TIM8 Deficiency in Yeast Induces Endoplasmic Reticulum Stress and Shortens the Chronological Lifespan
Abstract
1. Introduction
2. Materials and Methods
2.1. Strain Construction
2.2. Spot Assay
2.3. Growth Curve Assay
2.4. Reactive Oxygen Species (ROS) Assay
2.5. RLS Assay
2.6. CLS Assay
2.7. Real-Time Polymerase Chain Reaction (RT-PCR)
2.8. Yeast HAC1 mRNA Splicing Pattern Assay
2.9. Mitochondrial Function Assay
2.10. Cell Culture
2.11. Small Interfering RNA (siRNA) Transfection
2.12. Western Blot Analysis
2.13. Measurement of the Intracellular Calcium Content
3. Results
3.1. TIM8 Deficiency Increases Yeast Resistance to the ER Stress Inducer TM
3.2. TIM8 Deficiency Leads to Both Oxidative Stress and ER Stress in Yeast Cells
3.3. TIM8 Deficiency Leads to a Shortened CLS
3.4. TIM8 Deficiency Impaired the Mitochondrial Respiration Capacity of Yeast
3.5. SOD2 Overexpression Enhances TM Resistance in the tim8Δ Strain
3.6. Knockdown of TIMM8A Induces ER Stress in ARPE-19 Cells
4. Discussion
4.1. TIM8 Deficiency Induces ER Stress Response
4.2. tim8Δ Cells Exhibit a Shortened CLS
4.3. Improving the Antioxidant Capacity Further Enhances TM Resistance in the tim8Δ Strain
4.4. Knockdown of TIMM8A Induces ER Stress
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hasson, S.A.; Damoiseaux, R.; Glavin, J.D.; Dabir, D.V.; Walker, S.S.; Koehler, C.M. Substrate specificity of the TIM22 mitochondrial import pathway revealed with small molecule inhibitor of protein translocation. Proc. Natl. Acad. Sci. USA 2010, 107, 9578–9583. [Google Scholar] [CrossRef] [PubMed]
- Hofmann, S.; Rothbauer, U.; Muhlenbein, N.; Neupert, W.; Gerbitz, K.D.; Brunner, M.; Bauer, M.F. The C66W mutation in the deafness dystonia peptide 1 (DDP1) affects the formation of functional DDP1.TIM13 complexes in the mitochondrial intermembrane space. J. Biol. Chem. 2002, 277, 23287–23293. [Google Scholar] [CrossRef] [PubMed]
- Paschen, S.A.; Rothbauer, U.; Kaldi, K.; Bauer, M.F.; Neupert, W.; Brunner, M. The role of the TIM8-13 complex in the import of Tim23 into mitochondria. EMBO J. 2000, 19, 6392–6400. [Google Scholar] [CrossRef] [PubMed]
- Koehler, C.M.; Leuenberger, D.; Merchant, S.; Renold, A.; Junne, T.; Schatz, G. Human deafness dystonia syndrome is a mitochondrial disease. Proc. Natl. Acad. Sci. USA 1999, 96, 2141–2146. [Google Scholar] [CrossRef]
- Smith, J.T., Jr.; Singha, U.K.; Misra, S.; Chaudhuri, M. Divergent Small Tim Homologues Are Associated with TbTim17 and Critical for the Biogenesis of TbTim17 Protein Complexes in Trypanosoma brucei. mSphere 2018, 3, e00204-18. [Google Scholar] [CrossRef]
- Kang, Y.; Anderson, A.J.; Jackson, T.D.; Palmer, C.S.; De Souza, D.P.; Fujihara, K.M.; Stait, T.; Frazier, A.E.; Clemons, N.J.; Tull, D.; et al. Function of hTim8a in complex IV assembly in neuronal cells provides insight into pathomechanism underlying Mohr-Tranebjaerg syndrome. Elife 2019, 8, e48828. [Google Scholar] [CrossRef]
