Improvement of Skin Condition Through RXR Alpha-Activating Materials
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Preparation
Material | Concentration |
---|---|
Andrographolide | 1 μg/mL |
Bidens pilosa extract | 10 μg/mL |
Retinol | 10 μM |
All-trans retinoic acid | 1 μM |
9-cis retinoic acid | 1 μM |
UVI3003 | 10 μM |
AGN193109 | 50 μM |
2.2. RAR-γ and RXR-α Activation Assays
2.3. Quantitative Real-Time PCR (RT-qPCR)
Target mRNA | Forward Primer | Reverse Primer |
---|---|---|
GAPDH | CATGTTCGTCATGGGGTGAACCA | AGTGATGGCATGGACTGTGGTCAT |
RXRA | TGCTTCGTGTAAGCAAGTACATAAG | CTCTTTATGGATCTGTCATCCTCTC |
RARA | CAGAGCAGCAGTTCTGAAGAGATA | GACACGTGTACACCATGTTCTTCT |
IL-6 | AGACAGCCACTCACCTCTTCAG | TTCTGCCAGTGCCTCTTTGCTG |
2.4. Enzyme-Linked Immunosorbent Assay (ELISA)
2.5. Reconstructed Three-Dimensional (3D) Human Skin
2.6. Immunocytochemistry for Fibrillin-1
2.7. Measurement of Cellular Viability and Reactive Oxygen Species (ROS)
2.8. Human Clinical Trial
2.9. Statistical Analysis
3. Results and Discussions
3.1. RXR Alpha Activation by Combined Treatment of Andrographolide and BPE
3.2. Collagen Synthesis Effects of Combined Treatment of Andrographolide and BPE in the Skin Cells
3.3. Efficacies of Combined Treatment of Andrographolide and BPE on Extracellular Matrix (ECM) Component Enhancement
3.4. Anti-Oxidant and Anti-Inflammatory Effects of Combined Treatment of Andrographolide and BPE
3.5. Necessity of RXR Activation for Efficacies of Andrographolide and BPE
3.6. Wrinkle Improvement with a Cream Containing Andrographolide and BPE
3.7. Improvement in Elasticity and Hydration by RXR Formula Without Skin Irritation
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
RAR | Retinoic acid receptor |
RXR | Retinoid X receptor |
UV | Ultraviolet |
ATRA | All-trans retinoic acid |
COL1A1 | Collagen type 1 |
COL3A1 | Collagen type 3 |
BPE | B. pilosa extract |
HaCaT | Human skin keratinocyte |
Hs68 | Human skin fibroblast |
DMEM | Dulbecco’s Modified Eagle Medium |
FBS | Fetal bovine serum |
RT-qPCR | Quantitative real-time PCR |
ELISA | Enzyme-linked immunosorbent assay |
DAPI | 4′,6-Diamidino-2-phenylindole |
ROS | Reactive oxygen species |
DCFDA | 2′,7′-Dichlorofluorescein diacetate |
RXR formula | Cream including andrographolide and BPE |
ECM | Extracellular Matrix |
References
- Farage, M.A.; Miller, K.W.; Elsner, P.; Maibach, H.I. Characteristics of the Aging Skin. Adv. Wound Care 2013, 2, 5–10. [Google Scholar] [CrossRef] [PubMed]
- El-Domyati, M.; Attia, S.; Saleh, F.; Brown, D.; Birk, D.E.; Gasparro, F.; Ahmad, H.; Uitto, J. Intrinsic Aging vs. Photoaging: A Comparative Histopathological, Immunohistochemical, and Ultrastructural Study of Skin. Exp. Dermatol. 2002, 11, 398–405. [Google Scholar] [CrossRef]
- Karim, P.L.; Aryani, N.I.A.; Nopriyati, N. Anatomy and Histologic of Intrinsic Aging Skin. Biosci. Med. J. Biomed. Transl. Res. 2021, 5, 1165–1177. [Google Scholar] [CrossRef]
