gallus gallus) are a pivotal agriculture animal and directly related to the economic benefits because of their meat yield and egg production. Although intensive selection on chicken growth rate and body weight has remarkably improved their growth performance, it was accompanied by excessive deposition of abdominal fat (AF), which is a waste of carcass processing in the poultry industry. Excessive AF deposition not only reduces feed conversion efficiency and meat quality, but also increases production costs and may lead to metabolic diseases such as fatty liver, thus hindering profitable farming [1,2]. Lean line broiler (low AF deposition) breeding has been a long-term challenge for global poultry breeders. Considering the high heritability of AF weight and AF percentage in chickens, a genetic approach maybe the most effective manner for reduced AF deposition [3]. Therefore, identifying the crucial regulatory factors and studying the molecular regulatory mechanism of AF deposition are of great significance to molecular breeding of lean line broilers [4].
AF expands by increasing the number of abdominal preadipocytes (proliferation) and their maturation into adipocytes with lipid droplet accumulation (adipogenic differentiation) [5]. Preadipocyte proliferation occurs primarily during embryonic and early postnatal development, while adipogenic differentiation dominates at later stages of growth and development. Both proliferation and adipogenic differentiation processes are orchestrated by the sequential regulation of non-coding RNAs (ncRNAs), transcriptional regulators and adipogenesis-related genes [6,7,8]. MicroRNAs (miRNAs) are 22 nt endogenous ncRNAs with high conservation among species and can inhibit post-transcriptional expression by triggering mRNA degradation and translation inhibition through their seed region sequences (2–8 nucleotides), complete or incomplete complementarity to the 3’untranslated regions (UTRs) of the target gene, thus participating in multiple cellular processes such as proliferation, differentiation, apoptosis [5,9,10]. Increasing evidence has supported the strong involvement of miRNAs in chicken AF deposition by mediating the proliferation and adipogenic differentiation of chicken abdominal preadipocytes by post-transcriptionally regulating target gene expression, including miR-106-5p/KLF15 axis [11], miR-122-5p/FABP5 [12], miR-125b-5p/ACSBG2 [13], miR-429-3p/LPINI [14], miR-17-92/MAP3K2 [15], miR-301b-3p/ACSL1 [16], miR-24-3p/FNIP2 [17], miRNA-206/KLF4 [18], miR-200b-3p/SESN1 [19], and miR-20b-3p/TMEM38B [20].
The let-7 gene was first identified in the screening of developmental defects in Caenorhabditis elegans [21], and later discovered to encode a miRNA that promoted the differentiation of cellular fates [22]. Increasing evidence has shown that let-7 could affect the mammalian lipid metabolism by targeting adipogenesis-related genes. For example, in mouse macrophages treated with oxidized low-density lipoprotein, let-7c knockdown inhibited lipid accumulation but did not affect cholesterol uptake, and let-7c overexpression promoted lipid accumulation by downregulating the mRNA and protein expression of PGC-1α gene to activate LXRα/ABCA1/G1 axis [23]. Let-7c-3p could significantly reduce lipid accumulation of mouse foamy macrophages by regulating PPAR/RXR [24]. Let-7c could inhibit bovine preadipocytes proliferation and promote their adipogenic differentiation by targeting the PPARGC1B gene [25]. Additionally, let-7c-3p could promote the directed differentiation of human chronic myeloid leukemia cells into monocytes or macrophages by targeting Egr-1 gene [26]. Let-7a-5p could inhibit the proliferation and adipogenic differentiation of rabbit preadipocytes by targeting the Srebf2 and Thbs1 genes [27]. In chicken, the RNA-seq data of breast muscle tissues with high- and low-body weight identified the let-7 family as the dominant miRNAs involved in breast muscle development, including multiple members such as gga-let-7a, -7c, -7f, -7j, -7k, etc., particularly gga-let-7c showing high expression abundance [28]. However, little was known about its regulatory roles in fat deposition, especially in chickens. The previously constructed miRNA expression profiles by RNA-seq for chicken abdominal preadipocytes at different differentiated stages demonstrated that gga-let-7c-3p was differentially expressed and exhibited a significantly decreased expression during chicken abdominal preadipocytes’ adipogenic differentiation, suggesting its potential involvement in chicken AF deposition.
In this study, we investigated the biological functions and regulatory mechanisms of gga-let-7c-3p underlying chicken AF deposition and found that gga-let-7c-3p could inhibit chicken abdominal preadipocytes’ proliferation and adipogenic differentiation by downregulating the post-transcriptional expression of its target peroxisome proliferator activated receptor delta (PPARD) gene, which encodes a transcription factor that subsequently affected the expression of PPARD-responsive genes involved in proliferation and adipogenic differentiation. These findings enhance our understanding of the molecular mechanisms governing AF deposition in poultry, and provide potential genetic markers for lean line broiler breeding.

2. Materials and Methods

2.1. Cell Culture

Immortalized chicken preadipocytes 2 (ICP2) cells were established and provided by the Key Laboratory of Chicken Genetics and Breeding, Ministry of Agriculture (Northeast Agricultural University, Harbin, China) [29]. The chicken embryonic fibroblast (DF1) cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). ICP2 cells and DF1 cells were cultured in complete medium comprising in DMEM-F12 basic medium (Gibco, Gaithersburg, MD, USA) with a supplement of 10% fetal bovine serum (Gibco, Gaithersburg, MD, USA) and 2% penicillin streptomycin bispecific (Gibco, Gaithersburg, MD, USA). When they reached 80–90% confluence, ICP2 cells were maintained with differentiation medium containing complete medium with a supplement of 160 μM oleic acid (Solarbio, Beijing, China) dissolved in dimethyl sulfoxide (Solarbio, Beijing, China) to induce adipogenic differentiation.

2.2. RNA Isolation, Reverse Transcription, and Real-Time Quantitative PCR (qPCR)

Total RNA from cells was isolated using TRIzol reagent (Vazyme Biotech, Nanjing, China). Reverse transcription for cDNA synthesis was conducted using the HiScript IIl RT SuperMix for qPCR (+gDNA wiper) (Vazyme Biotech, Nanjing, China). The SYBR Green-based qPCR was performed on the Roche LightCycler 96 system (Roche, Basel, Switzerland) using a 10 μL reaction mixture, including 0.4 μL of forward and reverse primers each (10 μM), 1 μL of cDNA (approximately 100 ng), 3.2 μL RNase-free water, and 5 μL 2 × ChamQ SYBR qPCR Master Mix (Vazyme Biotech, Nanjing, China). β-actin and U6 were used as internal reference genes to normalize the relative mRNA and miRNA expression, respectively. All experiments were conducted in triplicate. The qPCR primers were designed using Primer Premier 5.0 software and synthesized by Qingke Biotechnology Co., Ltd. (Beijing, China). The qPCR primers were listed in Supplementary Table S1. The 2−ΔΔCt method was used for calculating the relative miRNA/mRNA expression.

2.3. Recombinant Plasmid Construction and Cell Transfection

To construct the overexpression plasmid of PPARD gene, its coding sequence (CDS) was cloned into the HindIII and EcoRI restriction enzymes (Takara, Kyoto, Japan) double-digested pcDNA3.1 (+) vector (Invitrogen, Carlsbad, CA, USA), termed as pcDNA3.1-PPARD. Short interfering RNAs specifically targeting the PPARD gene (si-PPARD, 5′ CCGCATGAAGCTGGAATAT 3′) and negative control (si-NC) were synthesized by Ribo Biotechnology (Ribobio, Guangzhou, China). gga-let-7c-3p mimics (sense: CUGUACAACCUUCUAGCUUUCC, anti-sense: GGAAAGCTAGAAGGTTGTACAG) and the mimics NC (sense: UUCUCCGAACGUGUCACGUTT, anti-sense: ACGUGACACGUUCGGAGAATT) were synthesized by GenePharma Co., Ltd. (Shanghai, China). The gga-let-7c-3p inhibitor (sense: GGAAAGCUAGAAGGUUGUACAG) and the inhibitor NC (sense: CAGUACUUUUGUGUAGUACAA) were synthesized by GenePharma Co., Ltd. (Shanghai, China).
To validate the direct target of gga-let-7c-3p to the PPARD gene, its 3′UTR with or without the gga-let-7c-3p binding site were cloned into psi-CHECK™-2 plasmid (Promega, Madison, WI, USA) with XhoI and NotI restriction enzymes (Takara, Kyoto, Japan) double digestion, respectively, named as wild-type plasmid (PPARD-3′UTR-WT) and mutant plasmid (PPARD-3′UTR-MuT).
All cell transfection experiments were conducted using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol.

2.4. Determination of Intracellular Triglyceride (TG) Content

ICP2 cells (3 × 104 cells/well) with six replicates in each group (n = 6) were cultured in 12-well plates and maintained in differentiation medium. At 48 h post-transfection, after washing thrice with 1× phosphate-buffered saline (PBS) (Solarbio, Beijing, China). Intracellular TG levels of the differentiated ICP2 cells were measured using a Cellular Triglyceride Content Assay Kit (Applygen, Beijing, China). Intracellular protein content was determined using the BCA protein detection kit (Epizyme, Shanghai, China) to standardized intracellular TG content.

2.5. Oil Red O Staining

ICP2 cells (3 × 105 cells/well) with three replicates in each group (n = 3) were cultured in 6-well plates and maintained in differentiation medium. At 48 h post-transfection, the differentiated ICP2 cells were washed thrice with 1 × PBS (Solarbio), fixed using 4% paraformaldehyde (Solarbio, Beijing, China), and subsequently stained with 40% Oil Red O solution (Sigma, Beijing, China). Images were then acquired by an inverted fluorescence microscope (Olympus, Tokyo, Japan). Quantification of intracellular lipid droplets was performed by eluting the stained Oil Red O stain with 100% isopropanol (Sigma, Beijing, China) and measuring the absorbance at 500 nm using a microplate reader (BioTek, Winooski, VT, USA).