- Hetz, C.; Papa, F.R. The Unfolded Protein Response and Cell Fate Control. Mol. Cell 2018, 69, 169–181. [Google Scholar] [CrossRef]
- Hetz, C.; Zhang, K.; Kaufman, R.J. Mechanisms, regulation and functions of the unfolded protein response. Nat. Rev. Mol. Cell Biol. 2020, 21, 421–438. [Google Scholar] [CrossRef]
- Lee, J.H.; Lee, J. Endoplasmic Reticulum (ER) Stress and Its Role in Pancreatic beta-Cell Dysfunction and Senescence in Type 2 Diabetes. Int. J. Mol. Sci. 2022, 23, 4843. [Google Scholar] [CrossRef]
- Brown, M.K.; Naidoo, N. The endoplasmic reticulum stress response in aging and age-related diseases. Front. Physiol. 2012, 3, 263. [Google Scholar] [CrossRef]
- Hemagirri, M.; Chen, Y.; Gopinath, S.C.B.; Sahreen, S.; Adnan, M.; Sasidharan, S. Crosstalk between protein misfolding and endoplasmic reticulum stress during ageing and their role in age-related disorders. Biochimie 2024, 221, 159–181. [Google Scholar] [CrossRef] [PubMed]
- Baudin, A.; Ozier-Kalogeropoulos, O.; Denouel, A.; Lacroute, F.; Cullin, C. A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res. 1993, 21, 3329–3330. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.; Zheng, H.Z.; Zhou, T.; Hong, X.S.; Cui, H.J.; Jiang, Z.W.; Chen, H.J.; Zhou, Z.J.; Liu, X.G. CTT1 overexpression increases the replicative lifespan of MMS-sensitive Saccharomyces cerevisiae deficient in KSP1. Mech. Ageing Dev. 2017, 164, 27. [Google Scholar] [CrossRef] [PubMed]
- Tesniere, C.; Pradal, M.; Legras, J.L. Sterol uptake analysis in Saccharomyces and non-Saccharomyces wine yeast species. FEMS Yeast Res. 2021, 21, foab020. [Google Scholar] [CrossRef]
- Cui, H.J.; Cui, X.G.; Jing, X.; Yuan, Y.; Chen, Y.Q.; Sun, Y.X.; Zhao, W.; Liu, X.G. GAS1 Deficient Enhances UPR Activity in Saccharomyces cerevisiae. Biomed. Res. Int. 2019, 2019, 1238581. [Google Scholar] [CrossRef]
- Olsen, B.; Murakami, C.J.; Kaeberlein, M. YODA: Software to facilitate high-throughput analysis of chronological life span, growth rate, and survival in budding yeast. BMC Bioinformatics 2010, 11. [Google Scholar] [CrossRef]
- Arroyo Lopez, F.N.; Quintana, M.C.; Fernandez, A.G. Modelling of the growth-no growth interface of Issatchenkia occidentalis, an olive spoiling yeast, as a function of the culture media, NaCl, citric and sorbic acid concentrations: Study of its inactivation in the no growth region. Int. J. Food Microbiol. 2007, 117, 150–159. [Google Scholar] [CrossRef]
- Olivares-Marin, I.K.; González-Hernández, J.C.; Regalado-Gonzalez, C.; Madrigal-Perez, L.A. Saccharomyces cerevisiae exponential growth kinetics in batch culture to analyze respiratory and fermentative metabolism. J. Vis. Exp. 2018, 139, 58192. [Google Scholar] [CrossRef]