- Kafi, R.; Kwak, H.S.R.; Schumacher, W.E.; Cho, S.; Hanft, V.N.; Hamilton, T.A.; King, A.L.; Neal, J.D.; Varani, J.; Fisher, G.J.; et al. Improvement of Naturally Aged Skin with Vitamin A (Retinol). Arch. Dermatol. 2007, 143, 606–612. [Google Scholar] [CrossRef]
- Quan, T. Human Skin Aging and the Anti-Aging Properties of Retinol. Biomolecules 2023, 13, 1614. [Google Scholar] [CrossRef] [PubMed]
- Shao, Y.; He, T.; Fisher, G.J.; Voorhees, J.J.; Quan, T. Molecular Basis of Retinol Anti-ageing Properties in Naturally Aged Human Skin In Vivo. Deep Blue (Univ. Mich.) 2017, 39, 56–65. [Google Scholar] [CrossRef] [PubMed]
- Kong, R.; Cui, Y.; Fisher, G.J.; Wang, X.; Chen, Y.; Schneider, L.M.; Majmudar, G. A Comparative Study of the Effects of Retinol and Retinoic Acid on Histological, Molecular, and Clinical Properties of Human Skin. J. Cosmet. Dermatol. 2015, 15, 49–57. [Google Scholar] [CrossRef] [PubMed]
- Stücker, M.; Hoffmann, M.; Altmeyer, P. Instrumental Evaluation of Retinoid-induced Skin Irritation. Ski. Res. Technol. 2002, 8, 133–140. [Google Scholar] [CrossRef]
- Rakuša, Ž.T.; Škufca, P.; Kristl, A.; Roškar, R. Retinoid Stability and Degradation Kinetics in Commercial Cosmetic Products. J. Cosmet. Dermatol. 2020, 20, 2350–2358. [Google Scholar] [CrossRef]
- Kang, S.; Lee, H.; Jun, S.-H.; Park, S.-G.; Kang, N.-G. Enhancement of Efficacy of Retinoids through Enhancing Retinoid-Induced RAR Activity and Inhibiting Hydroxylation of Retinoic Acid, and Its Clinical Efficacy on Photo-Aging. Pharmaceutics 2022, 14, 2412. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.; Kim, K.; Jun, S.-H.; Lee, S.; Kim, J.; Shin, J.-G.; Kim, Y.; Kim, M.; Park, S.-G.; Kang, N.-G. Anti-Irritant Strategy against Retinol Based on the Genetic Analysis of Korean Population: A Genetically Guided Top–Down Approach. Pharmaceutics 2021, 13, 2006. [Google Scholar] [CrossRef]
- Napoli, J.L. Interactions of Retinoid Binding Proteins and Enzymes in Retinoid Metabolism. Biochim. Biophys. Acta (BBA)-Mol. Cell Biol. Lipids 1999, 1440, 139–162. [Google Scholar] [CrossRef]
- Blomhoff, R.; Blomhoff, H.K. Overview of Retinoid Metabolism and Function. J. Neurobiol. 2006, 66, 606–630. [Google Scholar] [CrossRef] [PubMed]
- Szymański, Ł.; Skopek, R.; Palusińska, M.; Schenk, T.; Stengel, S.; Lewicki, S.; Kraj, L.; Kamiński, P.; Zelent, A. Retinoic Acid and Its Derivatives in Skin. Cells 2020, 9, 2660. [Google Scholar] [CrossRef] [PubMed]
- Mangelsdorf, D.J.; Borgmeyer, U.; Heyman, R.A.; Zhou, J.Y.; Ong, E.S.; Oro, A.E.; Kakizuka, A.; Evans, R.M. Characterization of Three RXR Genes That Mediate the Action of 9-Cis Retinoic Acid. Genes Dev. 1992, 6, 329–344. [Google Scholar] [CrossRef] [PubMed]
- Evans, R.M.; Mangelsdorf, D.J. Nuclear Receptors, RXR, and the Big Bang. Cell 2014, 157, 255–266. [Google Scholar] [CrossRef] [PubMed]
- Fisher, G.J.; Talwar, H.S.; Xiao, J.H.; Datta, S.C.; Reddy, A.P.; Gaub, M.P.; Rochette-Egly, C.; Chambon, P.; Voorhees, J.J. Immunological Identification and Functional Quantitation of Retinoic Acid and Retinoid X Receptor Proteins in Human Skin. J. Biol. Chem. 1994, 269, 20629–20635. [Google Scholar] [CrossRef]