2.6. CCK-8 Assay

ICP2 cells (1 × 103 cells/well) with twelve replicates in each group (n = 12) were cultured in 96-well plates and maintained in complete medium. Cell vitality was evaluated at 12, 24, 36 and 48 h post-transfection using a CCK-8 Cell Counting Kit (Dojindo, Kumamoto, Japan). Following the addition of 10 μL CCK-8 reagent (Dojindo, Kumamoto, Japan) in each well, the plates were incubated for 2 h under dark conditions, and then the absorbance was measured at 450 nm using a microplate reader (BioTek, Winooski, VT, USA).

2.7. 5-Ethynyl-2-deoxyuridine (EdU) Assay

ICP2 cells were seeded into 12-well plates at a density of 3 × 104 cells per well, with three technical replicates in each group (n = 3), and subsequently maintained in complete medium. At 24 h post-transfection, the cells were pulse-labeled with EdU reagent (Ribobio Guangzhou, China; 1:1000 dilution in complete medium) for 2 h under the standard culture conditions (37 °C, 5% CO2). EdU-positive cells exhibited red fluorescence, while cell nuclei were counterstained blue with Hoechst 33342 (Ribobio, Guangzhou, China). Fluorescence microscopy images were acquired using an inverted fluorescent microscope (Olympus, Tokyo, Japan).

2.8. Flow Cytometry Analysis

Cells (3 × 104 cells/well) with six replicates in each group (n = 6) were cultured in 12-well plates and maintained in complete medium. At 24 h post-transfection, cells were harvested, washed thrice with prechilled 1× PBS (Solarbio), and fixed in 75% ethanol. Cell cycle was analyzed by a BD AccuriC6 flow cytometer (BD Biosciences, San Diego, CA, USA) using a Cell Cycle Detection Kit (KeyGEN Biotech, Nanjing, China).

2.9. Dual-Luciferase Reporter Assay

To verify the binding of gga-let-7c-3p to the PPARD gene, DF1 cells with 6 replicates in each group (n = 6) were plated into 24-well plates. DF1 cells were co-transfected with 300 ng of PPARD-3′UTR-WT or PPARD-3′UTR-MuT and 50 nM gga-let-7c-3p mimics or mimics NC. At 48 h post-transfection, cells were washed thrice with 1× PBS (Solarbio) and lysed in passive lysis buffer (Promega, Madison, WI, USA). Firefly and Renilla luciferase activities were measured on a microplate reader (BioTek, Winooski, VT, USA) using the Dual-Luciferase® Reporter Assay System (Promega, Madison, WI, USA). Renilla luciferase activity was normalized to firefly luciferase activity.

2.10. Bioinformatics Analysis

The target genes of gga-let-7c-3p were predicted using miRDB [30]. The minimum free energy (MFE) of gga-let-7c-3p and the PPARD gene duplex was calculated using RNAhybrid [31]. The vertebrate PPARD motif matrix was downloaded from JASPAR software (2026) [32]. The 2000 bp promoter sequences upstream from the transcription start site of genes were used for PPARD motif screening by FIMO software (MEME Suite 4.11.4) [33].

2.11. Statistical Analysis

Data are presented as mean ± S.E.M. The statistical significance of differences between two groups was determined using Student’s t-test by SPSS software 23.0 (IBM, Chicago, IL, USA). The statistical significance of differences among three or more groups was determined using the one-way ANOVA combined with Duncan’s Multiple Range Test by SPSS software 23.0 (IBM, Chicago, IL, USA). * p < 0.05 means a significant difference and ** p < 0.01 means an extremely significant difference. All graphical representations were generated by GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA).

3. Results

3.1. gga-let-7c-3p Inhibits Chicken Abdominal Preadipocytes Proliferation

To investigate the functions of gga-let-7c-3p in chicken abdominal preadipocytes proliferation, gga-let-7c-3p was overexpressed and knocked down in ICP2 cells by transfection with gga-let-7c-3p mimics and gga-let-7c-3p inhibitor, respectively. Compared to the mimics NC group, gga-let-7c-3p expression displayed an about 95-fold increase in gga-let-7c-3p mimics-treated ICP2 cells (Figure 1A). As determined by qPCR, overexpression of gga-let-7c-3p significantly decreased the mRNA expression of cell proliferation-promotion marker genes, including CCND1 [34], PCNA [34], CCNB2 [35] and CDK2 [34] genes, but significantly increased that of CCNE1 [36] gene (Figure 1B). Flow cytometry analysis clarified that overexpression of gga-let-7c-3p led to a remarkable increase in the population of G0/G1 phase cells and a marked decrease in the population of S phase cells, indicating an inhibition of cell cycle progression from G0/G1 phase to S phase (Figure 1C,D). CCK-8 assay demonstrated that overexpression of gga-let-7c-3p significantly inhibited cell viability at 36 and 48 h post-transfection (Figure 1E). Notably, EdU assay revealed that overexpression of gga-let-7c-3p significantly reduced the EdU-positive cell proportion (Figure 1F,G).
Compared to the inhibitor NC group, gga-let-7c-3p expression displayed an approximately 46% decrease in gga-let-7c-3p inhibitor-treated ICP2 cells (Figure 1H). The qPCR analysis showed that knockdown of gga-let-7c-3p significantly upregulated the mRNA expression of cell proliferation-promotion marker genes including PCNA [34], CCNB2 [35] and CCNE1 [36] (Figure 1I). Flow cytometry analysis indicated that knockdown of gga-let-7c-3p led to an upward trend but not significant promotion of cell cycle progression from G0/G1 phase to S phase, leading to an inapparent decrease in the population of G0/G1 phase cells and an inapparent increase in the population of S phase cells (Figure 1J,K). CCK-8 assay demonstrated that knockdown of gga-let-7c-3p significantly enhanced cell viability at 36 h and 48 h after transfection (Figure 1L). EdU assay revealed that knockdown of gga-let-7c-3p significantly increased the EdU-positive cell proportion (Figure 1M,N). These results suggest that gga-let-7c-3p hinders chicken abdominal preadipocytes’ proliferation.

3.2. gga-let-7c-3p Inhibits Adipogenic Differentiation of Chicken Abdominal Preadipocytes

To investigate the functions of gga-let-7c-3p in adipogenic differentiation of chicken abdominal preadipocytes, ICP2 cells were transfected with gga-let-7c-3p mimics and gga-let-7c-3p inhibitor for gga-let-7c-3p overexpression and knockdown, respectively, and subsequently induced adipogenic differentiation for 48 h. Compared to the mimics NC group, overexpression of gga-let-7c-3p significantly downregulated the mRNA expression of the lipid metabolism-related PPARγ [37], LPL [37] and FABP4 [37] genes (Figure 2A). Furthermore, intracellular TG content and lipid droplet accumulation were markedly decreased upon gga-let-7c-3p overexpression (Figure 2B–D). Additionally, knockdown of gga-let-7c-3p led to a significantly upregulation of the mRNA expression of the lipid metabolism-related PPARγ [37], ACSL5 [38] and APOA4 [39] genes as well as a remarkable intracellular TG content and lipid droplet accumulation (Figure 2F–H). Taken together, these findings suggest that gga-let-7c-3p suppresses chicken abdominal preadipocytes’ adipogenic differentiation.

3.3. Screening of Candidate Target Genes for gga-let-7c-3p

To identify the potential targets of gga-let-7c-3p, we firstly employed miRDB software [30] to predict its target genes and found the 3′UTR of 1145 target genes may directly interact with the seed region of gga-let-7c-3p. The 25 predicted target genes were differentially expressed and showed significantly highly negative expression correlations (r < −0.6, p < 0.05) with gga-let-7c-3p based on the previously reported RNA-seq data of chicken abdominal preadipocytes at 0, 12, 48, 72, and 120 h post-adipogenic differentiation [11] (Figure 3A, Supplementary Table S2). Of these, PPARD mRNA expression showed an overall increased expression during the ICP2 cells’ adipogenic differentiation, opposite to gga-let-7c-3p that exhibited a gradually decreased expression (Figure 3B,C). Notably, there was a significantly highly negative correlation (r = −0.6695 and p = 0.0063) between PPARD and gga-let-7c-3p expression (Figure 3D). The mRNA expression of the PPARD gene was significantly downregulated in the gga-let-7c-3p overexpressed ICP2 cells and significantly upregulated in the gga-let-7c-3p knockdown ICP2 cells (Figure 3E,F). Accordingly, we selected the PPARD gene for gga-let-7c-3p target validation.

3.4. PPARD Gene Is a Direct Target of gga-let-7c-3p

The MFE of the gga-let-7c-3p–PPARD duplex was −19.7 kcal/mol, suggesting strong hybridization stability of gga-let-7c-3p and the 3′UTR of the PPARD gene (Figure 4A). To further validate the binding of gga-let-7c-3p to the PPARD gene, we successfully constructed the wild-type (PPARD-WT-3′UTR) and mutant (PPARD-MuT-3′UTR) plasmids with and without complementary binding site (the 173–146 nt region of the PPARD 3′UTR and the 2–8 nt seed region of gga-let-7c-3p), respectively (Figure 4B,C). A dual-luciferase reporter assay elucidated that gga-let-7c-3p significantly inhibited the relative luciferase activity of PPARD-3′UTR-WT (the wild-type plasmid), but had no significant effect on that of PPARD-3′UTR-MuT (the mutant plasmid) (Figure 4D). These findings demonstrate that the PPARD gene is a direct target of gga-let-7c-3p.