- Wu, Y.; Wu, M.; Wang, Y.; Chen, Y.; Gao, J.; Ying, C. ERG11 couples oxidative stress adaptation, hyphal elongation and virulence in Candida albicans. FEMS Yeast Res. 2018, 18, foy057. [Google Scholar] [CrossRef]
- Lin, Y.; Kotakeyama, Y.; Li, J.; Pan, Y.; Matsuura, A.; Ohya, Y.; Yoshida, M.; Xiang, L.; Qi, J. Cucurbitacin B Exerts Antiaging Effects in Yeast by Regulating Autophagy and Oxidative Stress. Oxid. Med. Cell Longev. 2019, 2019, 4517091. [Google Scholar] [CrossRef]
- Garcia, E.J.; de Jonge, J.J.; Liao, P.C.; Stivison, E.; Sing, C.N.; Higuchi-Sanabria, R.; Boldogh, I.R.; Pon, L.A. Reciprocal interactions between mtDNA and lifespan control in budding yeast. Mol. Biol. Cell 2019, 30, 2943–2952. [Google Scholar] [CrossRef] [PubMed]
- Fukuda, A.P.M.; Camandona, V.L.; Francisco, K.J.M.; Rios-Anjos, R.M.; Lucio do Lago, C.; Ferreira-Junior, J.R. Simulated microgravity accelerates aging in Saccharomyces cerevisiae. Life Sci. Space Res. 2021, 28, 32–40. [Google Scholar] [CrossRef] [PubMed]
- Aluru, M.; McKinney, T.; Venero, A.L.; Choudhury, S.; Torres, M. Mitogen-activated protein kinases, Fus3 and Kss1, regulate chronological lifespan in yeast. Aging 2017, 9, 2587–2609. [Google Scholar] [CrossRef] [PubMed]
- Lim, S.; Ahn, H.; Duan, R.; Liu, Y.; Ryu, H.Y.; Ahn, S.H. The Spt7 subunit of the SAGA complex is required for the regulation of lifespan in both dividing and nondividing yeast cells. Mech. Ageing Dev. 2021, 196, 111480. [Google Scholar] [CrossRef]
- Bui, L.N.; Iosue, C.L.; Wykoff, D.D. Tup1 Paralog CgTUP11 Is a Stronger Repressor of Transcription than CgTUP1 in Candida glabrata. mSphere 2022, 7, e0076521. [Google Scholar] [CrossRef]
- Zhan, C.; Yang, Y.; Zhang, Z.; Li, X.; Liu, X.; Bai, Z. Transcription factor Mxr1 promotes the expression of Aox1 by repressing glycerol transporter 1 in Pichia pastoris. FEMS Yeast Res. 2017, 17, fox015. [Google Scholar] [CrossRef]
- Labunskyy, V.M.; Gerashchenko, M.V.; Delaney, J.R.; Kaya, A.; Kennedy, B.K.; Kaeberlein, M.; Gladyshev, V.N. Lifespan extension conferred by endoplasmic reticulum secretory pathway deficiency requires induction of the unfolded protein response. PLoS Genet. 2014, 10, e1004019. [Google Scholar] [CrossRef]
- Cocheme, H.M.; Murphy, M.P. Complex I is the major site of mitochondrial superoxide production by paraquat. J. Biol. Chem. 2008, 283, 1786–1798. [Google Scholar] [CrossRef]
- Yang, Y.Q.; Sun, R.F.; Ge, P.; Li, W.X.; Zhang, X.; Zhang, J.; Ye, L.; Zhang, N.; Wang, S.Y.; Lv, M.Q.; et al. GRPR down-regulation inhibits spermatogenesis through Ca2+ mediated by PLCbeta/IP3R signaling pathway in long-term formaldehyde-exposed rats. Food Chem. Toxicol. 2023, 179, 113998. [Google Scholar] [CrossRef]
