Biomarker Signatures in Time-Course Progression of Neuropathic Pain at Spinal Cord Level Based on Bioinformatics and Machine Learning Analysis
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Groups
2.2. SNI Model
2.3. Behavioral Tests
2.4. Tisue Collection and RNA Extraction
2.5. cDNA Library Preparation and RNA Sequencing
2.6. Protein–Protein Interaction (PPI) Network Construction
2.7. Functional Enrichment Analysis
2.8. Machine Learning Algorithms
2.9. WGCNA
2.10. Quantitative Real-Time PCR (qRT-PCR)
2.11. Immune Infiltration Analysis
2.12. Receiver Operating Characteristic (ROC) Analysis
2.13. Regulatory Network of TF, mRNAs and miRNAs and Identification of Potential Drugs
2.14. Statistical Analysis
3. Results
3.1. Overall Workflow and the Development of Nociception and Cold Hypersensitivity in the SNI Model
3.2. Identification of Common DEGs Across Three Time Points
3.3. PPI Analysis of 54 DEGs and Hub Genes
3.4. GO and KEGG Enrichment Analysis of 54 DEGs
3.5. Identification of Characteristic Genes via Machine Learning Algorithms
3.6. Selection of Modules with Time-Course Progression by WGCNA
3.7. Validation of Bioinformatics Results by qRT-PCR
3.8. Immune Characteristics of SNI Model
3.9. Assessment of the Clinical Diagnostic Value of Genes
3.10. TF–mRNA–miRNA Network Construction and NP-Targeted Drug Prediction
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| NP | Neuropathic pain |
| DEGs | Differentially expressed genes |
| GO | Gene ontology |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| WGCNA | Weighted gene co-expression network analysis |
| LASSO | Least absolute shrinkage and selection operation |
| RF | Random forest |
| SVM-RFE | Support vector machine recursive feature elimination |
| qRT-PCR | Quantitative real time-PCR |
| ROC | Receiver operating characteristic |
| AUC | Area under the curve |
| SNI | Spared nerve injury |
| PUMCH | Peking Union Medical College Hospital |
| PPI | Protein–protein interaction |
| MDG | Mean decrease Gini |
| TOM | Topological overlap matrix |
References
- Jensen, T.S.; Baron, R.; Haanpaa, M.; Kalso, E.; Loeser, J.D.; Rice, A.S.C.; Treede, R.-D. A new definition of neuropathic pain. Pain 2011, 152, 2204–2205. [Google Scholar] [CrossRef]
- Treede, R.-D.; Jensen, T.S.; Campbell, J.N.; Cruccu, G.; Dostrovsky, J.O.; Griffin, J.W.; Hansson, P.; Hughes, R.; Nurmikko, T.; Serra, J. Neuropathic pain: Redefinition and a grading system for clinical and research purposes. Neurology 2008, 70, 1630–1635. [Google Scholar] [CrossRef] [PubMed]
- Campbell, J.N.; Meyer, R.A. Mechanisms of neuropathic pain. Neuron 2006, 52, 77–92. [Google Scholar] [CrossRef]
- van Hecke, O.; Austin, S.K.; Khan, R.A.; Smith, B.H.; Torrance, N. Neuropathic pain in the general population: A systematic review of epidemiological studies. Pain 2014, 155, 654–662. [Google Scholar] [CrossRef]
- Veluchamy, A.; Hebert, H.L.; Meng, W.; Palmer, C.N.A.; Smith, B.H. Systematic review and meta-analysis of genetic risk factors for neuropathic pain. Pain 2018, 159, 825–848. [Google Scholar] [CrossRef] [PubMed]
- Cavalli, E.; Mammana, S.; Nicoletti, F.; Bramanti, P.; Mazzon, E. The neuropathic pain: An overview of the current treatment and future therapeutic approaches. Int. J. Immunopathol. Pharmacol. 2019, 33, 2058738419838383. [Google Scholar] [CrossRef]