3.5. PPARD Inhibits Chicken Abdominal Preadipocytes Proliferation

To explore the regulatory effect of PPARD gene in chicken abdominal preadipocytes’ proliferation, the PPARD gene was overexpressed and knocked down in ICP2 cells by transfection with the pcDNA3.1-PPARD overexpression vector and si-PPARD for PPARD gene overexpression and knockdown, respectively. Compared to the pcDNA3.1 NC group, the PPARD gene expression level displayed an approximately 3-fold increase in ICP2 cells transfected with the pcDNA3.1-PPARD overexpression vector (Figure 5A). As determined by qPCR, overexpression of the PPARD gene significantly downregulated the mRNA expression of cell proliferation-promotion marker genes PCNA [34], CCNB2 [35], CDK2 [34] and CCND3 [40] (Figure 5B). Among these cell proliferation-promotion marker genes, the 2000 bp promoter sequences upstream transcriptional start site of CDK2 [34], CCND3 [40] and PCNA [34] genes possess the putative PPARD motif (Supplementary Table S3). Flow cytometry analysis further showed that overexpression of PPARD gene inhibited cell cycle progression from G0/G1 phase to S phase, resulting in a remarkable increase in the population of G0/G1 phase cells and a remarkable decrease in the population of S phase cells (Figure 5C,D). CCK-8 assay showed that overexpression of PPARD gene significantly reduced cell viability at 24 h, 36 h and 48 h post-transfection (Figure 5E). Additionally, the EdU assay revealed that overexpression of PPARD gene significantly suppressed the EdU-positive cell proportion (Figure 5F,G).
Additionally, qPCR analysis displayed that the mRNA expression level of the PPARD gene was significantly decreased by about 55% in si-PPARD transfected ICP2 cells compared to the si-NC group (Figure 5H). Knockdown of the PPARD gene significantly upregulated the expressions of the CCND1 [34] and PCNA [34] genes (Figure 5I). Accordingly, knockdown of the PPARD gene promoted cell cycle progression from G0/G1 phase to S phase, characterized by a substantial decrease in the G0/G1 phase and increase in the S phase ICP2 cells (Figure 5J,K). CCK-8 assay showed that knockdown of the PPARD gene significantly enhanced cell viability at 36 h and 48 h post-transfection (Figure 5L). Moreover, EdU assay revealed that knockdown of the PPARD gene significantly increased the EdU-positive cell proliferation proportion (Figure 5M,N). Consequently, these results suggest that the PPARD gene suppresses chicken abdominal preadipocytes’ proliferation.

3.6. PPARD Promotes Adipogenic Differentiation of Chicken Abdominal Preadipocytes

To explore the functions of the PPARD gene in adipogenic differentiation of chicken abdominal preadipocytes, ICP2 cells were transfected with the pcDNA3.1-PPARD overexpression vector and si-PPARD for PPARD gene overexpression and knockdown, respectively, and then induced to undergo adipogenic differentiation for 48 h. Compared to the pcDNA3.1 negative control, overexpression of the PPARD gene significantly upregulated the mRNA expression levels of the lipid metabolism-related PPARγ [37], LPL [37], ACSL5 [38], ELOVL1 [37], DGAT2 [41] and APOA4 [39] genes (Figure 6A). Among these adipogenic differentiation-related genes, the 2000 bp promoter sequences upstream transcriptional start site of ACSL5 [38], ELOVL1 [37], DGAT2 [41] and APOA4 [39] genes possess the putative PPARD motif (Supplementary Table S3). Additionally, intracellular TG content and lipid droplet accumulation were markedly increased upon PPARD overexpression (Figure 6B–D). Knockdown of the PPARD gene significantly downregulated the mRNA expression of the lipid metabolism-related PPARγ [37], LPL [37] and APOA4 [39] genes (Figure 6E). The intracellular TG content and lipid droplet accumulation were also significantly decreased upon PPARD gene knockdown (Figure 6F–H). Collectively, these findings suggest that the PPARD gene promotes the adipogenic differentiation of chicken abdominal preadipocytes.

4. Discussion

As an important regulator of post-transcriptional gene expression, miRNAs have increasingly been proved to play prominent roles in mammalian adipogenesis. However, their biological functions and regulatory mechanisms underlying AF deposition in chickens have been largely unexplored. The previous miRNA and mRNA expression profiles during the adipogenic differentiation of chicken abdominal preadipocytes have revealed a series of differentially expressed miRNAs/mRNAs and the miRNAs-mRNA regulatory network involving adipogenesis, suggesting the crucial roles of miRNA regulation in chicken AF deposition [11]. Based on these findings, we selected a differentially expressed miRNA, gga-let-7c-3p, and confirmed that gga-let-7c-3p could inhibit the proliferation and adipogenic differentiation of chicken abdominal preadipocytes and verified the regulatory mechanisms of gga-let-7c-3p suppressing the post-transcriptional expression of the PPARD gene by directly interacting with its 3′UTR, which encodes a transcription factor with an inhibition of chicken abdominal preadipocytes proliferation and a promotion of their adipogenic differentiation. Our findings not only enrich the molecular regulation of avian adipogenesis, but also provide the potential genetic biomarkers of gga-let-7c-3p/PPARD axis for the genetic improvement of excessive AF deposition in poultry.
The miRNA let-7c-3p belongs to the let-7 family whose members have highly similar and conserved core “seed sequences” [42,43]. Research has shown that the let-7 family could participate in cell proliferation, differentiation, immune response, and glucose metabolism in mammals [42,44,45]. The study on mouse liver revealed that let-7 miRNA targets RNF8 and through the let-7-RNF8-RXRα axis to inhibit the PPARα signaling pathway, thereby promoting the fatty liver occurrence [46]. In chicken, it was reported that let-7a-5p and let-7b repressed the expression of TGFBR1 and LIN28B genes by directly binding to their 3′UTR, which intrinsically controlled blastodermal cell differentiation and maintained pluripotency in early chick embryogenesis [47]. Depressed let-7 expression in chicken embryo primary type II pneumocytes could reduce the adhesion capacity Mycoplasma gallisepticum (MG) as well as MG-induced hyperinflammation and cell apoptosis of through a suppression of mitogen-activated protein kinase (MAPK) signaling pathway [48]. An initial element linking the let-7 family to chicken adipogenesis was that gga-let-7a-3p could inhibit chicken intramuscular preadipocytes’ proliferation and adipogenic differentiation [49]. Our results revealed that gga-let-7c-3p could lead to a conspicuous decrease in viability, proliferation and cell cycle progression of chicken abdominal preadipocytes, which was accompanied by a significant decrease in intracellular triglyceride synthesis and lipid droplet accumulation in differentiated chicken abdominal preadipocytes. This indicates that gga-let-7c-3p can inhibit the proliferation and adipogenic differentiation of chicken abdominal preadipocytes.
It is generally accepted that miRNAs play their regulatory roles by post-transcriptional silencing of their target genes whose 3′UTRs are complementary to the miRNA seed region. Here, the PPARD gene was elucidated as a direct target of gga-let-7c-3p, whose 2–8 nt seed region could recognize and directly bind to the 3′UTR of the PPARD gene, thereby inhibiting the PPARD mRNA expression. The PPARD gene encodes peroxisome proliferator activated receptor delta, which belongs to a member of PPARs, a class of nuclear receptors that act as transcription factors to initiate or suppress the transcription of downstream target genes involved in cell proliferation and lipid metabolism by specifically binding to the PPAR response elements (PPREs) in their genomic DNA sequence [50]. Noteworthily, studies have confirmed that the binding of PPARs to their ligands was the gateway for adipogenic genes’ activation and adipogenesis initiation [51]. In livestock, the PPARD gene could promote fat deposition in pig backfat [52]; the PPARD gene could upregulate the expression of genes involving fatty acid activation (ACSL1), lipid droplet formation (PLIN2), and fatty acid transport (FABP4), thereby promoting lipid secretion and fatty acid breakdown metabolism in goat mammary epithelial cells [53]; PPARD mRNA expression was significantly higher in the longest dorsal muscle Wagyu-sierd cattle with more intramuscular fat content than Angus cattle with lower intramuscular fat content [54]. However, the regulatory functions of the PPARD gene in chickens is still unclear. In this study, the PPARD mRNA expression showed an overall increased trend during the adipogenic differentiation of chicken abdominal preadipocytes, suggesting its potential regulatory role in chicken abdominal adipogenesis. Further gain- and loss-of function assays demonstrated that the PPARD gene could inhibit the cell vitality, proliferation and cell cycle progression of chicken abdominal preadipocytes, and could promote intracellular triglyceride content and lipid droplet accumulation, indicating that PPARD plays an important regulatory role in chicken abdominal adipogenesis. This is consistent with the previous results of another subtype of PPARs-PPARγ gene-mediated cell cycle arrest and suppressive proliferation, together with stimulative adipogenic differentiation of chicken abdominal preadipocytes [55,56]. This led us to hypothesize that PPARD might also bind to the promoter regions of cell proliferation and lipid metabolism-related genes to regulate their transcription activities, thus controlling the proliferation and adipogenic differentiation of chicken abdominal preadipocytes. To verify this, we predicted downstream target genes of PPARD, whose 2000 bp promoters contain putative PPARD binding sites and identified multiple proliferation-related genes (CCNE1 [36], CDK2 [34], CCND2 [57], CCND3 [40], PCNA [34]) and lipid synthesis-related genes (ACSL5 [38], ELOVL1 [37], ACACA [58], FADS6 [59], DGAT2 [41], APOA4 [39], ELOVL3 [60], LPL [37], ELOVL6 [60], FABP3 [61], FABP2 [61], ACAA1 [62], LPIN1 [14], ELOVL2 [60], FABP5 [61]). Of these, the PPARD gene could significantly decrease the mRNA expression of proliferation-related genes (CCNE1 [36], CDK2 [34], CCND3 [40], PCNA [34]) and significantly increase that of lipid synthesis-related genes (ACSL5 [38], ELOVL1 [37], DGAT2 [41], APOA4 [39]), indicating the dynamic expression change of these genes in response to PPARD overexpression or knockdown. CDK2 is a core cell cycle kinase that can phosphorylate many substrates to drive cell cycle progression [63]. CCNE1 is an important regulator of the cell cycle, driving the transition from G1 phase to S phase [64]. CCND3 is a regulatory protein belonging to the highly conserved cyclin D family, which is crucial for the transition from G1 phase to S phase [65]. ACSL5 belongs to long-chain fatty-acid-coenzyme A ligase family and activates long-chain fatty acids into acyl-CoAs, which were responsible for de novo lipid biosynthesis (such as triglycerides) and fatty acid degradation (β-oxidation) [38]. DGAT2 is an essential acyltransferase that catalyzes the terminal and only committed step in intracellular triacylglycerol synthesis and integral to cellular lipid droplet formation, and its overexpression could significantly promote triglyceride accumulation, and lipid droplet formation in bovine preadipocytes [41]. In mammals, ELOVL is the first rate-limiting enzyme in the synthesis of very long chain fatty acids, controlling the rate and direction of lipid synthesis [66,67,68]. It has been revealed that ELOVL1 could activate PI3K/AKT/mTOR signaling, promoting tumor growth in human hepatocellular carcinoma [69]. APOA4 is a plasma lipoprotein that participates in regulating many metabolic pathways such as lipid and glucose metabolism. In vivo studies have shown that APOA4 enhances hepatic triglyceride secretion in mouse [70]. Furthermore, APOA4 could promote hepatic fat deposition during chicken embryonic development [71]. These gene expression changes responding to PPARD dynamics suggested that PPARD serves as a regulator during chicken abdominal adipogenesis by regulate the transcription activities of proliferation- and lipid synthesis-related genes by recognizing and binding to PPREs in their promoters, and such effects could be inhibited by gga-let-7c-3p that suppressed its direct target PPARD gene expression, which needs to be further verified.
It is widely accepted that miRNA can regulate a broad range of biological and PPREs physiological processes by post-transcriptionally triggering target gene silencing, where miRNA often showed the opposite regulatory effects to its target gene. In addition, a single miRNA has the potential to simultaneously regulate more than one target gene, even up to hundreds of target genes [72]. For the regulatory effects of the gga-let-7c-3p/PPARD axis on chicken abdominal adipogenesis, both gga-let-7c-3p and the PPARD gene could inhibit chicken abdominal preadipocytes’ proliferation, which did not align with the miRNA-mRNA regulatory characteristics. This could be explained that, besides the PPARD gene silencing, gga-let-7c-3p also suppressed the post-transcriptional expression of some other target genes which were responsible for cell proliferation promotion, and then counteracted the PPARD gene silence-mediated accelerating effects on chicken abdominal preadipocytes proliferation, ultimately resulting in an overall inhibition of gga-let-7c-3p on chicken abdominal preadipocytes proliferation, which needs further investigation.