- Selvaraj, B.; Le, T.T.; Kim, D.W.; Jung, B.H.; Yoo, K.Y.; Ahn, H.R.; Thuong, P.T.; Tran, T.T.T.; Pae, A.N.; Jung, S.H.; et al. Neuroprotective Effects of Ethanol Extract of Polyscias fruticosa (EEPF) against Glutamate-Mediated Neuronal Toxicity in HT22 Cells. Int. J. Mol. Sci. 2023, 24, 3969. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhang, L.; Zhou, L.; Lei, Y.; Zhang, Y.; Huang, C. Redox signaling and unfolded protein response coordinate cell fate decisions under ER stress. Redox Biol. 2019, 25, 101047. [Google Scholar] [CrossRef] [PubMed]
- Kawahara, T.; Yanagi, H.; Yura, T.; Mori, K. Endoplasmic reticulum stress-induced mRNA splicing permits synthesis of transcription factor Hac1p/Ern4p that activates the unfolded protein response. Mol. Biol. Cell 1997, 8, 1845–1862. [Google Scholar] [CrossRef] [PubMed]
- Delaney, J.R.; Murakami, C.; Chou, A.; Carr, D.; Schleit, J.; Sutphin, G.L.; An, E.H.; Castanza, A.S.; Fletcher, M.; Goswami, S.; et al. Dietary restriction and mitochondrial function link replicative and chronological aging in Saccharomyces cerevisiae. Exp. Gerontol. 2013, 48, 1006–1013. [Google Scholar] [CrossRef] [PubMed]
- Jin, H.; May, M.; Tranebjaerg, L.; Kendall, E.; Fontan, G.; Jackson, J.; Subramony, S.H.; Arena, F.; Lubs, H.; Smith, S.; et al. A novel X-linked gene, DDP, shows mutations in families with deafness (DFN-1), dystonia, mental deficiency and blindness. Nat. Genet. 1996, 14, 177–180. [Google Scholar] [CrossRef]
- Tam, A.B.; Koong, A.C.; Niwa, M. Ire1 has distinct catalytic mechanisms for XBP1/HAC1 splicing and RIDD. Cell Rep. 2014, 9, 850–858. [Google Scholar] [CrossRef]
- Wu, H.; Ng, B.S.; Thibault, G. Endoplasmic reticulum stress response in yeast and humans. Biosci. Rep. 2014, 34, e00118. [Google Scholar] [CrossRef]
- Salminen, A.; Kaarniranta, K. ER stress and hormetic regulation of the aging process. Ageing Res. Rev. 2010, 9, 211–217. [Google Scholar] [CrossRef]
- Bhandary, B.; Marahatta, A.; Kim, H.R.; Chae, H.J. An involvement of oxidative stress in endoplasmic reticulum stress and its associated diseases. Int. J. Mol. Sci. 2012, 14, 434–456. [Google Scholar] [CrossRef]
- Wang, J.; Yang, X.; Zhang, J. Bridges between mitochondrial oxidative stress, ER stress and mTOR signaling in pancreatic beta cells. Cell Signal 2016, 28, 1099–1104. [Google Scholar] [CrossRef]
- Roohi, T.F.; Faizan, S.; Parray, Z.A.; Baig, M.; Mehdi, S.; Kinattingal, N.; Krishna, K.L. Beyond Glucose: The Dual Assault of Oxidative and ER Stress in Diabetic Disorders. High. Blood Press. Cardiovasc. Prev. 2023, 30, 513–531. [Google Scholar] [CrossRef]
- Mizuno, T.; Nakamura, M.; Irie, K. Induction of Ptp2 and Cmp2 protein phosphatases is crucial for the adaptive response to ER stress in Saccharomyces cerevisiae. Sci. Rep. 2018, 8, 13078. [Google Scholar] [CrossRef] [PubMed]