- Fluhr, J.W.; Vienne, M.-P.; Lauze, C.; Dupuy, P.; Gehring, W.; Gloor, M. Tolerance Profile of Retinol, Retinaldehyde and Retinoic Acid under Maximized and Long-Term Clinical Conditions. Dermatology 1999, 199, 57–60. [Google Scholar] [CrossRef]
- Shim, J.H.; Shin, D.W.; Lee, T.R.; Kang, H.H.; Jin, S.H.; Noh, M. The Retinoic Acid-Induced up-Regulation of Insulin-like Growth Factor 1 and 2 Is Associated with Prolidase-Dependent Collagen Synthesis in UVA-Irradiated Human Dermal Equivalents. J. Dermatol. Sci. 2011, 66, 51–59. [Google Scholar] [CrossRef] [PubMed]
- Gillbro, J.M.; Al-Bader, T.; Westman, M.; Olsson, M.J.; Mavon, A. Transcriptional Changes in Organoculture of Full-thickness Human Skin Following Topical Application of All-trans Retinoic Acid. Int. J. Cosmet. Sci. 2014, 36, 253–261. [Google Scholar] [CrossRef][Green Version]
- Chen, S.; Ostrowski, J.; Whiting, G.; Roalsvig, T.; Hammer, L.; Currier, S.J.; Honeyman, J.; Kwasniewski, B.; Yu, K.-L.; Sterzycki, R.; et al. Retinoic Acid Receptor Gamma Mediates Topical Retinoid Efficacy and Irritation in Animal Models. J. Investig. Dermatol. 1995, 104, 779–783. [Google Scholar] [CrossRef] [PubMed][Green Version]
- MacGregor, J.L.; Maibach, H.I. The Specificity of Retinoid-Induced Irritation and Its Role in Clinical Efficacy. Exog. Dermatol. 2002, 1, 68–73. [Google Scholar] [CrossRef]
- Melo, N.; Belyaeva, O.V.; Berger, W.K.; Halasz, L.; Yu, J.; Pilli, N.; Yang, Z.; Klyuyeva, A.V.; Elmets, C.A.; Atigadda, V.; et al. Next-Generation Retinoid X Receptor Agonists Increase ATRA Signaling in Organotypic Epithelium Cultures and Have Distinct Effects on Receptor Dynamics. J. Biol. Chem. 2022, 299, 102746. [Google Scholar] [CrossRef] [PubMed]
- Gericke, J.; Ittensohn, J.; Mihály, J.; Álvarez, S.; Álvarez, R.; Töröcsik, D.; De Lera, Á.R.; Rühl, R. Regulation of Retinoid-Mediated Signaling Involved in Skin Homeostasis by RAR and RXR Agonists/Antagonists in Mouse Skin. PLoS ONE 2013, 8, e62643. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Messaddeq, N.; Teletin, M.; Pasquali, J.-L.; Metzger, D.; Chambon, P. Retinoid X Receptor Ablation in Adult Mouse Keratinocytes Generates an Atopic Dermatitis Triggered by Thymic Stromal Lymphopoietin. Proc. Natl. Acad. Sci. USA 2005, 102, 14795–14800. [Google Scholar] [CrossRef]
- Li, Y.; Xing, Q.; Wei, Y.; Zhao, L.; Zhang, P.; Han, X.; Wang, J. Activation of RXR by Bexarotene Inhibits Inflammatory Conditions in Human Rheumatoid Arthritis Fibroblast-like Synoviocytes. Int. J. Mol. Med. 2019, 44, 1963–1970. [Google Scholar] [CrossRef] [PubMed]
- Kalsotra, A.; Du, L.; Wang, Y.; Ladd, P.A.; Kikuta, Y.; Duvic, M.; Boyd, A.S.; Keeney, D.S.; Strobel, H.W. Inflammation Resolved by Retinoid X Receptor-mediated Inactivation of Leukotriene Signaling Pathways. FASEB J. 2007, 22, 538–547. [Google Scholar] [CrossRef]