5. Conclusions

Collectively, gga-let-7c-3p could inhibit the proliferation and adipogenic differentiation of chicken abdominal preadipocytes, at least by inhibiting the mRNA expression of its direct target PPARD gene (Figure 7). To the best of our knowledge, this study is the first to elucidate the regulatory functions and molecular mechanism of gga-let-7c-3p/PPARD axis in chicken abdominal adipogenesis These findings not only deepen our understanding of the molecular mechanism underlying chicken AF deposition, but also provides potential molecular targets and theoretical basis for lean line broiler breeding.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biom16020311/s1, Table S1: The information of qRT-PCR primers used in this study. Table S2: It contains three sheets, namely SN-PTGs, PTGs, and DEGs. Table S3: Prediction of PPARD motifs in the promoter regions of genes related to cell proliferation and adipogenic differentiation.

Author Contributions

Conceptualization, X.L. and W.T.; methodology, H.L., Z.L., Y.T., X.L. and W.T.; software, S.L. and K.Z.; validation, X.C., S.L. and K.Z.; formal analysis, S.L. and Y.G.; investigation, X.C.; resources, X.L. and X.K.; data curation, X.C.; writing—original draft preparation, X.C.; writing—review and editing, X.L. and W.T.; visualization, K.Z.; supervision, Y.G., H.L., Y.T., X.K. and Z.L.; project administration, W.T.; funding acquisition, W.T. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the China Postdoctoral Science Foundation (GZC20240431, 2025M770269), Key Science and Technology Research Project of Henan Province (252102111031).

Institutional Review Board Statement

This study was approved by the Science Ethics Committee Henan Agricultural University (Zhengzhou, Henan, China), under approval number HNND2024051231 (Approval Date: 11 March 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding authors.

Acknowledgments

The Key Laboratory of Chicken Genetics and Breeding, Ministry of Agriculture (Northeast Agricultural University) provided the immortalized chicken preadipocytes 2 (ICP2) cells.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
RNA-seqHigh-throughput sequencing of RNA
qPCRQuantitative real-time PCR
miRNAsmicroRNAs
DEGsDifferentially expressed genes
ICP2Immortalized chicken preadipocytes 2
DMEM-F12Dulbecco’s modified Eagle’s medium F12
cDNAComplementary DNA
CCK8Cell Counting Kit-8
EdU5-Ethynyl-2-deoxyuridine
3’UTRs3’untranslated regions
TGTriglyceride
PPREsPPAR response elements
PPARDperoxisome proliferator activated receptor delta
AFabdominal fat
PPARγPeroxisome proliferator activated receptor gamma
LPLlipoprotein lipase
FABP4fatty acid binding protein 4
CCND1cyclin D1
PCNAproliferating cell nuclear antigen
CCNB2cyclin B2
CCNE1cyclin E1
CDK2cyclin dependent kinase 2
CCND3cyclin D3
ACSL5Acyl-CoA synthetase long-chain family member 5
ELOVL1ELOVL fatty acid elongase 1
DGAT2Diglyceride acyltransferase 2
APOA4Apolipoprotein A4
ACSBG2Acyl-CoA synthetase bubblegum family member 2
ACACAAcetyl-CoA carboxylase alpha