- Osman, A.; El-Gamal, H.; Pasha, M.; Zeidan, A.; Korashy, H.M.; Abdelsalam, S.S.; Hasan, M.; Benameur, T.; Agouni, A. Endoplasmic Reticulum (ER) Stress-Generated Extracellular Vesicles (Microparticles) Self-Perpetuate ER Stress and Mediate Endothelial Cell Dysfunction Independently of Cell Survival. Front. Cardiovasc. Med. 2020, 7, 584791. [Google Scholar] [CrossRef] [PubMed]
- Kapitzky, L.; Beltrao, P.; Berens, T.J.; Gassner, N.; Zhou, C.; Wüster, A.; Wu, J.; Babu, M.M.; Elledge, S.J.; Toczyski, D. Cross-species chemogenomic profiling reveals evolutionarily conserved drug mode of action. Mol. Syst. Biol. 2010, 6, 451. [Google Scholar] [CrossRef] [PubMed]
- Hanway, D.; Chin, J.K.; Xia, G.; Oshiro, G.; Winzeler, E.A.; Romesberg, F.E. Previously uncharacterized genes in the UV-and MMS-induced DNA damage response in yeast. Proc. Natl. Acad. Sci. USA 2002, 99, 10605–10610. [Google Scholar] [CrossRef] [PubMed]
- Rowe, L.A.; Degtyareva, N.; Doetsch, P.W. DNA damage-induced reactive oxygen species (ROS) stress response in Saccharomyces cerevisiae. Free Radic. Biol. Med. 2008, 45, 1167–1177. [Google Scholar] [CrossRef]
- Davalli, P.; Mitic, T.; Caporali, A.; Lauriola, A.; D’Arca, D. ROS, Cell Senescence, and Novel Molecular Mechanisms in Aging and Age-Related Diseases. Oxid. Med. Cell Longev. 2016, 2016, 3565127. [Google Scholar] [CrossRef]
- Finkel, T.; Holbrook, N.J. Oxidants, oxidative stress and the biology of ageing. Nature 2000, 408, 239–247. [Google Scholar] [CrossRef]
- Alugoju, P.; Janardhanshetty, S.S.; Subaramanian, S.; Periyasamy, L.; Dyavaiah, M. Quercetin Protects Yeast Saccharomyces cerevisiae pep4 Mutant from Oxidative and Apoptotic Stress and Extends Chronological Lifespan. Curr. Microbiol. 2018, 75, 519–530. [Google Scholar] [CrossRef]
- Polymenis, M.; Kennedy, B.K. Chronological and replicative lifespan in yeast: Do they meet in the middle? Cell Cycle 2012, 11, 3531–3532. [Google Scholar] [CrossRef][Green Version]
- Aerts, A.M.; Zabrocki, P.; Govaert, G.; Mathys, J.; Carmona-Gutierrez, D.; Madeo, F.; Winderickx, J.; Cammue, B.P.A.; Thevissen, K. Mitochondrial dysfunction leads to reduced chronological lifespan and increased apoptosis in yeast. FEBS Lett. 2009, 583, 113–117. [Google Scholar] [CrossRef]
- Ocampo, A.; Liu, J.; Schroeder, E.A.; Shadel, G.S.; Barrientos, A. Mitochondrial Respiratory Thresholds Regulate Yeast Chronological Life Span and its Extension by Caloric Restriction. Cell Metab. 2012, 16, 55–67. [Google Scholar] [CrossRef] [PubMed]
- Burtner, C.R.; Murakami, C.J.; Kennedy, B.K.; Kaeberlein, M. A molecular mechanism of chronological aging in yeast. Cell Cycle 2009, 8, 1256–1270. [Google Scholar] [CrossRef] [PubMed]
- Kaeberlein, M. Lessons on longevity from budding yeast. Nature 2013, 464, 513–519. [Google Scholar] [CrossRef] [PubMed]