- Finnerup, N.B.; Attal, N.; Haroutounian, S.; McNicol, E.; Baron, R.; Dworkin, R.H.; Gilron, I.; Haanpää, M.; Hansson, P.; Jensen, T.S.; et al. Pharmacotherapy for neuropathic pain in adults: A systematic review and meta-analysis. Lancet Neurol. 2015, 14, 162–173. [Google Scholar] [CrossRef] [PubMed]
- Bourquin, A.F.; Suveges, M.; Pertin, M.; Gilliard, N.; Sardy, S.; Davison, A.C.; Spahn, D.R.; Decosterd, I. Assessment and analysis of mechanical allodynia-like behavior induced by spared nerve injury (SNI) in the mouse. Pain 2006, 122, 14e1–14e14. [Google Scholar] [CrossRef]
- Shields, S.D.; Eckert III, W.A.; Basbaum, A.I. Spared nerve injury model of neuropathic pain in the mouse: A behavioral and anatomic analysis. J. Pain 2003, 4, 465–470. [Google Scholar] [CrossRef]
- Dai, W.; Wen, M.; Kalso, E.; Palada, V. Circadian disruption upon painful peripheral nerve injury in mice: Temporal effects on transcriptome in pain-regulating sensory tissues. Neurobiol. Dis. 2025, 211, 106934. [Google Scholar] [CrossRef]
- Decosterd, I.; Woolf, C.J. Spared nerve injury: An animal model of persistent peripheral neuropathic pain. Pain 2000, 87, 149–158. [Google Scholar] [CrossRef]
- Xu, J.; Brennan, T.J. Guarding pain and spontaneous activity of nociceptors after skin versus skin plus deep tissue incision. Anesthesiology 2010, 112, 153–164. [Google Scholar] [CrossRef]
- Flatters, S.J.; Bennett, G.J. Ethosuximide reverses paclitaxel- and vincristine-induced painful peripheral neuropathy. Pain 2004, 109, 150–161. [Google Scholar] [CrossRef] [PubMed]
- Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING database in 2023: Protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023, 51, D638–D646. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Hayward, R.; Moore, S.; Artun, D.; Madhavan, A.; Harte, E.; Torres-Pérez, J.; Nagy, I. Transcriptional reprogramming post-peripheral nerve injury: A systematic review. Neurobiol. Dis. 2024, 200, 106624. [Google Scholar] [CrossRef]
- Guo, J.B.; Chen, B.L.; Song, G.; Zheng, Y.L.; Zhu, Y.; Yang, Z.; Su, X.; Wang, Y.; Cao, Q.; Chen, P.-J.; et al. Comparative Transcriptome Profiling Reveals Changes of microRNAs Response to Exercise in Rats with Neuropathic Pain. Neural Plast. 2021, 2021, 5597139. [Google Scholar] [CrossRef]
- Yang, J.A.; He, J.M.; Lu, J.M.; Jie, L.J. Jun, Gal, Cd74, and C1qb as potential indicator for neuropathic pain. J. Cell. Biochem. 2018, 119, 4792–4798. [Google Scholar] [CrossRef]
- Sun, W.; Kou, D.; Yu, Z.; Yang, S.; Jiang, C.; Xiong, D.; Xiao, L.; Deng, Q.; Xie, H.; Hao, Y. A Transcriptomic Analysis of Neuropathic Pain in Rat Dorsal Root Ganglia Following Peripheral Nerve Injury. Neuromol. Med. 2020, 22, 250–263. [Google Scholar] [CrossRef] [PubMed]
- Nahin, R.L.; Ren, K.; De Leon, M.; Ruda, M. Primary sensory neurons exhibit altered gene expression in a rat model of neuropathic pain. Pain 1994, 58, 95–108. [Google Scholar] [CrossRef] [PubMed]
- Gu, Y.; Qiu, Z.; Cheng, N.; Chen, C.; Hei, Z.; Li, X. Identification of potential mechanism and hub genes for neuropathic pain by expression-based genome-wide association study. J. Cell. Biochem. 2019, 120, 4912–4923. [Google Scholar] [CrossRef]