References

  1. Wu, G.Q.; Deng, X.M.; Li, J.Y.; Li, N.; Yang, N. A potential molecular marker for selection against abdominal fatness in chickens. Poult. Sci. 2006, 85, 1896–1899. [Google Scholar] [CrossRef] [PubMed]
  2. Emmerson, D.A. Commercial approaches to genetic selection for growth and feed conversion in domestic poultry. Poult. Sci. 1997, 76, 1121–1125. [Google Scholar] [CrossRef] [PubMed]
  3. Cahaner, A.; Nitsan, Z. Evaluation of simultaneous selection for live body weight and against abdominal fat in broilers. Poult. Sci. 1985, 64, 1257–1263. [Google Scholar] [CrossRef] [PubMed]
  4. Cui, X.; Gou, Z.; Jiang, Z.; Li, L.; Lin, X.; Fan, Q.; Wang, Y.; Jiang, S. Dietary fiber modulates abdominal fat deposition associated with cecal microbiota and metabolites in yellow chickens. Poult. Sci. 2022, 101, 101721. [Google Scholar] [CrossRef]
  5. Bartel, D.P. MicroRNAs: Target recognition and regulatory functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef]
  6. Siersbæk, R.; Nielsen, R.; Mandrup, S. Transcriptional networks and chromatin remodeling controlling adipogenesis. Trends Endocrinol. Metab. 2012, 23, 56–64. [Google Scholar] [CrossRef]
  7. Lefterova, M.I.; Lazar, M.A. New developments in adipogenesis. Trends Endocrinol. Metab. 2009, 20, 107–114. [Google Scholar] [CrossRef]
  8. Lee, J.E.; Schmidt, H.; Lai, B.; Ge, K. Transcriptional and Epigenomic Regulation of Adipogenesis. Mol. Cell Biol. 2019, 39, e00601-18. [Google Scholar] [CrossRef]
  9. Peng, Y.; Croce, C.M. The role of MicroRNAs in human cancer. Signal Transduct. Target. Ther. 2016, 1, 15004. [Google Scholar] [CrossRef]
  10. Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
  11. Tian, W.; Hao, X.; Nie, R.; Ling, Y.; Zhang, B.; Zhang, H.; Wu, C. Integrative analysis of miRNA and mRNA profiles reveals that gga-miR-106-5p inhibits adipogenesis by targeting the KLF15 gene in chickens. J. Anim. Sci. Biotechnol. 2022, 13, 81. [Google Scholar] [CrossRef] [PubMed]
  12. Zhai, B.; Li, H.; Li, S.; Gu, J.; Zhang, H.; Zhang, Y.; Li, H.; Tian, Y.; Li, G.; Wang, Y. Transcriptome analysis reveals FABP5 as a key player in the development of chicken abdominal fat, regulated by miR-122-5p targeting. BMC Genom. 2023, 24, 386. [Google Scholar] [CrossRef] [PubMed]
  13. Li, G.; Chen, Y.; Jin, W.; Zhai, B.; Li, Y.; Sun, G.; Li, H.; Kang, X.; Tian, Y. Effects of miR-125b-5p on Preadipocyte Proliferation and Differentiation in Chicken. Mol. Biol. Rep. 2021, 48, 491–502. [Google Scholar] [CrossRef] [PubMed]
  14. Chao, X.; Guo, L.; Wang, Q.; Huang, W.; Liu, M.; Luan, K.; Jiang, J.; Lin, S.; Nie, Q.; Luo, W.; et al. miR-429-3p/LPIN1 Axis Promotes Chicken Abdominal Fat Deposition via PPARγ Pathway. Front. Cell Dev. Biol. 2020, 8, 595637. [Google Scholar] [CrossRef]
  15. Zhang, X.; Song, H.; Qiao, S.; Liu, J.; Xing, T.; Yan, X.; Li, H.; Wang, N. MiR-17-5p and miR-20a promote chicken cell proliferation at least in part by upregulation of c-Myc via MAP3K2 targeting. Sci. Rep. 2017, 7, 15852. [Google Scholar] [CrossRef]
  16. Tian, W.; Liu, Y.; Zhang, W.; Nie, R.; Ling, Y.; Zhang, B.; Zhang, H.; Wu, C. CircDOCK7 facilitates the proliferation and adipogenic differentiation of chicken abdominal preadipocytes through the gga-miR-301b-3p/ACSL1 axis. J. Anim. Sci. Biotechnol. 2023, 14, 91. [Google Scholar] [CrossRef]
  17. Guo, L.; Chao, X.; Huang, W.; Li, Z.; Luan, K.; Ye, M.; Zhang, S.; Liu, M.; Li, H.; Luo, W.; et al. Whole Transcriptome Analysis Reveals a Potential Regulatory Mechanism of LncRNA-FNIP2/miR-24-3p/FNIP2 Axis in Chicken Adipogenesis. Front. Cell Dev. Biol. 2021, 9, 653798. [Google Scholar] [CrossRef]
  18. Wang, Z.; Zhao, Q.; Li, X.; Yin, Z.; Chen, S.; Wu, S.; Yang, N.; Hou, Z. MYOD1 inhibits avian adipocyte differentiation via miRNA-206/KLF4 axis. J. Anim. Sci. Biotechnol. 2021, 12, 55. [Google Scholar] [CrossRef]
  19. Yuan, P.; Li, H.; Zhang, H.; Fan, S.; Dai, Y.; Jia, J.; Shen, J.; Zhang, Y.; Li, H.; Sun, G.; et al. miR-200b-3p affects the proliferation and differentiation of chicken preadipocytes by modulating SESN1 expression through competition with CircADGRF5. Poult. Sci. 2025, 104, 105068. [Google Scholar] [CrossRef]
  20. Li, S.; Cheng, X.; Zhang, K.; Wang, Y.; Wei, H.; Zhi, Y.; Cheng, Z.; Guo, Y.; Li, H.; Tian, Y.; et al. Genome-wide analysis of TMEM38 family revealed functional roles of TMEM38B in fat deposition and its miRNA-mediated regulation in chicken. Poult. Sci. 2025, 104, 105694. [Google Scholar] [CrossRef]
  21. Meneely, P.M.; Herman, R.K. Lethals, steriles and deficiencies in a region of the X chromosome of Caenorhabditis elegans. Genetics 1979, 92, 99–115. [Google Scholar] [CrossRef]
  22. Reinhart, B.J.; Slack, F.J.; Basson, M.; Pasquinelli, A.E.; Bettinger, J.C.; Rougvie, A.E.; Horvitz, H.R.; Ruvkun, G. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 2000, 403, 901–906. [Google Scholar] [CrossRef]
  23. Lin, S.; Hou, L.; Wang, Y.; Lin, H.; Deng, J.; Li, S.; Long, H.; Zhao, G. Antagonism of let-7c reduces atherosclerosis and macrophage lipid accumulation by promoting PGC-1α/LXRα/ABCA1/G1 pathway. Gene 2024, 909, 148302. [Google Scholar] [CrossRef]
  24. Hsieh, M.H.; Lai, P.F.; Chen, P.C.; Liu, X.L.; Chen, W.L.; Kuo, W.S.; Wang, S.D.; Kao, H.F.; Lin, L.J.; Wu, L.S.; et al. Exosomal MicroRNA let-7 Modulates Lipid Metabolism and Inflammation in Foamy Macrophages of Chronic Obstructive Pulmonary Disease. Int. J. Mol. Sci. 2025, 26, 8800. [Google Scholar] [CrossRef] [PubMed]
  25. Jiang, R.; Li, H.; Yang, J.; Shen, X.; Song, C.; Yang, Z.; Wang, X.; Huang, Y.; Lan, X.; Lei, C.; et al. circRNA Profiling Reveals an Abundant circFUT10 that Promotes Adipocyte Proliferation and Inhibits Adipocyte Differentiation via Sponging let-7. Mol. Ther. Nucleic Acids 2020, 20, 491–501. [Google Scholar] [CrossRef] [PubMed]
  26. Qi, F.; Wang, X.; Zhao, S.; Wang, C.; Sun, R.; Wang, H.; Du, P.; Wang, J.; Wang, X.; Jiang, G. miR-let-7c-3p targeting on Egr-1 contributes to the committed differentiation of leukemia cells into monocyte/macrophages. Oncol. Lett. 2022, 24, 273. [Google Scholar] [CrossRef] [PubMed]
  27. Shao, J.; Jiang, G.; Li, Y.; Wang, M.; Tang, T.; Wang, J.; Jia, X.; Lai, S. Let-7a-5p Regulates Animal Lipid Accumulation by Targeting Srebf2 and Thbs1 Signaling. Int. J. Mol. Sci. 2024, 25, 894. [Google Scholar] [CrossRef]
  28. Ouyang, H.; He, X.; Li, G.; Xu, H.; Jia, X.; Nie, Q.; Zhang, X. Deep Sequencing Analysis of miRNA Expression in Breast Muscle of Fast-Growing and Slow-Growing Broilers. Int. J. Mol. Sci. 2015, 16, 16242–16262. [Google Scholar] [CrossRef]
  29. Wang, W.; Zhang, T.; Wu, C.; Wang, S.; Wang, Y.; Li, H.; Wang, N. Immortalization of chicken preadipocytes by retroviral transduction of chicken TERT and TR. PLoS ONE 2017, 12, e0177348. [Google Scholar] [CrossRef]
  30. Chen, Y.; Wang, X. miRDB: An online database for prediction of functional microRNA targets. Nucleic Acids Res. 2020, 48, D127–D131. [Google Scholar] [CrossRef]
  31. Krüger, J.; Rehmsmeier, M. RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Res. 2006, 34, W451–W454. [Google Scholar] [CrossRef] [PubMed]
  32. Bryne, J.C.; Valen, E.; Tang, M.H.; Marstrand, T.; Winther, O.; da Piedade, I.; Krogh, A.; Lenhard, B.; Sandelin, A. JASPAR, the open access database of transcription factor-binding profiles: New content and tools in the 2008 update. Nucleic Acids Res. 2008, 36, D102–D106. [Google Scholar] [CrossRef] [PubMed]
  33. Grant, C.E.; Bailey, T.L.; Noble, W.S. FIMO: Scanning for occurrences of a given motif. Bioinformatics 2011, 27, 1017–1018. [Google Scholar] [CrossRef] [PubMed]
  34. He, L.; Feng, X.; Hu, C.; Liu, S.; Sheng, H.; Cai, B.; Ma, Y. HOXA9 gene inhibits proliferation and differentiation and promotes apoptosis of bovine preadipocytes. BMC Genom. 2024, 25, 358. [Google Scholar] [CrossRef]
  35. Daldello, E.M.; Luong, X.G.; Yang, C.R.; Kuhn, J.; Conti, M. Cyclin B2 is required for progression through meiosis in mouse oocytes. Development 2019, 146, dev172734. [Google Scholar] [CrossRef]
  36. Pan, M.; Sun, Q.; Li, C.; Tai, R.; Shi, X.; Sun, C. Hoxa5 inhibits adipocyte proliferation through transcriptional regulation of Ccne1 and blocking JAK2/STAT3 signaling pathway in mice. Biochem. Cell Biol. 2022, 100, 325–337. [Google Scholar] [CrossRef]
  37. Abdalla, B.A.; Chen, J.; Nie, Q.; Zhang, X. Genomic Insights Into the Multiple Factors Controlling Abdominal Fat Deposition in a Chicken Model. Front. Genet. 2018, 9, 262. [Google Scholar] [CrossRef]
  38. Klaus, C.; Jeon, M.K.; Kaemmerer, E.; Gassler, N. Intestinal acyl-CoA synthetase 5: Activation of long chain fatty acids and behind. World J. Gastroenterol. 2013, 19, 7369–7373. [Google Scholar] [CrossRef]
  39. Karathanasis, S.K.; Oettgen, P.; Haddad, I.A.; Antonarakis, S.E. Structure, evolution, and polymorphisms of the human apolipoprotein A4 gene (APOA4). Proc. Natl. Acad. Sci. USA 1986, 83, 8457–8461. [Google Scholar] [CrossRef]
  40. Liu, W.; Sun, M.; Jiang, J.; Shen, X.; Sun, Q.; Liu, W.; Shen, H.; Gu, J. Cyclin D3 interacts with human activating transcription factor 5 and potentiates its transcription activity. Biochem. Biophys. Res. Commun. 2004, 321, 954–960. [Google Scholar] [CrossRef]
  41. Guo, P.P.; Jin, X.; Zhang, J.F.; Li, Q.; Yan, C.G.; Li, X.Z. Overexpression of DGAT2 Regulates the Differentiation of Bovine Preadipocytes. Animals 2023, 13, 1195. [Google Scholar] [CrossRef]