- Gast, V.; Campbell, K.; Picazo, C.; Engqvist, M.; Siewers, V.; Molin, M. The Yeast eIF2 Kinase Gcn2 Facilitates H2O2-Mediated Feedback Inhibition of Both Protein Synthesis and Endoplasmic Reticulum Oxidative Folding during Recombinant Protein Production. Appl. Environ. Microbiol. 2021, 87, e0030121. [Google Scholar] [CrossRef]
- An, M.Y.; Lee, S.R.; Hwang, H.J.; Yoon, J.G.; Lee, H.J.; Cho, J.A. Antioxidant and Anti-Inflammatory Effects of Korean Black Ginseng Extract through ER Stress Pathway. Antioxidants 2021, 10, 62. [Google Scholar] [CrossRef]
- Franca, M.B.; Panek, A.D.; Eleutherio, E.C. The role of cytoplasmic catalase in dehydration tolerance of Saccharomyces cerevisiae. Cell Stress. Chaperones 2005, 10, 167–170. [Google Scholar] [CrossRef]
- Walter, P.; Ron, D. The unfolded protein response: From stress pathway to homeostatic regulation. Science 2011, 334, 1081–1086. [Google Scholar] [CrossRef]
- Afsar, E.; Kirimlioglu, E.; Ceker, T.; Yilmaz, C.; Demir, N.; Aslan, M. Effect of ER stress on sphingolipid levels and apoptotic pathways in retinal pigment epithelial cells. Redox Biol. 2020, 30, 101430. [Google Scholar] [CrossRef]
- Ogata, S.; Kameda, K.; Kono, T.; Ozeki, Y.; Hashimoto, H.; Tominaga, S.; Nakanishi, K. Expressions of ATF6, XBP1, and GRP78 in normal tissue, atypical adenomatous hyperplasia, and adenocarcinoma of the lung. Hum. Pathol. 2019, 83, 22–28. [Google Scholar] [CrossRef]
- Aghaei, M.; Nasimian, A.; Rahmati, M.; Kawalec, P.; Machaj, F.; Rosik, J.; Bhushan, B.; Bathaie, S.Z.; Azarpira, N.; Los, M.J.; et al. The Role of BiP and the IRE1alpha-XBP1 Axis in Rhabdomyosarcoma Pathology. Cancers 2021, 13, 4927. [Google Scholar] [CrossRef]
- Makio, T.; Chen, J.; Simmen, T. ER stress as a sentinel mechanism for ER Ca2+ homeostasis. Cell Calcium 2024, 124, 102961. [Google Scholar] [CrossRef] [PubMed]
- Krebs, J.; Agellon, L.B.; Michalak, M. Ca2+ homeostasis and endoplasmic reticulum (ER) stress: An integrated view of calcium signaling. Biochem. Biophys. Res. Commun. 2015, 460, 114–121. [Google Scholar] [CrossRef] [PubMed]
- Groenendyk, J.; Agellon, L.B.; Michalak, M. Calcium signaling and endoplasmic reticulum stress. Int. Rev. Cell Mol. Biol. 2021, 363, 1–20. [Google Scholar] [CrossRef] [PubMed]






| Strain Name | Genotype | Comments | Source |
|---|---|---|---|
| BY4742 | MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 | WT | Gift from Matt Kaeberlein |
| tim8Δ tim8Δ SOD2 OX | BY4742 tim8::URA3 BY4742 tim8::URA3SOD2OX | Deletion of TIM8 in BY4742 pAUR123SOD2 was transformed into tim8Δ | This study This study |
| tim8ΔCTT1 OX tim8ΔHAC1 OX | BY4742 tim8::URA3 CTT1 OX BY4742 tim8::URA3HAC1OX | pAUR123 CTT1 was transformed into tim8Δ pAUR123 HAC1 was transformed into tim8Δ | This study This study |
| Gene | Primers | Sequence |
|---|---|---|
| PRP8 | Forward | TCATGGCTGCGTCTGAAGTA |
| Reverse | GGCACCGTTATTAGCAGCAT | |
| SOD1 | Forward | AATCCGAGCCAACCACTGTC |
| Reverse | CGACGCTTCTGCCTACAACG | |
| SOD2 | Forward | GCATTACACCAAGCACCAT |