- Leal, A.S.; Moerland, J.A.; Zhang, D.; Carapellucci, S.; Lockwood, B.; Krieger-Burke, T.; Aleiwi, B.; Ellsworth, E.; Liby, K.T. The RXR Agonist MSU42011 Is Effective for the Treatment of Preclinical HER2+ Breast Cancer and KRAS-Driven Lung Cancer. Cancers 2021, 13, 5004. [Google Scholar] [CrossRef]
- Zhao, W.; Li, S.; Chen, R.; Ni, J.; Huang, X.; Li, S.; Lu, X.; Cao, X. RXR Signaling Targeted Cancer Therapy. Innov. Life 2023, 1, 100014. [Google Scholar] [CrossRef]
- Lee, S.; Ye, S.; Kim, M.; Lee, H.; Jun, S.-H.; Kang, N.-G. Fine Wrinkle Improvement through Bioactive Materials That Modulate EDAR and BNC2 Gene Expression. Biomolecules 2024, 14, 279. [Google Scholar] [CrossRef]
- Bjørklund, G.; Shanaida, M.; Lysiuk, R.; Butnariu, M.; Peana, M.; Sarac, I.; Strus, O.; Smetanina, K.; Chirumbolo, S. Natural Compounds and Products from an Anti-Aging Perspective. Molecules 2022, 27, 7084. [Google Scholar] [CrossRef] [PubMed]
- Chaudhuri, R.K.; Bojanowski, K. Bakuchiol: A Retinol-like Functional Compound Revealed by Gene Expression Profiling and Clinically Proven to Have Anti-aging Effects. Int. J. Cosmet. Sci. 2014, 36, 221–230. [Google Scholar] [CrossRef] [PubMed]
- Jarukamjorn, K.; Nemoto, N. Pharmacological Aspects of Andrographis Paniculata on Health and Its Major Diterpenoid Constituent Andrographolide. J. Health Sci. 2008, 54, 370–381. [Google Scholar] [CrossRef]
- Eksi, G.; Kurbanoglu, S.; Erdem, S.A. Analysis of Diterpenes and Diterpenoids. In Recent Advances in Natural Products Analysis; Elsevier eBooks: Amsterdam, The Netherlands, 2020; pp. 313–345. [Google Scholar]
- Mussard, E.; Cesaro, A.; Lespessailles, E.; Legrain, B.; Berteina-Raboin, S.; Toumi, H. Andrographolide, a Natural Antioxidant: An Update. Antioxidants 2019, 8, 571. [Google Scholar] [CrossRef]
- Manikam, S.T.; Stanslas, J. Andrographolide Inhibits Growth of Acute Promyelocytic Leukaemia Cells by Inducing Retinoic Acid Receptor-Independent Cell Differentiation and Apoptosis. J. Pharm. Pharmacol. 2009, 61, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Quaglio, A.E.V.; Cruz, V.M.; Almeida-Junior, L.D.; Costa, C.A.R.A.; Di Stasi, L.C. Bidens Pilosa (Black Jack) Standardized Extract Ameliorates Acute TNBS-Induced Intestinal Inflammation in Rats. Planta Medica 2020, 86, 319–330. [Google Scholar] [CrossRef] [PubMed]
- Abajo, C.; Boffill, M.Á.; Del Campo, J.; Méndez, M.A.; González, Y.; Mitjans, M.; Vinardell, M.P. In Vitro Study of the Antioxidant and Immunomodulatory Activity of Aqueous Infusion of Bidens Pilosa. J. Ethnopharmacol. 2004, 93, 319–323. [Google Scholar] [CrossRef] [PubMed]
- Dieamant, G.; Del Carmen, V.; Pereda, M.; Nogueira, C.; Eberlin, S.; Facchini, G.; Checon, J.T.; Cesar, C.K.; Mussi, L.; Polezel, M.A.; et al. Antiageing Mechanisms of a Standardized Supercritical CO2 Preparation of Black Jack (Bidens pilosa L.) in Human Fibroblasts and Skin Fragments. Evid.-Based Complement. Altern. Med. 2015, 2015, 280529. [Google Scholar] [CrossRef] [PubMed]