  42. Zhu, H.; Shyh-Chang, N.; Segrè, A.V.; Shinoda, G.; Shah, S.P.; Einhorn, W.S.; Takeuchi, A.; Engreitz, J.M.; Hagan, J.P.; Kharas, M.G.; et al. The Lin28/let-7 axis regulates glucose metabolism. Cell 2011, 147, 81–94. [Google Scholar] [CrossRef] [PubMed]
  43. Jiang, S. A Regulator of Metabolic Reprogramming: MicroRNA Let-7. Transl. Oncol. 2019, 12, 1005–1013. [Google Scholar] [CrossRef] [PubMed]
  44. Schulte, L.N.; Eulalio, A.; Mollenkopf, H.J.; Reinhardt, R.; Vogel, J. Analysis of the host microRNA response to Salmonella uncovers the control of major cytokines by the let-7 family. EMBO J. 2011, 30, 1977–1989. [Google Scholar] [CrossRef] [PubMed]
  45. Johnson, S.M.; Grosshans, H.; Shingara, J.; Byrom, M.; Jarvis, R.; Cheng, A.; Labourier, E.; Reinert, K.L.; Brown, D.; Slack, F.J. RAS is regulated by the let-7 microRNA family. Cell 2005, 120, 635–647. [Google Scholar] [CrossRef]
  46. Yagai, T.; Yan, T.; Luo, Y.; Takahashi, S.; Aibara, D.; Kim, D.; Brocker, C.N.; Levi, M.; Motohashi, H.; Gonzalez, F.J. Feedback repression of PPARα signaling by Let-7 microRNA. Cell Rep. 2021, 36, 109506. [Google Scholar] [CrossRef]
  47. Lee, S.I.; Jeon, M.H.; Kim, J.S.; Jeon, I.S.; Byun, S.J. The gga-let-7 family post-transcriptionally regulates TGFBR1 and LIN28B during the differentiation process in early chick development. Mol. Reprod. Dev. 2015, 82, 967–975. [Google Scholar] [CrossRef]
  48. Wang, Y.; Sun, H.; Zhao, W.; Wang, T.; Zou, M.; Han, Y.; Sun, Y.; Peng, X. Low let-7d microRNA levels in chick embryos enhance innate immunity against Mycoplasma gallisepticum by suppressing the mitogen-activated protein kinase pathway. Vet. Res. 2023, 54, 50. [Google Scholar] [CrossRef]
  49. Ren, P.; Chen, M.; Liu, Q.; Wu, J.; Li, R.; Lin, Z.; Li, J. Gga-let-7a-3p inhibits the proliferation and differentiation of chicken intramuscular preadipocytes. Br. Poult. Sci. 2024, 65, 34–43. [Google Scholar] [CrossRef]
  50. Michalik, L.; Desvergne, B.; Wahli, W. Peroxisome-proliferator-activated receptors and cancers: Complex stories. Nat. Rev. Cancer 2004, 4, 61–70. [Google Scholar] [CrossRef]
  51. Farmer, S.R. Transcriptional control of adipocyte formation. Cell Metab. 2006, 4, 263–273. [Google Scholar] [CrossRef]
  52. Zhang, Y.; Gao, T.; Hu, S.; Lin, B.; Yan, D.; Xu, Z.; Zhang, Z.; Mao, Y.; Mao, H.; Wang, L.; et al. The Functional SNPs in the 5′ Regulatory Region of the Porcine PPARD Gene Have Significant Association with Fat Deposition Traits. PLoS ONE 2015, 10, e0143734. [Google Scholar] [CrossRef] [PubMed][Green Version]
  53. Shi, H.B.; Zhang, C.H.; Zhao, W.; Luo, J.; Loor, J.J. Peroxisome proliferator-activated receptor delta facilitates lipid secretion and catabolism of fatty acids in dairy goat mammary epithelial cells. J. Dairy Sci. 2017, 100, 797–806. [Google Scholar] [CrossRef] [PubMed]
  54. Jaborek, J.R.; Fluharty, F.L.; Lee, K.; Zerby, H.N.; Relling, A.E. Lipid metabolism mRNA expression and cellularity of intramuscular adipocytes within the Longissimus muscle of Angus- and Wagyu-sired cattle fed for a similar days on feed or body weight endpoint. J. Anim. Sci. 2023, 101, skac371. [Google Scholar] [CrossRef] [PubMed]
  55. Wang, Y.; Mu, Y.; Li, H.; Ding, N.; Wang, Q.; Wang, Y.; Wang, S.; Wang, N. Peroxisome proliferator-activated receptor-gamma gene: A key regulator of adipocyte differentiation in chickens. Poult. Sci. 2008, 87, 226–232. [Google Scholar] [CrossRef]
  56. Mu, F.; Jing, Y.; Ning, B.; Huang, J.; Cui, T.; Guo, Y.; You, X.; Yan, X.; Li, H.; Wang, N. Peroxisome proliferator-activated receptor γ isoforms differentially regulate preadipocyte proliferation, apoptosis, and differentiation in chickens. Poult. Sci. 2020, 99, 6410–6421. [Google Scholar] [CrossRef]
  57. Mirzaa, G.; Parry, D.A.; Fry, A.E.; Giamanco, K.A.; Schwartzentruber, J.; Vanstone, M.; Logan, C.V.; Roberts, N.; Johnson, C.A.; Singh, S.; et al. De novo CCND2 mutations leading to stabilization of cyclin D2 cause megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome. Nat. Genet. 2014, 46, 510–515. [Google Scholar] [CrossRef]
  58. Shafieipour, N.; Jafari Khamirani, H.; Kamal, N.; Tabei, S.M.B.; Dianatpour, M.; Dastgheib, S.A. The third patient of ACACA-related acetyl-CoA carboxylase deficiency with seizure and literature review. Eur. J. Med. Genet. 2023, 66, 104707. [Google Scholar] [CrossRef]
  59. Cui, J.; Chen, H.; Tang, X.; Zhao, J.; Zhang, H.; Chen, Y.Q.; Chen, W. Δ6 fatty acid desaturases in polyunsaturated fatty acid biosynthesis: Insights into the evolution, function with substrate specificities and biotechnological use. Appl. Microbiol. Biotechnol. 2020, 104, 9947–9963. [Google Scholar] [CrossRef]
  60. Ferrero, E.; Vaz, F.M.; Cheillan, D.; Brusco, A.; Marelli, C. The ELOVL proteins: Very and ultra long-chain fatty acids at the crossroads between metabolic and neurodegenerative disorders. Mol. Genet. Metab. 2025, 144, 109050. [Google Scholar] [CrossRef]
  61. Warren, W.; Osborn, M.; Yates, A.; O’Sullivan, S. The emerging role of fatty acid-binding protein 3 (FABP3) in cancer. Drug Discov. Today 2025, 30, 104504. [Google Scholar] [CrossRef] [PubMed]
  62. Li, G.; Fu, S.; Chen, Y.; Jin, W.; Zhai, B.; Li, Y.; Sun, G.; Han, R.; Wang, Y.; Tian, Y.; et al. MicroRNA-15a Regulates the Differentiation of Intramuscular Preadipocytes by Targeting ACAA1, ACOX1 and SCP2 in Chickens. Int. J. Mol. Sci. 2019, 20, 4063. [Google Scholar] [CrossRef] [PubMed]
  63. Arora, M.; Moser, J.; Hoffman, T.E.; Watts, L.P.; Min, M.; Musteanu, M.; Rong, Y.; Ill, C.R.; Nangia, V.; Schneider, J.; et al. Rapid adaptation to CDK2 inhibition exposes intrinsic cell-cycle plasticity. Cell 2023, 186, 2628–2643.e2621. [Google Scholar] [CrossRef] [PubMed]
  64. Han, Z.; Zhang, Y.; Yang, Q.; Liu, B.; Wu, J.; Zhang, Y.; Yang, C.; Jiang, Y. miR-497 and miR-34a retard lung cancer growth by co-inhibiting cyclin E1 (CCNE1). Oncotarget 2015, 6, 13149–13163. [Google Scholar] [CrossRef]
  65. Furuta, M.; Kozaki, K.; Tanimoto, K.; Tanaka, S.; Arii, S.; Shimamura, T.; Niida, A.; Miyano, S.; Inazawa, J. The tumor-suppressive miR-497-195 cluster targets multiple cell-cycle regulators in hepatocellular carcinoma. PLoS ONE 2013, 8, e60155. [Google Scholar] [CrossRef]
  66. Jakobsson, A.; Westerberg, R.; Jacobsson, A. Fatty acid elongases in mammals: Their regulation and roles in metabolism. Prog. Lipid Res. 2006, 45, 237–249. [Google Scholar] [CrossRef]
  67. Guillou, H.; Zadravec, D.; Martin, P.G.; Jacobsson, A. The key roles of elongases and desaturases in mammalian fatty acid metabolism: Insights from transgenic mice. Prog. Lipid Res. 2010, 49, 186–199. [Google Scholar] [CrossRef]
  68. Sassa, T.; Kihara, A. Metabolism of very long-chain Fatty acids: Genes and pathophysiology. Biomol. Ther. 2014, 22, 83–92. [Google Scholar] [CrossRef]
  69. Qin, L.; Song, C.Z.; Yuan, F.Y.; Wang, X.F.; Yang, Y.; Ma, Y.F.; Chen, Z.L. ELOVL1 is upregulated and promotes tumor growth in hepatocellular carcinoma through regulating PI3K-AKT-mTOR signaling. Heliyon 2024, 10, e34961. [Google Scholar] [CrossRef]
  70. VerHague, M.A.; Cheng, D.; Weinberg, R.B.; Shelness, G.S. Apolipoprotein A-IV expression in mouse liver enhances triglyceride secretion and reduces hepatic lipid content by promoting very low density lipoprotein particle expansion. Arterioscler. Thromb. Vasc. Biol. 2013, 33, 2501–2508. [Google Scholar] [CrossRef]
  71. Shen, N.; Li, C.; Yang, S.; Ma, Y.; Wang, H.L. Liver proteomics analysis reveals the differentiation of lipid mechanism and antioxidant enzyme activity during chicken embryonic development. Int. J. Biol. Macromol. 2023, 253, 127417. [Google Scholar] [CrossRef]
  72. Friedman, R.C.; Farh, K.K.; Burge, C.B.; Bartel, D.P. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 2009, 19, 92–105. [Google Scholar] [CrossRef]
Biomolecules 16 00311 g001
Figure 1. Effects of gga-let-7c-3p on chicken abdominal preadipocytes’ proliferation. (A) Relative gga-let-7c-3p expression in ICP2 cells transfected with mimics NC and gga-let-7c-3p mimics. The gga-let-7c-3p expression was represented as fold change versus mimics NC group. (B) Relative mRNA expression of CCND1, PCNA, CCNB2, CCNE1, CDK2 and CCND3 genes in ICP2 cells upon gga-let-7c-3p overexpression. The gene expression was represented as fold change versus mimics NC group. (C) Flow cytometry assay for cell cycle of ICP2 cells upon gga-let-7c-3p overexpression. (D) Representative cell cycle diagram by flow cytometry analysis in ICP2 cells upon gga-let-7c-3p overexpression. (E) CCK-8 assay showing cell viability in ICP2 cells upon gga-let-7c-3p overexpression. (F,G) EdU assay showing EdU-positive cell proportion upon gga-let-7c-3p overexpression. The EdU positive cell proportion was calculated by the ratio of the number of EdU-stained cells to the number of Hoechst 33342-stained cells and was represented as fold change versus mimics NC group. Scale = 100 μm. (H) Relative gga-let-7c-3p expression in ICP2 cells after transfection transfected with inhibitor NC and gga-let-7c-3p inhibitor. The gga-let-7c-3p expression was represented as fold change versus inhibitor NC group. (I) Relative mRNA expression levels of CCND1, PCNA, CCNB2, CCNE1, CDK2 and CCND3 genes in ICP2 cells upon gga-let-7c-3p knockdown. The gene expression was represented as fold change versus inhibitor NC group. (J) Flow cytometry assay for cell cycle of ICP2 cells upon gga-let-7c-3p knockdown. (K) Representative cell cycle diagram by flow cytometry analysis in ICP2 cells upon gga-let-7c-3p knockdown. (L) CCK-8 assay showing cell viability in ICP2 cells upon gga-let-7c-3p knockdown. (M,N) EdU assay showing EdU-positive cell proportion upon gga-let-7c-3p knockdown. The EdU positive cell proportion was calculated by the ratio of the number of EdU-stained cells to the number of Hoechst 33342-stained cells and was represented as fold change versus inhibitor NC group. Scale = 100 μm. * p < 0.05, ** p < 0.01.