| Reverse | CTCGTCCAGACTGCCAAAC | |
| CTA1 | Forward | CCAACAGGACAGACCCATTC |
| Reverse | TTACCCAAAACGCGGTAGAG | |
| CTT1 | Forward | GATTCCGTTCTACAAGCCAGAC |
| Reverse | GGAGTATGGACATCCCAAGTTTC | |
| GPX1 | Forward | ATCCATTCCCCTTCAACTCC |
| Reverse | TCCAGACTTCCCGCTTAC | |
| GPX2 | Forward | AAAAGCCAAAAAGCAGGTTTACT |
| Reverse | CCAAGGACGATGGTTTTGTT | |
| GPX3 | Forward | TAAAGGGAAAAGTGGTGC |
| Reverse | TTCATAATGGGGAAAGTCA | |
| TRX2 | Forward | AAAGTTTGCAGAACAATATTCTGACG |
| Reverse | TTGGCACCGACGACTCTGGTAACC | |
| MXR1 | Forward | ACAGATTTTGCGGAGGTTTTAC |
| Reverse | CCATTTTGGTTGCCATTCTT | |
| TSA1 | Forward | TCTTTTCGCCTCCACTGACT |
| Reverse | CGATGATGAACAAACCTCTCAA | |
| GLR1 | Forward | CGAACACCAAGCATTACGATTA |
| Reverse | GTAGCGAGGTCAGAAGCATACC | |
| GSH1 | Forward | GACACCGATGTGGAAACTGA |
| Reverse | CCCTTTTTGGCATAGGATTG | |
| GSH2 | Forward | CACAGAGCAGGAAATAGCG |
| Reverse | TTGGAGCCAGATAATTGAGT | |
| YAP1 | Forward | ATGATGTCGTTCCATCTAAGGAAGG |
| Reverse | CAACCCCTCTTTCTGAACATTTTGC | |
| SKN7 | Forward | CCCGAGGAAAGACAGAGATGTA |
| Reverse | CAAAAGAGACCCAGAAGGATTG |
| Gene | Primers | Sequence |
|---|---|---|
| HACIs | Forward | GCGTAATCCAGAAGCGCAGT |
| Reverse | GTGATGAAGAAATCATTCAATTCAAATG | |
| EUG1 | Forward | TATCAATCCACTTGCCAAACACTAC |
| Reverse | ACCACTGAGTTAGAGCAACGGAA | |
| ERO1 | Forward | ATGGTGGTAAGCAAGCTGGTC |
| Reverse | ACCGATAGAGGCATGGAAACC | |
| LHS1 | Forward | CCAGGTGAACAGCAGCATTATAT |
| Reverse | CTATTGTAACGGGCTGAGTAGTGTC | |
| KAR2 | Forward | ATACGAGGGTGAAAGAGCCATG |
| Reverse | TCGGATTTACCAGTTCCCTTATCT | |
| FKB2 | Forward | AATCGGGAACTGTATTTGACTCAA |
| Reverse | TTGGAATTTGCAGCTTTCTTTT | |
| INO1 | Forward | TGTTCTGTTGTCGGGTTCCTAAT |
| Reverse | CCTTGTACGTGCACTTGTCGGT | |
| PDI1 | Forward | CATTCCAGGGTTCCCAAGC |
| Reverse | CGGATTGGACGATAACTGGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, D.; Guan, W.; Yang, X.; Li, Z.; Zhao, W.; Liu, X. TIM8 Deficiency in Yeast Induces Endoplasmic Reticulum Stress and Shortens the Chronological Lifespan. Biomolecules 2025, 15, 271. https://doi.org/10.3390/biom15020271
Tang D, Guan W, Yang X, Li Z, Zhao W, Liu X. TIM8 Deficiency in Yeast Induces Endoplasmic Reticulum Stress and Shortens the Chronological Lifespan. Biomolecules. 2025; 15(2):271. https://doi.org/10.3390/biom15020271
Chicago/Turabian StyleTang, Dong, Wenbin Guan, Xiaodi Yang, Zhongqin Li, Wei Zhao, and Xinguang Liu. 2025. "TIM8 Deficiency in Yeast Induces Endoplasmic Reticulum Stress and Shortens the Chronological Lifespan" Biomolecules 15, no. 2: 271. https://doi.org/10.3390/biom15020271
APA StyleTang, D., Guan, W., Yang, X., Li, Z., Zhao, W., & Liu, X. (2025). TIM8 Deficiency in Yeast Induces Endoplasmic Reticulum Stress and Shortens the Chronological Lifespan. Biomolecules, 15(2), 271. https://doi.org/10.3390/biom15020271