- Wu, S.; Yang, S.; Li, R.; Ba, X.; Jiang, C.; Xiong, D.; Xiao, L.; Sun, W. HSV-1 infection-induced herpetic neuralgia involves a CCL5/CCR5-mediated inflammation mechanism. J. Med. Virol. 2023, 95, e28718. [Google Scholar] [CrossRef]
- Wang, K.; Wang, S.; Chen, Y.; Wu, D.; Hu, X.; Lu, Y.; Wang, L.; Bao, L.; Li, C.; Zhang, X. Publisher Correction: Single-cell transcriptomic analysis of somatosensory neurons uncovers temporal development of neuropathic pain. Cell Res. 2021, 31, 939–940. [Google Scholar] [CrossRef] [PubMed]
- Colvin, L.A.; Mark, M.A.; Duggan, A.W. The effect of a peripheral mononeuropathy on immunoreactive (ir)-galanin release in the spinal cord of the rat. Brain Res. 1997, 766, 259–261. [Google Scholar] [CrossRef]
- Holmes, F.E.; Bacon, A.; Pope, R.J.P.; Vanderplank, P.A.; Kerr, N.C.H.; Sukumaran, M.; Pachnis, V.; Wynick, D. Transgenic overexpression of galanin in the dorsal root ganglia modulates pain-related behavior. Proc. Natl. Acad. Sci. USA 2003, 100, 6180–6185. [Google Scholar] [CrossRef]
- Jiang, B.-C.; Ling, Y.-J.; Xu, M.-L.; Gu, J.; Wu, X.-B.; Sha, W.-L.; Tian, T.; Bai, X.-H.; Li, N.; Jiang, C.-Y.; et al. Follistatin drives neuropathic pain in mice through IGF1R signaling in nociceptive neurons. Sci. Transl. Med. 2024, 16, eadi1564. [Google Scholar] [CrossRef]
- Eibl, J.K.; Strasser, B.C.; Ross, G.M. Structural, biological, and pharmacological strategies for the inhibition of nerve growth factor. Neurochem. Int. 2012, 61, 1266–1275. [Google Scholar] [CrossRef]
- Tender, G.C.; Li, Y.-Y.; Cui, J.-G. The role of nerve growth factor in neuropathic pain inhibition produced by resiniferatoxin treatment in the dorsal root ganglia. Neurosurgery 2013, 73, 158–165; discussion 165–166. [Google Scholar] [CrossRef]
- O’LEary, V.B.; O’COnnell, M.; Antyborzec, I.; Ntziachristos, V.; Dolly, J.O.; Ovsepian, S.V. Alleviation of Trigeminal Nociception Using p75 Neurotrophin Receptor Targeted Lentiviral Interference Therapy. Neurotherapeutics 2018, 15, 489–499. [Google Scholar] [CrossRef]
- Zhou, X.; Tao, L.; Zhao, M.; Wu, S.; Obeng, E.; Wang, D.; Zhang, W. Wnt/beta-catenin signaling regulates brain-derived neurotrophic factor release from spinal microglia to mediate HIV(1) gp120-induced neuropathic pain. Mol. Pain 2020, 16, 1744806920922100. [Google Scholar] [CrossRef] [PubMed]
- Matsuura, Y.; Iwakura, N.; Ohtori, S.; Suzuki, T.; Kuniyoshi, K.; Murakami, K.; Hiwatari, R.; Hashimoto, K.; Okamoto, S.; Shibayama, M.; et al. The effect of Anti-NGF receptor (p75 Neurotrophin Receptor) antibodies on nociceptive behavior and activation of spinal microglia in the rat brachial plexus avulsion model. Spine 2013, 38, E332–E338. [Google Scholar] [CrossRef] [PubMed]
- Mukhatyar, V.; Pai, B.; Clements, I.; Srinivasan, A.; Huber, R.; Mehta, A.; Mukhopadaya, S.; Rudra, S.; Patel, G.; Karumbaiah, L.; et al. Molecular sequelae of topographically guided peripheral nerve repair. Ann. Biomed. Eng. 2014, 42, 1436–1455. [Google Scholar] [CrossRef]
- Jing, W.; Zhang, T.; Liu, J.; Huang, X.; Yu, Q.; Yu, H.; Zhang, Q.; Li, H.; Deng, M.; Zhu, L.-Q.; et al. A circuit of COCH neurons encodes social-stress-induced anxiety via MTF1 activation of Cacna1h. Cell Rep. 2021, 37, 110177. [Google Scholar] [CrossRef]
- Oh, K.S.; Walls, D.; Joo, S.Y.; Kim, J.A.; Yoo, J.E.; Koh, Y.I.; Kim, D.H.; Rim, J.H.; Choi, H.J.; Kim, H.-Y.; et al. COCH-related autosomal dominant nonsyndromic hearing loss: A phenotype-genotype study. Hum. Genet. 2022, 141, 889–901. [Google Scholar] [CrossRef]
- Burri, A.; Leupin, M.; Spector, T.; Marinova, Z. Differential DNA Methylation in Monozygotic Twins Discordant for Female Sexual Functioning. J. Sex. Med. 2017, 14, 1357–1364. [Google Scholar] [CrossRef]
- Campeanu, I.J.; Jiang, Y.; Liu, L.; Pilecki, M.; Najor, A.; Cobani, E.; Manning, M.; Zhang, X.M.; Yang, Z.-Q. Multi-omics integration of methyltransferase-like protein family reveals clinical outcomes and functional signatures in human cancer. Sci. Rep. 2021, 11, 14784. [Google Scholar] [CrossRef] [PubMed]
- Heydari, S.; Peymani, M.; Hashemi, M.; Ghaedi, K.; Entezari, M. Potential prognostic and predictive biomarkers: METTL5, METTL7A, and METTL7B expression in gastrointestinal cancers. Mol. Biol. Rep. 2025, 52, 151. [Google Scholar] [CrossRef] [PubMed]
- Yuan, T.; Qian, H.; Yu, X.; Meng, J.; Lai, C.-T.; Jiang, H.; Zhao, J.-N.; Bao, N.-R. Proteomic analysis reveals rotator cuff injury caused by oxidative stress. Ther. Adv. Chronic. Dis. 2021, 12, 2040622320987057. [Google Scholar] [CrossRef]
- Hai, B.; Song, Q.; Du, C.; Mao, T.; Jia, F.; Liu, Y.; Pan, X.; Zhu, B.; Liu, X. Comprehensive bioinformatics analyses reveal immune genes responsible for altered immune microenvironment in intervertebral disc degeneration. Mol. Genet. Genom. 2022, 297, 1229–1242. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.; Tao, H.; Zhu, P.; Chu, M.; Li, X.; Shi, Y.; Zhang, L.; Xu, Y.; Lv, S.; Huang, L.; et al. ADAM8 silencing suppresses the migration and invasion of fibroblast-like synoviocytes via FSCN1/MAPK cascade in osteoarthritis. Arthritis Res. Ther. 2024, 26, 20. [Google Scholar] [CrossRef] [PubMed]
- Garman, A.; Ash, A.M.; Kokkinos, E.K.; Nerland, D.; Winter, L.; Langreck, C.B.; Forgette, M.L.; Girgenti, M.J.; Banasr, M.; Duric, V. Novel hippocampal genes involved in enhanced susceptibility to chronic pain-induced behavioral emotionality. Eur. J. Pharmacol. 2024, 964, 176273. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.-J.; Liang, T.-S.; Wang, J.; Zhao, J.-Y.; Yang, D.-K.; Liu, Z.-S. Silencing lncRNA LOC101928963 Inhibits Proliferation and Promotes Apoptosis in Spinal Cord Glioma Cells by Binding to PMAIP1. Mol. Ther. Nucleic Acids. 2019, 18, 485–495. [Google Scholar] [CrossRef]
- Zhang, X.; Wang, H.; Sun, Y.; Qi, M.; Li, W.; Zhang, Z.; Zhang, X.-E.; Cui, Z. Enterovirus A71 Oncolysis of Malignant Gliomas. Mol. Ther. 2020, 28, 1533–1546. [Google Scholar] [CrossRef]
- Zhao, X.; Liu, X.; Su, L. Parthenolide induces apoptosis via TNFRSF10B and PMAIP1 pathways in human lung cancer cells. J. Exp. Clin. Cancer. Res. 2014, 33, 3. [Google Scholar] [CrossRef]
- A Dengler, M.; Weilbacher, A.; Gutekunst, M.; Staiger, A.M.; Vöhringer, M.C.; Horn, H.; Ott, G.; E Aulitzky, W.; van der Kuip, H. Discrepant NOXA (PMAIP1) transcript and NOXA protein levels: A potential Achilles’ heel in mantle cell lymphoma. Cell Death Dis. 2014, 5, e1013. [Google Scholar] [CrossRef] [PubMed]
- E Guikema, J.; Amiot, M.; Eldering, E. Exploiting the pro-apoptotic function of NOXA as a therapeutic modality in cancer. Expert Opin. Ther. Targets 2017, 21, 767–779. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Li, Y.; Xin, S.; Yang, L.; Jiang, M.; Xin, Y.; Wang, Y.; Cao, P.; Zhang, S.; Yang, Y.; et al. The emerging roles of IFIT3 in antiviral innate immunity and cellular biology. J. Med. Virol. 2023, 95, e28259. [Google Scholar] [CrossRef]
- Wu, R.; Yang, H.; Liu, C. IFIT3: A crucial mediator in innate immunity and tumor progression with therapeutic implications. Front. Immunol. 2025, 16, 1515718. [Google Scholar] [CrossRef]
- Ouyang, X.; Zeng, Y.; Jiang, X.; Xu, H.; Ning, Y.; Yi, M. Identification of Vital Hub Genes and Potential Molecular Pathways of Dermatomyositis by Bioinformatics Analysis. Biomed. Res. Int. 2021, 2021, 9991726. [Google Scholar] [CrossRef]
- Kazezian, Z.; Gawri, R.; Haglund, L.; Ouellet, J.; Mwale, F.; Tarrant, F.; O’gAora, P.; Pandit, A.; Alini, M.; Grad, S. Gene Expression Profiling Identifies Interferon Signalling Molecules and IGFBP3 in Human Degenerative Annulus Fibrosus. Sci. Rep. 2015, 5, 15662. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Zhu, Z.; Zuo, X.; Wang, X.; Ju, C.; Liang, Z.; Li, K.; Zhang, J.; Luo, L.; Ma, Y.; et al. Photobiomodulation reduces neuropathic pain after spinal cord injury by downregulating CXCL10 expression. CNS Neurosci. Ther. 2023, 29, 3995–4017. [Google Scholar] [CrossRef]
- Yang, C.; Hu, Z.; Drolkar, G.; Jia, K.; Zhu, C.; Wang, C.; Li, Q.; Wang, L.; Zhang, G.; Jokyab, T.; et al. Tibetan medicine Ruyi Zhenbao Pill ameliorates neuropathic pain by inhibiting the CXCL10-CXCR3 pathway in spinal cord of spinal nerve ligation model. J. Ethnopharmacol. 2024, 323, 117653. [Google Scholar] [CrossRef]
- Li, H.-L.; Huang, Y.; Zhou, Y.-L.; Teng, R.-H.; Zhou, S.-Z.; Lin, J.-P.; Yang, Y.; Zhu, S.-M.; Xu, H.; Yao, Y.-X. C-X-C Motif Chemokine 10 Contributes to the Development of Neuropathic Pain by Increasing the Permeability of the Blood-Spinal Cord Barrier. Front. Immunol. 2020, 11, 477. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Yin, D.; Fan, B.; Zhu, X.; Chen, Q.; Li, Y.; Zhu, S.; Lu, R.; Xu, Z. Chemokine CXCL10/CXCR3 signaling contributes to neuropathic pain in spinal cord and dorsal root ganglia after chronic constriction injury in rats. Neurosci. Lett. 2019, 694, 20–28. [Google Scholar] [CrossRef]
- Safronova, A.; Araujo, A.; Camanzo, E.T.; Moon, T.J.; Elliott, M.R.; Beiting, D.P.; Yarovinsky, F. Alarmin S100A11 initiates a chemokine response to the human pathogen Toxoplasma gondii. Nat. Immunol. 2019, 20, 64–72. [Google Scholar] [CrossRef]
- Dey, D.; Biswas, S.; Pal, S.; Nandi, S.; Khatun, N.; Jha, R.; Chandra Chakraborty, B.; Baidya, A.; Ghosh, R.; Banerjee, S.; et al. Monocyte-derived Galectin-9 and PD-L1 differentially impair adaptive and innate immune response in chronic HBV infection and their expression remain unaltered after antiviral therapy. Front. Immunol. 2024, 15, 1474853. [Google Scholar] [CrossRef] [PubMed]
- Brkic, Z.; Maria, N.I.; van Helden-Meeuwsen, C.G.; van de Merwe, J.P.; van Daele, P.L.; Dalm, V.A.; Wildenberg, M.E.; Beumer, W.; Drexhage, H.A.; Versnel, M.A. Prevalence of interferon type I signature in CD14 monocytes of patients with Sjogren’s syndrome and association with disease activity and BAFF gene expression. Ann. Rheum. Dis. 2013, 72, 728–735. [Google Scholar] [CrossRef] [PubMed]
- Yang, P.; Wu, Q.; Sun, L.; Fang, P.; Liu, L.; Ji, Y.; Park, J.; Qin, X.; Qin, X.; Yang, X.; et al. Adaptive Immune Response Signaling Is Suppressed in Ly6C(high) Monocyte but Upregulated in Monocyte Subsets of ApoE(-/-) Mice—Functional Implication in Atherosclerosis. Front. Immunol. 2021, 12, 809208. [Google Scholar] [CrossRef]
- Ainola, M.; Li, T.-F.; Mandelin, J.; Hukkanen, M.; Choi, S.J.; Salo, J.; Konttinen, Y.T. Involvement of a disintegrin and a metalloproteinase 8 (ADAM8) in osteoclastogenesis and pathological bone destruction. Ann. Rheum. Dis. 2009, 68, 427–434. [Google Scholar] [CrossRef]
- Ozga, A.J.; Chow, M.T.; Lopes, M.E.; Servis, R.L.; Di Pilato, M.; Dehio, P.; Lian, J.; Mempel, T.R.; Luster, A.D. CXCL10 chemokine regulates heterogeneity of the CD8+ T cell response and viral set point during chronic infection. Immunity 2022, 55, 82–97.e8. [Google Scholar] [CrossRef]
- Montagnoli, C.; Tiribuzi, R.; Crispoltoni, L.; Pistilli, A.; Stabile, A.M.; Manfreda, F.; Placella, G.; Rende, M.; Cerulli, G.G. β-NGF and β-NGF receptor upregulation in blood and synovial fluid in osteoarthritis. Biol. Chem. 2017, 398, 1045–1054. [Google Scholar] [CrossRef]
- Liuzzo, G.; Vallejo, A.N.; Kopecky, S.L.; Frye, R.L.; Holmes, D.R.; Goronzy, J.J.; Weyand, C.M. Molecular fingerprint of interferon-gamma signaling in unstable angina. Circulation 2001, 103, 1509–1514. [Google Scholar] [CrossRef]
- Mamet, J.; Klukinov, M.; Yaksh, T.L.; Malkmus, S.A.; Williams, S.; Harris, S.; Manning, D.C.; Taylor, B.K.; Donahue, R.R.; Porreca, F.; et al. Single intrathecal administration of the transcription factor decoy AYX1 prevents acute and chronic pain after incisional, inflammatory, or neuropathic injury. Pain 2014, 155, 322–333. [Google Scholar] [CrossRef] [PubMed]
- Chiechio, S.; Copani, A.; Zammataro, M.; Battaglia, G.; Iv, R.W.G.; Nicoletti, F. Transcriptional regulation of type-2 metabotropic glutamate receptors: An epigenetic path to novel treatments for chronic pain. Trends Pharmacol. Sci. 2010, 31, 153–160. [Google Scholar] [CrossRef]
- LI, Z.; Zhou, Y. NFKB1 Signalling Activation Contributes to TRPV1 Over-expression via Repressing MiR-375 and MiR-455: A Study on Neuropathic Low Back Pain. Folia Biol. 2022, 68, 105–111. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Yang, L.; Huang, L.; Li, Z. Screening of disease-related biomarkers related to neuropathic pain (NP) after spinal cord injury (SCI). Hum. Genom. 2021, 15, 5. [Google Scholar] [CrossRef]
- Guo, A.; Li, J.; Luo, L.; Chen, C.; Lu, Q.; Ke, J.; Feng, X. Valproic acid mitigates spinal nerve ligation-induced neuropathic pain in rats by modulating microglial function and inhibiting neuroinflammatory response. Int. Immunopharmacol. 2021, 92, 107332. [Google Scholar] [CrossRef] [PubMed]
- Sahebdel, F.; Zia, A.; Quinta, H.R.; Morse, L.R.; Olson, J.K.; Battaglino, R.A. Transcriptomic Profiling of Primary Microglia: Effects of miR-19a-3p and miR-19b-3p on Microglia Activation. Int. J. Mol. Sci. 2024, 25, 10601. [Google Scholar] [CrossRef]
- Korczeniewska, O.A.; Husain, S.; Hoque, M.; Soteropoulos, P.; Khan, J.; Eliav, E.; Benoliel, R. Time-Course Progression of Whole Transcriptome Expression Changes of Trigeminal Ganglia Compared to Dorsal Root Ganglia in Rats Exposed to Nerve Injury. J. Pain 2024, 25, 101–117. [Google Scholar] [CrossRef]
- Zeng, F.; Cao, J.; Hong, Z.; Lu, Y.; Qin, Z.; Tao, T. Epigenetic combined with transcriptomic analysis of the m6A methylome after spared nerve injury-induced neuropathic pain in mice. Neural Regen. Res. 2023, 18, 2545–2552. [Google Scholar] [CrossRef]
- Tian, S.; Zheng, H.; Wu, W.; Wu, L. Predicting Diagnostic Biomarkers Associated with Pyroptosis in Neuropathic Pain Based on Machine Learning and Experimental Validation. J. Inflamm. Res. 2024, 17, 1121–1145. [Google Scholar] [CrossRef]
- He, Y.; Wei, Y.; Wang, Y.; Ling, C.; Qi, X.; Geng, S.; Meng, Y.; Deng, H.; Zhang, Q.; Qin, X.; et al. Prediction and validation of anoikis-related genes in neuropathic pain using machine learning. PLoS ONE 2025, 20, e0314773. [Google Scholar] [CrossRef] [PubMed]













| mRNA | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| Siglech | GGAGAGACCAGCAACACACA | TCCAGTTGGCACCATCATCC |
| Mpeg1 | CTGGATGATAATAGCGTGTGC | CAAGACAGGTAGTTTCAGGGC |
| Ly86 | ATTCTGAACTACTCCTATCCCCTTT | GGCCGGCATAGTATATCTGTTCT |
| Crym | CTATGAGGGCCACAGCAACA | ATGACCGCCAGCAGGGAG |
| Cd180 | TAGGTCTCAATGAAATTCCTGGC | AATCTGGCACCTGGTTAAATCC |
| Procr | TTGACGAAGTTTCTGCCGCTAC | CCTGATGCCTCACATGATGGTT |
| Abi3 | CTACTGCGAGGATAACTACTTGC | CAGGTTACCCACTTGGTAGGC |
| Cxcl10 | ATCCACCGCTGAGAGACATCCC | AATGACGGCAGCACTTGGGTTC |
| Adam8 | GCAGGACCATTGCCTCTACC | TGGACCCAACTCGGAAAAAGC |
| Ifit3 | ACTCCATCGTTAATCGTCTC | ACAGTGAACAACAGTCCTC |
| Pld4 | TGGTGCCCAGATACGACA | AGGGATGGAAGCGGTTGA |
| Pmaip1 | CTCAGGAAGATCGGAGACAAAGT | GAGTTGAGCACACTCGTCCTT |
| S100a11 | AGCTGGACCTCAACTGT | GTAGGTGTGCTGGGCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, K.; Wang, R.; Zhu, H.; Wen, B.; Xu, L.; Huang, Y. Biomarker Signatures in Time-Course Progression of Neuropathic Pain at Spinal Cord Level Based on Bioinformatics and Machine Learning Analysis. Biomolecules 2025, 15, 1254. https://doi.org/10.3390/biom15091254
Li K, Wang R, Zhu H, Wen B, Xu L, Huang Y. Biomarker Signatures in Time-Course Progression of Neuropathic Pain at Spinal Cord Level Based on Bioinformatics and Machine Learning Analysis. Biomolecules. 2025; 15(9):1254. https://doi.org/10.3390/biom15091254
Chicago/Turabian StyleLi, Kexin, Ruoxi Wang, He Zhu, Bei Wen, Li Xu, and Yuguang Huang. 2025. "Biomarker Signatures in Time-Course Progression of Neuropathic Pain at Spinal Cord Level Based on Bioinformatics and Machine Learning Analysis" Biomolecules 15, no. 9: 1254. https://doi.org/10.3390/biom15091254
APA StyleLi, K., Wang, R., Zhu, H., Wen, B., Xu, L., & Huang, Y. (2025). Biomarker Signatures in Time-Course Progression of Neuropathic Pain at Spinal Cord Level Based on Bioinformatics and Machine Learning Analysis. Biomolecules, 15(9), 1254. https://doi.org/10.3390/biom15091254