Figure 1. Effects of gga-let-7c-3p on chicken abdominal preadipocytes’ proliferation. (A) Relative gga-let-7c-3p expression in ICP2 cells transfected with mimics NC and gga-let-7c-3p mimics. The gga-let-7c-3p expression was represented as fold change versus mimics NC group. (B) Relative mRNA expression of CCND1, PCNA, CCNB2, CCNE1, CDK2 and CCND3 genes in ICP2 cells upon gga-let-7c-3p overexpression. The gene expression was represented as fold change versus mimics NC group. (C) Flow cytometry assay for cell cycle of ICP2 cells upon gga-let-7c-3p overexpression. (D) Representative cell cycle diagram by flow cytometry analysis in ICP2 cells upon gga-let-7c-3p overexpression. (E) CCK-8 assay showing cell viability in ICP2 cells upon gga-let-7c-3p overexpression. (F,G) EdU assay showing EdU-positive cell proportion upon gga-let-7c-3p overexpression. The EdU positive cell proportion was calculated by the ratio of the number of EdU-stained cells to the number of Hoechst 33342-stained cells and was represented as fold change versus mimics NC group. Scale = 100 μm. (H) Relative gga-let-7c-3p expression in ICP2 cells after transfection transfected with inhibitor NC and gga-let-7c-3p inhibitor. The gga-let-7c-3p expression was represented as fold change versus inhibitor NC group. (I) Relative mRNA expression levels of CCND1, PCNA, CCNB2, CCNE1, CDK2 and CCND3 genes in ICP2 cells upon gga-let-7c-3p knockdown. The gene expression was represented as fold change versus inhibitor NC group. (J) Flow cytometry assay for cell cycle of ICP2 cells upon gga-let-7c-3p knockdown. (K) Representative cell cycle diagram by flow cytometry analysis in ICP2 cells upon gga-let-7c-3p knockdown. (L) CCK-8 assay showing cell viability in ICP2 cells upon gga-let-7c-3p knockdown. (M,N) EdU assay showing EdU-positive cell proportion upon gga-let-7c-3p knockdown. The EdU positive cell proportion was calculated by the ratio of the number of EdU-stained cells to the number of Hoechst 33342-stained cells and was represented as fold change versus inhibitor NC group. Scale = 100 μm. * p < 0.05, ** p < 0.01.
Biomolecules 16 00311 g001
Biomolecules 16 00311 g002
Figure 2. Effects of gga-let-7c-3p on chicken abdominal preadipocytes’ adipogenic differentiation. (A) Relative mRNA expression levels of PPARγ, LPL, FABP4, ACSL5, ELOVL1, DGAT2 and APOA4 in differentiated ICP2 cells upon gga-let-7c-3p overexpression. The gene expression was represented as fold change versus mimics NC group. (B) Detection of intracellular TG content in differentiated ICP2 cells upon gga-let-7c-3p overexpression. The intracellular TG content was represented as fold change versus mimics NC group. (C) Detection of intracellular lipid droplet accumulation in differentiated ICP2 cells by Oil Red O staining upon gga-let-7c-3p overexpression. Scale = 50 μm. (D) Spectrophotometric analysis of intracellular lipid droplet content in differentiated ICP2 cells upon gga-let-7c-3p overexpression. The intracellular lipid droplet content was represented as fold change versus mimics NC group. (E) Relative mRNA expression levels of PPARγ, LPL, FABP4, ACSL5, ELOVL1, DGAT2 and APOA4 in differentiated ICP2 cells upon gga-let-7c-3p knockdown. The gene expression was represented as fold change versus inhibitor NC group. (F) Detection of intracellular TG content in differentiated ICP2 cells upon gga-let-7c-3p knockdown. The intracellular TG content was represented as fold change versus inhibitor NC group. (G) Detection of intracellular lipid droplet accumulation in differentiated ICP2 cells by Oil Red O staining upon gga-let-7c-3p knockdown. Scale = 50 μm. (H) Spectrophotometric analysis of intracellular lipid droplet content in differentiated ICP2 cells upon gga-let-7c-3p knockdown. The intracellular lipid droplet content was represented as fold change versus inhibitor NC group. * p < 0.05, ** p < 0.01.
Figure 2. Effects of gga-let-7c-3p on chicken abdominal preadipocytes’ adipogenic differentiation. (A) Relative mRNA expression levels of PPARγ, LPL, FABP4, ACSL5, ELOVL1, DGAT2 and APOA4 in differentiated ICP2 cells upon gga-let-7c-3p overexpression. The gene expression was represented as fold change versus mimics NC group. (B) Detection of intracellular TG content in differentiated ICP2 cells upon gga-let-7c-3p overexpression. The intracellular TG content was represented as fold change versus mimics NC group. (C) Detection of intracellular lipid droplet accumulation in differentiated ICP2 cells by Oil Red O staining upon gga-let-7c-3p overexpression. Scale = 50 μm. (D) Spectrophotometric analysis of intracellular lipid droplet content in differentiated ICP2 cells upon gga-let-7c-3p overexpression. The intracellular lipid droplet content was represented as fold change versus mimics NC group. (E) Relative mRNA expression levels of PPARγ, LPL, FABP4, ACSL5, ELOVL1, DGAT2 and APOA4 in differentiated ICP2 cells upon gga-let-7c-3p knockdown. The gene expression was represented as fold change versus inhibitor NC group. (F) Detection of intracellular TG content in differentiated ICP2 cells upon gga-let-7c-3p knockdown. The intracellular TG content was represented as fold change versus inhibitor NC group. (G) Detection of intracellular lipid droplet accumulation in differentiated ICP2 cells by Oil Red O staining upon gga-let-7c-3p knockdown. Scale = 50 μm. (H) Spectrophotometric analysis of intracellular lipid droplet content in differentiated ICP2 cells upon gga-let-7c-3p knockdown. The intracellular lipid droplet content was represented as fold change versus inhibitor NC group. * p < 0.05, ** p < 0.01.
Biomolecules 16 00311 g002
Biomolecules 16 00311 g003
Figure 3. Screening of candidate target genes for gga-let-7c-3p. (A) Venn analysis of predicted target genes of gga-let-7c-3p (PTGs), PTGs whose expression was significantly negatively correlated with gga-let-7c-3p (SN-PTGs) and differentially expressed genes during the ICP2 cells’ adipogenic differentiation (DEGs). (B) Relative to 0 h, the expression level of gga-let-7c-3p changes during the ICP2 cells’ adipogenic differentiation (0, 12, 48, 72, and 120 h). Different lowercase letters mean significant differences, while the same lowercase letters mean no significant differences. (C) Relative to 0 h, the mRNA expression level of PPARD gene during the ICP2 cells’ adipogenic differentiation (0, 12, 48, 72, and 120 h). (D) gga-let-7c-3p and PPARD expression correlation analysis. (E) Relative mRNA expression of PPARD gene in ICP2 cells transfected with the mimics NC and gga-let-7c-3p mimics. The PPARD gene expression was represented as fold change versus mimics NC group. (F) Relative mRNA expression of PPARD gene in ICP2 cells transfected with the inhibitor NC and gga-let-7c-3p inhibitor. The PPARD gene expression was represented as fold change versus inhibitor NC group. * p < 0.05.
Figure 3. Screening of candidate target genes for gga-let-7c-3p. (A) Venn analysis of predicted target genes of gga-let-7c-3p (PTGs), PTGs whose expression was significantly negatively correlated with gga-let-7c-3p (SN-PTGs) and differentially expressed genes during the ICP2 cells’ adipogenic differentiation (DEGs). (B) Relative to 0 h, the expression level of gga-let-7c-3p changes during the ICP2 cells’ adipogenic differentiation (0, 12, 48, 72, and 120 h). Different lowercase letters mean significant differences, while the same lowercase letters mean no significant differences. (C) Relative to 0 h, the mRNA expression level of PPARD gene during the ICP2 cells’ adipogenic differentiation (0, 12, 48, 72, and 120 h). (D) gga-let-7c-3p and PPARD expression correlation analysis. (E) Relative mRNA expression of PPARD gene in ICP2 cells transfected with the mimics NC and gga-let-7c-3p mimics. The PPARD gene expression was represented as fold change versus mimics NC group. (F) Relative mRNA expression of PPARD gene in ICP2 cells transfected with the inhibitor NC and gga-let-7c-3p inhibitor. The PPARD gene expression was represented as fold change versus inhibitor NC group. * p < 0.05.
Biomolecules 16 00311 g003
Biomolecules 16 00311 g004
Figure 4. Validation of the PPARD gene as a direct target of gga-let-7c-3p. (A) Secondary structure of gga-let-7c-3p and the 3′UTR of the PPARD gene duplex. Red means the target 3′UTR of the PPARD gene; green means gga-let-7c-3p. (B) Binding sites of gga-let-7c-3p and the 3′UTR of the PPARD gene. (C) Sanger sequencing of PPARD-WT-3′UTR plasmid and PPARD-MuT-3′UTR plasmid. (D) gga-let-7c-3p and PPARD 3′UTR target relationship validation by a dual-luciferase reporter assay. Different lowercase letters mean significant differences, while the same lowercase letters mean no significant differences.