- Bartolome, A.P.; Villaseñor, I.M.; Yang, W.-C. Bidens pilosa L. (Asteraceae): Botanical Properties, Traditional Uses, Phytochemistry, and Pharmacology. Evid.-Based Complement. Altern. Med. 2013, 2013, 340215. [Google Scholar] [CrossRef] [PubMed]
- Kitareewan, S.; Burka, L.T.; Tomer, K.B.; Parker, C.E.; Deterding, L.J.; Stevens, R.D.; Forman, B.M.; Mais, D.E.; Heyman, R.A.; McMorris, T.; et al. Phytol Metabolites Are Circulating Dietary Factors That Activate the Nuclear Receptor RXR. Mol. Biol. Cell 1996, 7, 1153–1166. [Google Scholar] [CrossRef] [PubMed]
- Yamauchi, M.; Woodley, D.T.; Mechanic, G.L. Aging and Cross-Linking of Skin Collagen. Biochem. Biophys. Res. Commun. 1988, 152, 898–903. [Google Scholar] [CrossRef] [PubMed]
- Quan, T.; Fisher, G.J. Role of Age-Associated Alterations of the Dermal Extracellular Matrix Microenvironment in Human Skin Aging: A Mini-Review. Gerontology 2015, 61, 427–434. [Google Scholar] [CrossRef] [PubMed]
- Greenlee, T.K.; Ross, R.; Hartman, J.L. The Fine Structure of Elastic Fibers. J. Cell Biol. 1966, 30, 59–71. [Google Scholar] [CrossRef] [PubMed]
- Rock, M.J.; Cain, S.A.; Freeman, L.J.; Morgan, A.; Mellody, K.; Marson, A.; Shuttleworth, C.A.; Weiss, A.S.; Kielty, C.M. Molecular Basis of Elastic Fiber Formation. J. Biol. Chem. 2004, 279, 23748–23758. [Google Scholar] [CrossRef] [PubMed]
- Richard, A.F.; Clark, M.D. Fibronectin Matrix Deposition and Fibronectin Receptor Expression in Healing and Normal Skin. J. Investig. Dermatol. 1990, 94, s128–s134. [Google Scholar] [CrossRef]
- Juin, S.K.; Pushpakumar, S.; Sen, U. GYY4137 Regulates Extracellular Matrix Turnover in the Diabetic Kidney by Modulating Retinoid X Receptor Signaling. Biomolecules 2021, 11, 1477. [Google Scholar] [CrossRef]
- Snezhkina, A.V.; Kudryavtseva, A.V.; Kardymon, O.L.; Savvateeva, M.V.; Melnikova, N.V.; Krasnov, G.S.; Dmitriev, A.A. ROS Generation and Antioxidant Defense Systems in Normal and Malignant Cells. Oxidative Med. Cell. Longev. 2019, 2019, 6175804. [Google Scholar] [CrossRef]
- Rinnerthaler, M.; Bischof, J.; Streubel, M.; Trost, A.; Richter, K. Oxidative Stress in Aging Human Skin. Biomolecules 2015, 5, 545–589. [Google Scholar] [CrossRef]
- Soto, T.B.; Tenconi, P.E.; Buzzi, E.D.; Dionisio, L.; Mateos, M.V.; Rotstein, N.P.; Spitzmaul, G.; Politi, L.E.; German, O.L. Activation of Retinoid X Receptors Protects Retinal Neurons and Pigment Epithelial Cells from BMAA-Induced Death. Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 2024, 1871, 119816. [Google Scholar] [CrossRef] [PubMed]
- Ryter, S.W.; Kim, H.P.; Hoetzel, A.; Park, J.W.; Nakahira, K.; Wang, X.; Choi, A.M.K. Mechanisms of Cell Death in Oxidative Stress. Antioxid. Redox Signal. 2006, 9, 49–89. [Google Scholar] [CrossRef]
- Pasparakis, M.; Haase, I.; Nestle, F.O. Mechanisms Regulating Skin Immunity and Inflammation. Nat. Rev. Immunol. 2014, 14, 289–301. [Google Scholar] [CrossRef] [PubMed]
- Berardesca, E.; Distante, F. The Modulation of Skin Irritation. Contact Dermat. 1994, 31, 281–287. [Google Scholar] [CrossRef] [PubMed]
- Gröne, A. Keratinocytes and Cytokines. Vet. Immunol. Immunopathol. 2002, 88, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Welss, T.; Basketter, D.A.; Schröder, K.R. In Vitro Skin Irritation: Facts and Future. State of the Art Review of Mechanisms and Models. Toxicol. Vitr. 2003, 18, 231–243. [Google Scholar] [CrossRef] [PubMed]
- Prens, E.P.; Benne, K.; Van Damme, J.; Bakkus, M.; Brakel, K.; Benner, R.; Van Joost, T. Interleukin-1 and Interleukin-6 in Psoriasis. J. Investig. Dermatol. 1990, 95, S121–S124. [Google Scholar] [CrossRef] [PubMed]
- Saggini, A.; Chimenti, S.; Chiricozzi, A. IL-6 as a Druggable Target in Psoriasis: Focus on Pustular Variants. J. Immunol. Res. 2014, 2014, 964069. [Google Scholar] [CrossRef] [PubMed]
- Salminen, A.; Kaarniranta, K.; Kauppinen, A. Photoaging: UV Radiation-Induced Inflammation and Immunosuppression Accelerate the Aging Process in the Skin. Inflamm. Res. 2022, 71, 817–831. [Google Scholar] [CrossRef]
- Messaraa, C.; Metois, A.; Walsh, M.; Hurley, S.; Doyle, L.; Mansfield, A.; O’Connor, C.; Mavon, A. Wrinkle and Roughness Measurement by the Antera 3D and Its Application for Evaluation of Cosmetic Products. Ski. Res. Technol. 2018, 24, 359–366. [Google Scholar] [CrossRef]
- Messaraa, C.; Doyle, L.; Mansfield, A.; O’Connor, C.; Mavon, A. Ageing Profiles of Caucasian and Chinese Cohorts—Focus on Hands Skin. Int. J. Cosmet. Sci. 2019, 41, 79–88. [Google Scholar] [CrossRef]
- Fang, R.; Zhang, H.; Liu, Y.; Sun, Q. Quantitative Evaluation of Rejuvenation Treatment of Nasolabial Fold Wrinkles by Regression Model and 3D Photography. J. Cosmet. Dermatol. 2020, 20, 338–345. [Google Scholar] [CrossRef] [PubMed]
- Woo, M.S.; Moon, K.J.; Jung, H.Y.; Park, S.R.; Moon, T.K.; Kim, N.S.; Lee, B.C. Comparison of Skin Elasticity Test Results from the Ballistometer® and Cutometer®. Ski. Res. Technol. 2014, 20, 422–428. [Google Scholar] [CrossRef] [PubMed]
- Rastinejad, F. Retinoid X Receptor and Its Partners in the Nuclear Receptor Family. Curr. Opin. Struct. Biol. 2001, 11, 33–38. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ye, S.; Lee, S.; Kang, S.; Jun, S.-H.; Kang, N.-G. Improvement of Skin Condition Through RXR Alpha-Activating Materials. Biomolecules 2025, 15, 296. https://doi.org/10.3390/biom15020296
Ye S, Lee S, Kang S, Jun S-H, Kang N-G. Improvement of Skin Condition Through RXR Alpha-Activating Materials. Biomolecules. 2025; 15(2):296. https://doi.org/10.3390/biom15020296
Chicago/Turabian StyleYe, Sanghyun, Seonju Lee, Seongsu Kang, Seung-Hyun Jun, and Nae-Gyu Kang. 2025. "Improvement of Skin Condition Through RXR Alpha-Activating Materials" Biomolecules 15, no. 2: 296. https://doi.org/10.3390/biom15020296
APA StyleYe, S., Lee, S., Kang, S., Jun, S.-H., & Kang, N.-G. (2025). Improvement of Skin Condition Through RXR Alpha-Activating Materials. Biomolecules, 15(2), 296. https://doi.org/10.3390/biom15020296