Figure 4. Validation of the PPARD gene as a direct target of gga-let-7c-3p. (A) Secondary structure of gga-let-7c-3p and the 3′UTR of the PPARD gene duplex. Red means the target 3′UTR of the PPARD gene; green means gga-let-7c-3p. (B) Binding sites of gga-let-7c-3p and the 3′UTR of the PPARD gene. (C) Sanger sequencing of PPARD-WT-3′UTR plasmid and PPARD-MuT-3′UTR plasmid. (D) gga-let-7c-3p and PPARD 3′UTR target relationship validation by a dual-luciferase reporter assay. Different lowercase letters mean significant differences, while the same lowercase letters mean no significant differences.
Biomolecules 16 00311 g004
Biomolecules 16 00311 g005
Figure 5. Effects of PPARD gene on chicken abdominal preadipocytes’ proliferation. (A) Relative PPARD mRNA expression in ICP2 cells transfected with pcDNA3.1 and pcDNA3.1-PPARD. The PPARD mRNA expression was represented as fold change versus pcDNA3.1 group. (B) Relative mRNA expression levels of CCND1, PCNA, CCNB2, CCNE1, CDK2 and CCND3 genes in ICP2 cells upon PPARD overexpression. The gene expression was represented as fold change versus pcDNA3.1 group. (C) Cell cycle analysis of ICP2 cells upon PPARD overexpression using flow cytometry assay. (D) Representative cell cycle diagram by flow cytometry analysis in ICP2 cells upon PPARD overexpression. (E) CCK-8 assay showing cell viability in ICP2 cells upon PPARD overexpression. (F,G) EdU assay showing EdU-positive cell proportion upon PPARD overexpression. The EdU positive cell proportion was calculated by the ratio of the number of EdU-stained cells to the number of Hoechst 33342-stained cells and was represented as fold change versus pcDNA3.1 group. Scale = 100 μm. (H) Relative PPARD expression in ICP2 cells after transfection transfected with si-NC and si-PPARD. The PPARD expression was represented as fold change versus si-NC group. (I) Relative mRNA expression of CCND1, PCNA, CCNB2, CCNE1, CDK2 and CCND3 genes in ICP2 cells upon PPARD knockdown. The gene expression was represented as fold change versus si-NC group. (J) Flow cytometry assay for cell cycle of ICP2 cells upon PPARD knockdown. (K) Representative cell cycle diagram by flow cytometry analysis in ICP2 cells upon PPARD knockdown. (L) CCK-8 assay showing cell viability in ICP2 cells upon PPARD knockdown. (M,N) EdU assay showing EdU-positive cell proportion upon PPARD knockdown. The EdU positive cell proportion was calculated by the ratio of the number of EdU-stained cells to the number of Hoechst 33342-stained cells and was represented as fold change versus si-NC group. Scale = 100 μm. * p < 0.05, ** p < 0.01.
Figure 5. Effects of PPARD gene on chicken abdominal preadipocytes’ proliferation. (A) Relative PPARD mRNA expression in ICP2 cells transfected with pcDNA3.1 and pcDNA3.1-PPARD. The PPARD mRNA expression was represented as fold change versus pcDNA3.1 group. (B) Relative mRNA expression levels of CCND1, PCNA, CCNB2, CCNE1, CDK2 and CCND3 genes in ICP2 cells upon PPARD overexpression. The gene expression was represented as fold change versus pcDNA3.1 group. (C) Cell cycle analysis of ICP2 cells upon PPARD overexpression using flow cytometry assay. (D) Representative cell cycle diagram by flow cytometry analysis in ICP2 cells upon PPARD overexpression. (E) CCK-8 assay showing cell viability in ICP2 cells upon PPARD overexpression. (F,G) EdU assay showing EdU-positive cell proportion upon PPARD overexpression. The EdU positive cell proportion was calculated by the ratio of the number of EdU-stained cells to the number of Hoechst 33342-stained cells and was represented as fold change versus pcDNA3.1 group. Scale = 100 μm. (H) Relative PPARD expression in ICP2 cells after transfection transfected with si-NC and si-PPARD. The PPARD expression was represented as fold change versus si-NC group. (I) Relative mRNA expression of CCND1, PCNA, CCNB2, CCNE1, CDK2 and CCND3 genes in ICP2 cells upon PPARD knockdown. The gene expression was represented as fold change versus si-NC group. (J) Flow cytometry assay for cell cycle of ICP2 cells upon PPARD knockdown. (K) Representative cell cycle diagram by flow cytometry analysis in ICP2 cells upon PPARD knockdown. (L) CCK-8 assay showing cell viability in ICP2 cells upon PPARD knockdown. (M,N) EdU assay showing EdU-positive cell proportion upon PPARD knockdown. The EdU positive cell proportion was calculated by the ratio of the number of EdU-stained cells to the number of Hoechst 33342-stained cells and was represented as fold change versus si-NC group. Scale = 100 μm. * p < 0.05, ** p < 0.01.
Biomolecules 16 00311 g005
Biomolecules 16 00311 g006
Figure 6. Effect of PPARD gene on chicken abdominal preadipocytes adipogenic differentiation. (A) Relative mRNA expression levels of PPARγ, LPL, FABP4, ACSL5, ELOVL1, DGAT2 and APOA4 in differentiated ICP2 cells upon PPARD overexpression. The gene expression was represented as fold change versus pcDNA3.1 group. (B) Detection of intracellular TG content in differentiated ICP2 cells upon PPARD overexpression. The intracellular TG content was represented as fold change versus pcDNA3.1 group. (C) Measure of intracellular lipid droplet accumulation in differentiated ICP2 cells by Oil Red O staining upon PPARD overexpression. Scale = 50 μm. (D) Spectrophotometric analysis of intracellular lipid droplet content in differentiated ICP2 cells upon gga-let-7c-3p overexpression. The intracellular lipid droplet content was represented as fold change versus pcDNA3.1 group. (E) The relative mRNA expression levels of PPARγ, LPL, FABP4, ACSL5, ELOVL1, DGAT2 and APOA4 in differentiated ICP2 cells upon PPARD knockdown. The gene expression was represented as fold change versus si-NC group. (F) Detection of intracellular TG content in differentiated ICP2 cells upon PPARD knockdown. The intracellular TG content was represented as fold change versus si-NC group. (G) Detection of intracellular lipid droplet accumulation in differentiated ICP2 cells by Oil Red O staining upon PPARD knockdown. Scale = 50 μm. (H) Spectrophotometric analysis of intracellular lipid droplet content in differentiated ICP2 cells upon PPARD knockdown. The intracellular lipid droplet content was represented as fold change versus si-NC group. * p < 0.05, ** p < 0.01.
Figure 6. Effect of PPARD gene on chicken abdominal preadipocytes adipogenic differentiation. (A) Relative mRNA expression levels of PPARγ, LPL, FABP4, ACSL5, ELOVL1, DGAT2 and APOA4 in differentiated ICP2 cells upon PPARD overexpression. The gene expression was represented as fold change versus pcDNA3.1 group. (B) Detection of intracellular TG content in differentiated ICP2 cells upon PPARD overexpression. The intracellular TG content was represented as fold change versus pcDNA3.1 group. (C) Measure of intracellular lipid droplet accumulation in differentiated ICP2 cells by Oil Red O staining upon PPARD overexpression. Scale = 50 μm. (D) Spectrophotometric analysis of intracellular lipid droplet content in differentiated ICP2 cells upon gga-let-7c-3p overexpression. The intracellular lipid droplet content was represented as fold change versus pcDNA3.1 group. (E) The relative mRNA expression levels of PPARγ, LPL, FABP4, ACSL5, ELOVL1, DGAT2 and APOA4 in differentiated ICP2 cells upon PPARD knockdown. The gene expression was represented as fold change versus si-NC group. (F) Detection of intracellular TG content in differentiated ICP2 cells upon PPARD knockdown. The intracellular TG content was represented as fold change versus si-NC group. (G) Detection of intracellular lipid droplet accumulation in differentiated ICP2 cells by Oil Red O staining upon PPARD knockdown. Scale = 50 μm. (H) Spectrophotometric analysis of intracellular lipid droplet content in differentiated ICP2 cells upon PPARD knockdown. The intracellular lipid droplet content was represented as fold change versus si-NC group. * p < 0.05, ** p < 0.01.
Biomolecules 16 00311 g006
Biomolecules 16 00311 g007
Figure 7. Schematic illustration of gga-let-7c-3p regulating chicken abdominal adipogenesis.
Figure 7. Schematic illustration of gga-let-7c-3p regulating chicken abdominal adipogenesis.
Biomolecules 16 00311 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cheng, X.; Li, S.; Zhang, K.; Guo, Y.; Li, H.; Li, Z.; Tian, Y.; Kang, X.; Liu, X.; Tian, W. gga-let-7c-3p Inhibits Chicken Abdominal Adipogenesis by Regulating PPARD Gene. Biomolecules 2026, 16, 311. https://doi.org/10.3390/biom16020311

AMA Style

Cheng X, Li S, Zhang K, Guo Y, Li H, Li Z, Tian Y, Kang X, Liu X, Tian W. gga-let-7c-3p Inhibits Chicken Abdominal Adipogenesis by Regulating PPARD Gene. Biomolecules. 2026; 16(2):311. https://doi.org/10.3390/biom16020311

Chicago/Turabian Style

Cheng, Xi, Shuohan Li, Ke Zhang, Yulong Guo, Hong Li, Zhuanjian Li, Yadong Tian, Xiangtao Kang, Xiaojun Liu, and Weihua Tian. 2026. "gga-let-7c-3p Inhibits Chicken Abdominal Adipogenesis by Regulating PPARD Gene" Biomolecules 16, no. 2: 311. https://doi.org/10.3390/biom16020311

APA Style

Cheng, X., Li, S., Zhang, K., Guo, Y., Li, H., Li, Z., Tian, Y., Kang, X., Liu, X., & Tian, W. (2026). gga-let-7c-3p Inhibits Chicken Abdominal Adipogenesis by Regulating PPARD Gene. Biomolecules, 16(2), 311. https://doi.org/10.3390/biom16020311

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop