Single-Atom Ce-N-C Nanozyme Ameliorates Type 2 Diabetes Mellitus by Improving Glucose Metabolism Disorders and Reducing Oxidative Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Animal Experiments
2.3. Glucose- and Insulin-Tolerance Tests and Serum Insulin Content Determination
2.4. Measurement of Biochemical Indications in Mice
2.5. Histological Analysis
2.6. Establishment of Insulin Resistance Cell Model
2.7. Measurement of Cell Viability
2.8. Measurement of Glycogen Content and Glucose Uptake
2.9. Measurement of Oxidative Stress Index
2.10. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.11. Statistical Analysis
3. Results
3.1. Effect of SACe-N-C on Body Weight, Food Intake and Fasting Blood Glucose (FBG) in HFD/STZ-Induced T2DM Mice
3.2. SACe-N-C Improved Glucose Tolerance, Insulin Sensitivity and Pancreatic Injury in HFD/STZ-Induced T2DM Mice
3.3. SACe-N-C Improved Liver Injury in HFD/STZ-Induced T2DM Mice
3.4. SACe-N-C Improved Oxidative Stress in HFD/STZ-Induced T2DM Mice
3.5. Effect of SACe-N-C on Insulin Signaling Pathway In Vivo
3.6. Establishment of IR-HepG2 Cell Model and Effect of SACe-N-C on Glucose Uptake and Consumption
3.7. Effect of SACe-N-C on Oxidative Stress and Insulin Signaling Pathway In Vitro
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ben-Shlomo, A.; Fleseriu, M. Diabetes Mellitus. Endocrinol. Metab. Clin. N. Am. 2016, 45, xiii–xiv. [Google Scholar] [CrossRef] [Scilit]
- Classification and Diagnosis of Diabetes: Standards of Medical Care in Diabetes-2022. Diabetes Care 2022, 45, S17–S38. [CrossRef] [Scilit] [PubMed]
- Saeedi, P.; Petersohn, I.; Salpea, P.; Malanda, B.; Karuranga, S.; Unwin, N.; Colagiuri, S.; Guariguata, L.; Motala, A.A.; Ogurtsova, K.; et al. Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas, 9(th) edition. Diabetes Res Clin. Pr. 2019, 157, 107843. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, L.; Li, Y.; Dai, Y.; Peng, J. Natural products for the treatment of type 2 diabetes mellitus: Pharmacology and mechanisms. Pharmacol. Res. 2018, 130, 451–465. [Google Scholar] [CrossRef] [Scilit]
- Zheng, Y.; Ley, S.H.; Hu, F.B. Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nat. Rev. Endocrinol. 2018, 14, 88–98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stumvoll, M.; Goldstein, B.J.; van Haeften, T.W. Type 2 diabetes: Principles of pathogenesis and therapy. Lancet 2005, 365, 1333–1346. [Google Scholar] [CrossRef] [Scilit]
- Ma, C.X.; Ma, X.N.; Guan, C.H.; Li, Y.D.; Mauricio, D.; Fu, S.B. Cardiovascular disease in type 2 diabetes mellitus: Progress toward personalized management. Cardiovasc. Diabetol. 2022, 21, 74. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.G.; Liu, A.X.; Zhang, Y.X.; Zhou, M.Y.; Li, X.Y.; Fu, M.H.; Pan, Y.P.; Xu, J.; Zhang, J.Q. A diarylheptanoid compound from Alpinia officinarum Hance ameliorates high glucose-induced insulin resistance by regulating PI3K/AKT-Nrf2-GSK3β signaling pathways in HepG2 cells. J. Ethnopharmacol. 2022, 295, 115397. [Google Scholar] [CrossRef] [Scilit]
- DeFronzo, R.A.; Tripathy, D. Skeletal muscle insulin resistance is the primary defect in type 2 diabetes. Diabetes Care 2009, 32 (Suppl. S2), S157–S163. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Liu, H.; Liu, J. Akt activation: A potential strategy to ameliorate insulin resistance. Diabetes Res. Clin. Pract. 2019, 156, 107092. [Google Scholar] [CrossRef] [Scilit]
- Li, J.S.; Ji, T.; Su, S.L.; Zhu, Y.; Chen, X.L.; Shang, E.X.; Guo, S.; Qian, D.W.; Duan, J.A. Mulberry leaves ameliorate diabetes via regulating metabolic profiling and AGEs/RAGE and p38 MAPK/NF-κB pathway. J. Ethnopharmacol. 2022, 283, 114713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Evans, J.L.; Maddux, B.A.; Goldfine, I.D. The molecular basis for oxidative stress-induced insulin resistance. Antioxid. Redox Signal 2005, 7, 1040–1052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patel, B.M.; Goyal, R.K. Liver and insulin resistance: New wine in old bottle!!! Eur. J. Pharmacol. 2019, 862, 172657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Govers, R. Cellular regulation of glucose uptake by glucose transporter GLUT4. Adv. Clin. Chem. 2014, 66, 173–240. [Google Scholar] [CrossRef] [Scilit]
- Webb, A.E.; Brunet, A. FOXO transcription factors: Key regulators of cellular quality control. Trends Biochem. Sci. 2014, 39, 159–169. [Google Scholar] [CrossRef] [Scilit]
- Hu, X.; Liu, Z.; Lu, Y.; Chi, X.; Han, K.; Wang, H.; Wang, Y.; Ma, L.; Xu, B. Glucose metabolism enhancement by 10-hydroxy-2-decenoic acid via the PI3K/AKT signaling pathway in high-fat-diet/streptozotocin induced type 2 diabetic mice. Food Funct. 2022, 13, 9931–9946. [Google Scholar] [CrossRef] [Scilit]
- Houstis, N.; Rosen, E.D.; Lander, E.S. Reactive oxygen species have a causal role in multiple forms of insulin resistance. Nature 2006, 440, 944–948. [Google Scholar] [CrossRef] [Scilit]
- Rehman, K.; Akash, M.S.H. Mechanism of Generation of Oxidative Stress and Pathophysiology of Type 2 Diabetes Mellitus: How Are They Interlinked? J. Cell Biochem. 2017, 118, 3577–3585. [Google Scholar] [CrossRef] [Scilit]
- Baird, L.; Yamamoto, M. The Molecular Mechanisms Regulating the KEAP1-NRF2 Pathway. Mol. Cell Biol. 2020, 40, e00099-20. [Google Scholar] [CrossRef] [Scilit]
- Uruno, A.; Yagishita, Y.; Yamamoto, M. The Keap1-Nrf2 system and diabetes mellitus. Arch. Biochem. Biophys. 2015, 566, 76–84. [Google Scholar] [CrossRef] [Scilit]
- Manea, F.; Houillon, F.B.; Pasquato, L.; Scrimin, P. Nanozymes: Gold-nanoparticle-based transphosphorylation catalysts. Angew. Chem. Int. Ed. Engl. 2004, 43, 6165–6169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, D.; Ni, D.; Rosenkrans, Z.T.; Huang, P.; Yan, X.; Cai, W. Nanozyme: New horizons for responsive biomedical applications. Chem. Soc. Rev. 2019, 48, 3683–3704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiao, B.; Wang, A.; Yang, X.; Allard, L.F.; Jiang, Z.; Cui, Y.; Liu, J.; Li, J.; Zhang, T. Single-atom catalysis of CO oxidation using Pt1/FeOx. Nat. Chem. 2011, 3, 634–641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, B.; Li, S.; Zheng, L.; Liu, Y.; Han, A.; Zhang, J.; Huang, Z.; Xie, H.; Fan, K.; Gao, L.; et al. A Bioinspired Five-Coordinated Single-Atom Iron Nanozyme for Tumor Catalytic Therapy. Adv. Mater. 2022, 34, e2107088. [Google Scholar] [CrossRef] [Scilit]
- Jiao, L.; Yan, H.; Wu, Y.; Gu, W.; Zhu, C.; Du, D.; Lin, Y. When Nanozymes Meet Single-Atom Catalysis. Angew. Chem. Int. Ed. Engl. 2020, 59, 2565–2576. [Google Scholar] [CrossRef] [Scilit]
- Huang, L.; Chen, J.; Gan, L.; Wang, J.; Dong, S. Single-atom nanozymes. Sci. Adv. 2019, 5, eaav5490. [Google Scholar] [CrossRef] [Scilit]
- Ji, S.F.; Jiang, B.; Hao, H.G.; Chen, Y.J.; Dong, J.C.; Mao, Y.; Zhang, Z.D.; Gao, R.; Chen, W.X.; Zhang, R.F.; et al. Matching the kinetics of natural enzymes with a single-atom iron nanozyme. Nat. Catal. 2021, 4, 407–417. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Li, P.; Yu, D.; Zhang, Y.; Wang, Z.; Liu, C.; Qiu, H.; Liu, Z.; Ren, J.; Qu, X. Unraveling the Enzymatic Activity of Oxygenated Carbon Nanotubes and Their Application in the Treatment of Bacterial Infections. Nano Lett. 2018, 18, 3344–3351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.; Wang, Y.; Lu, L.L.; Ma, Q.; Feng, R.X.; Xu, S.Y.; James, T.D.; Wang, L.Y. Reducing Valence States of Co Active Sites in a Single-Atom Nanozyme for Boosted Tumor Therapy. Adv. Funct. Mater. 2022, 32, 202200331. [Google Scholar] [CrossRef] [Scilit]
- Cao, F.; Zhang, L.; You, Y.; Zheng, L.; Ren, J.; Qu, X. An Enzyme-Mimicking Single-Atom Catalyst as an Efficient Multiple Reactive Oxygen and Nitrogen Species Scavenger for Sepsis Management. Angew. Chem. Int. Ed. Engl. 2020, 59, 5108–5115. [Google Scholar] [CrossRef] [Scilit]
- Li, J.C.; Qin, X.; Xiao, F.; Liang, C.; Xu, M.; Meng, Y.; Sarnello, E.; Fang, L.; Li, T.; Ding, S.; et al. Highly Dispersive Cerium Atoms on Carbon Nanowires as Oxygen Reduction Reaction Electrocatalysts for Zn-Air Batteries. Nano Lett. 2021, 21, 4508–4515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, G.; Zhang, J.; Huang, H.; Wang, X.; He, X.; Luo, Y.; Li, J.C.; Huang, K.; Cheng, N. Single-atom Ce-N-C nanozyme bioactive paper with a 3D-printed platform for rapid detection of organophosphorus and carbamate pesticide residues. Food Chem. 2022, 387, 132896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, G.; Xu, J.; Zhong, H.; Zhang, Q.; Wang, X.; Lin, Y.; Beckman, S.P.; Luo, Y.; He, X.; Li, J.C.; et al. Single-Atom Ce-N4-C-(OH)2 Nanozyme-Catalyzed Cascade Reaction to Alleviate Hyperglycemia. Research 2023, 6, 0095. [Google Scholar] [CrossRef] [Scilit]
- Chen, T.; Zhang, Y.; Liu, Y.; Zhu, D.; Yu, J.; Li, G.; Sun, Z.; Wang, W.; Jiang, H.; Hong, Z. MiR-27a promotes insulin resistance and mediates glucose metabolism by targeting PPAR-γ-mediated PI3K/AKT signaling. Aging 2019, 11, 7510–7524. [Google Scholar] [CrossRef] [Scilit]
- Xiao, F.; Huang, Z.; Li, H.; Yu, J.; Wang, C.; Chen, S.; Meng, Q.; Cheng, Y.; Gao, X.; Li, J.; et al. Leucine deprivation increases hepatic insulin sensitivity via GCN2/mTOR/S6K1 and AMPK pathways. Diabetes 2011, 60, 746–756. [Google Scholar] [CrossRef] [Scilit]
- Hu, W.; Li, M.; Sun, W.; Li, Q.; Xi, H.; Qiu, Y.; Wang, R.; Ding, Q.; Wang, Z.; Yu, Y.; et al. Hirsutine ameliorates hepatic and cardiac insulin resistance in high-fat diet-induced diabetic mice and in vitro models. Pharmacol. Res. 2022, 177, 105917. [Google Scholar] [CrossRef] [Scilit]
- Yan, J.; Wang, C.; Jin, Y.; Meng, Q.; Liu, Q.; Liu, Z.; Liu, K.; Sun, H. Catalpol ameliorates hepatic insulin resistance in type 2 diabetes through acting on AMPK/NOX4/PI3K/AKT pathway. Pharmacol. Res. 2018, 130, 466–480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, T.; Wang, Q. D-chiro-inositol found in Cucurbita ficifolia (Cucurbitaceae) fruit extracts plays the hypoglycaemic role in streptozocin-diabetic rats. J. Pharm. Pharmacol. 2006, 58, 1527–1532. [Google Scholar] [CrossRef] [Scilit]
- Kong, F.; Ding, Z.; Zhang, K.; Duan, W.; Qin, Y.; Su, Z.; Bi, Y. Optimization of extraction flavonoids from Exocarpium Citri Grandis and evaluation its hypoglycemic and hypolipidemic activities. J. Ethnopharmacol. 2020, 262, 113178. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.; Liu, G.; Guo, J.; Su, Z. The PI3K/AKT pathway in obesity and type 2 diabetes. Int. J. Biol. Sci. 2018, 14, 1483–1496. [Google Scholar] [CrossRef] [Scilit]
- Samuel, V.T.; Shulman, G.I. The pathogenesis of insulin resistance: Integrating signaling pathways and substrate flux. J. Clin. Invest. 2016, 126, 12–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alnahdi, A.; John, A.; Raza, H. Augmentation of Glucotoxicity, Oxidative Stress, Apoptosis and Mitochondrial Dysfunction in HepG2 Cells by Palmitic Acid. Nutrients 2019, 11, 1979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Wu, Q.; Liu, J.; Zhang, Z.; Ma, X.; Zhang, Y.; Zhu, J.; Thring, R.W.; Wu, M.; Gao, Y.; et al. Sulforaphane alleviates high fat diet-induced insulin resistance via AMPK/Nrf2/GPx4 axis. Biomed. Pharmacother. 2022, 152, 113273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Upadhyay, K.K.; Jadeja, R.N.; Vyas, H.S.; Pandya, B.; Joshi, A.; Vohra, A.; Thounaojam, M.C.; Martin, P.M.; Bartoli, M.; Devkar, R.V. Carbon monoxide releasing molecule-A1 improves nonalcoholic steatohepatitis via Nrf2 activation mediated improvement in oxidative stress and mitochondrial function. Redox Biol. 2020, 28, 101314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ceriello, A.; Motz, E. Is oxidative stress the pathogenic mechanism underlying insulin resistance, diabetes, and cardiovascular disease? The common soil hypothesis revisited. Arterioscler. Thromb. Vasc. Biol. 2004, 24, 816–823. [Google Scholar] [CrossRef] [Scilit]
- Ogurtsova, K.; da Rocha Fernandes, J.D.; Huang, Y.; Linnenkamp, U.; Guariguata, L.; Cho, N.H.; Cavan, D.; Shaw, J.E.; Makaroff, L.E. IDF Diabetes Atlas: Global estimates for the prevalence of diabetes for 2015 and 2040. Diabetes Res. Clin. Pract. 2017, 128, 40–50. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.Y.; Shi, C.X.; Gao, R.; Sun, H.J.; Xiong, X.Q.; Ding, L.; Chen, Q.; Li, Y.H.; Wang, J.J.; Kang, Y.M.; et al. Irisin inhibits hepatic gluconeogenesis and increases glycogen synthesis via the PI3K/Akt pathway in type 2 diabetic mice and hepatocytes. Clin. Sci. 2015, 129, 839–850. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Liu, C.; Yu, Y.; Yin, M.; Sun, J.; Huang, J.; Chen, N.; Wang, H.; Fan, C.; Song, H. An Organelle-Specific Nanozyme for Diabetes Care in Genetically or Diet-Induced Models. Adv. Mater. 2020, 32, e2003708. [Google Scholar] [CrossRef] [Scilit]
- U.K. Prospective Diabetes Study 16. Overview of 6 years’ therapy of type II diabetes: A progressive disease. U.K. Prospective Diabetes Study Group. Diabetes 1995, 44, 1249–1258. [CrossRef] [Scilit]
- Ferrannini, E. The stunned beta cell: A brief history. Cell Metab. 2010, 11, 349–352. [Google Scholar] [CrossRef] [Scilit]
- Baig, N.A.; Herrine, S.K.; Rubin, R. Liver disease and diabetes mellitus. Clin. Lab. Med. 2001, 21, 193–207. [Google Scholar] [PubMed]
- Zhang, S.; Zheng, L.; Dong, D.; Xu, L.; Yin, L.; Qi, Y.; Han, X.; Lin, Y.; Liu, K.; Peng, J. Effects of flavonoids from Rosa laevigata Michx fruit against high-fat diet-induced non-alcoholic fatty liver disease in rats. Food Chem. 2013, 141, 2108–2116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, C.; Deng, J.; Liu, D.; Tuo, X.; Xiao, L.; Lai, B.; Yao, Q.; Liu, J.; Yang, H.; Wang, N. Nuciferine ameliorates hepatic steatosis in high-fat diet/streptozocin-induced diabetic mice through a PPARα/PPARγ coactivator-1α pathway. Br. J. Pharmacol. 2018, 175, 4218–4228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.; Huang, Q.; Zhang, L.; Qiao, X.; Zhang, Y.; Tang, F.; Li, Z. Effect of CAPE-pNO2 against type 2 diabetes mellitus via the AMPK/GLUT4/GSK3β/PPARα pathway in HFD/STZ-induced diabetic mice. Eur. J. Pharmacol. 2019, 853, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Mottillo, S.; Filion, K.B.; Genest, J.; Joseph, L.; Pilote, L.; Poirier, P.; Rinfret, S.; Schiffrin, E.L.; Eisenberg, M.J. The metabolic syndrome and cardiovascular risk a systematic review and meta-analysis. J. Am. Coll. Cardiol. 2010, 56, 1113–1132. [Google Scholar] [CrossRef] [Scilit]
- Ichimori, S.; Shimoda, S.; Goto, R.; Matsuo, Y.; Maeda, T.; Furukawa, N.; Kawashima, J.; Kodama, S.; Sekigami, T.; Isami, S.; et al. Ezetimibe improves glucose metabolism by ameliorating hepatic function in Japanese patients with type 2 diabetes. J. Diabetes Investig. 2012, 3, 179–184. [Google Scholar] [CrossRef] [Scilit]
- Tan, Y.; Miao, L.; Xiao, J.; Cheang, W.S. 3,3′,4,5′-Tetramethoxy-trans-stilbene Improves Insulin Resistance by Activating the IRS/PI3K/Akt Pathway and Inhibiting Oxidative Stress. Curr. Issues Mol. Biol. 2022, 44, 2175–2185. [Google Scholar] [CrossRef] [Scilit]
- Irimia, J.M.; Meyer, C.M.; Peper, C.L.; Zhai, L.; Bock, C.B.; Previs, S.F.; McGuinness, O.P.; DePaoli-Roach, A.; Roach, P.J. Impaired glucose tolerance and predisposition to the fasted state in liver glycogen synthase knock-out mice. J. Biol. Chem. 2010, 285, 12851–12861. [Google Scholar] [CrossRef] [Scilit]
- Krssak, M.; Brehm, A.; Bernroider, E.; Anderwald, C.; Nowotny, P.; Dalla Man, C.; Cobelli, C.; Cline, G.W.; Shulman, G.I.; Waldhäusl, W.; et al. Alterations in postprandial hepatic glycogen metabolism in type 2 diabetes. Diabetes 2004, 53, 3048–3056. [Google Scholar] [CrossRef] [Scilit]
- Zheng, X.; Zhao, M.G.; Jiang, C.H.; Sheng, X.P.; Yang, H.M.; Liu, Y.; Yao, X.M.; Zhang, J.; Yin, Z.Q. Triterpenic acids-enriched fraction from Cyclocarya paliurus attenuates insulin resistance and hepatic steatosis via PI3K/Akt/GSK3β pathway. Phytomedicine Int. J. Phytother. Phytopharm. 2020, 66, 153130. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Zhao, Q.; Zhang, J.; Zhou, L.; Zhang, W.; Chua, B.; Chen, Y.; Xu, L.; Li, P. The Protein Phosphatase 1 Complex Is a Direct Target of AKT that Links Insulin Signaling to Hepatic Glycogen Deposition. Cell Rep. 2019, 28, 3406–3422.e3407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, K.; Gross, M.; Lee, D.H.; Holvoet, P.; Himes, J.H.; Shikany, J.M.; Jacobs, D.R., Jr. Oxidative stress and insulin resistance: The coronary artery risk development in young adults study. Diabetes Care 2009, 32, 1302–1307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farkhondeh, T.; Samarghandian, S.; Roshanravan, B. Impact of chrysin on the molecular mechanisms underlying diabetic complications. J. Cell Physiol. 2019, 234, 17144–17158. [Google Scholar] [CrossRef] [Scilit]
- Aksu, E.H.; Kandemir, F.M.; Küçükler, S.; Mahamadu, A. Improvement in colistin-induced reproductive damage, apoptosis, and autophagy in testes via reducing oxidative stress by chrysin. J. Biochem. Mol. Toxicol. 2018, 32, e22201. [Google Scholar] [CrossRef] [Scilit]
- Ding, X.; Jian, T.; Wu, Y.; Zuo, Y.; Li, J.; Lv, H.; Ma, L.; Ren, B.; Zhao, L.; Li, W.; et al. Ellagic acid ameliorates oxidative stress and insulin resistance in high glucose-treated HepG2 cells via miR-223/keap1-Nrf2 pathway. Biomed. Pharmacother. 2019, 110, 85–94. [Google Scholar] [CrossRef] [Scilit]
- Cui, B.; Zhang, S.; Wang, Y.; Guo, Y. Farrerol attenuates β-amyloid-induced oxidative stress and inflammation through Nrf2/Keap1 pathway in a microglia cell line. Biomed. Pharmacother. 2019, 109, 112–119. [Google Scholar] [CrossRef] [Scilit]
- Kim, Y.G.; Lee, Y.; Lee, N.; Soh, M.; Kim, D.; Hyeon, T. Ceria-Based Therapeutic Antioxidants for Biomedical Applications. Adv. Mater. 2024, 36, 2210819. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, Y.J.; Jeong, H.Y.; Kim, Y.B.; Lee, Y.J.; Won, S.Y.; Shim, J.H.; Cho, M.K.; Nam, H.S.; Lee, S.H. Reactive oxygen species and PI3K/Akt signaling play key roles in the induction of Nrf2-driven heme oxygenase-1 expression in sulforaphane-treated human mesothelioma MSTO-211H cells. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2012, 50, 116–123. [Google Scholar] [CrossRef] [Scilit]
- Deng, X.; Rui, W.; Zhang, F.; Ding, W. PM2.5 induces Nrf2-mediated defense mechanisms against oxidative stress by activating PIK3/AKT signaling pathway in human lung alveolar epithelial A549 cells. Cell Biol. Toxicol. 2013, 29, 143–157. [Google Scholar] [CrossRef] [Scilit]







| Species | Gene | Forward Primer | Reverse Primer |
|---|---|---|---|
| Mouse | Keap1 | TGCCCCTGTGGTCAAAGTG | GGTTCGGTTACCGTCCTGC |
| Nrf2 | TCTTGGAGTAAGTCGAGAAGTGT | GTTGAAACTGAGCGAAAAAGGC | |
| HO-1 | AAGCCGAGAATGCTGAGTTCA | GCCGTGTAGATATGGTACAAGGA | |
| NQO1 | AGGATGGGAGGTACTCGAATC | AGGCGTCCTTCCTTATATGCTA | |
| SOD1 | AACCAGTTGTGTTGTCAGGAC | CCACCATGTTTCTTAGAGTGAGG | |
| Cyp2e1 | CGTTGCCTTGCTTGTCTGGA | AAGAAAGGAATTGGGAAAGGTCC | |
| IRS-1 | CGATGGCTTCTCAGACGTG | CAGCCCGCTTGTTGATGTTG | |
| PI3K | ACACCACGGTTTGGACTATGG | GGCTACAGTAGTGGGCTTGG | |
| AKT | ATGAACGACGTAGCCATTGTG | TTGTAGCCAATAAAGGTGCCAT | |
| GSK3β | TGGCAGCAAGGTAACCACAG | CGGTTCTTAAATCGCTTGTCCTG | |
| β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT | |
| Human | Keap1 | GGAAACAGAGACGTGGACTTTCGTA | TCCAGGAACGTGTGACCATCATA |
| Nrf2 | GGTTGCCCACATTCCCAAAC | GCAAGCGACTCATGGTCATC | |
| HO-1 | CCAGGCAGAGAATGCTGAGTTC | AAGACTGGGCTCTCCTTGTTGC | |
| NQO1 | TGGTTTGGAGTCCCTGCCAT | CACTGCCTTCTTACTCCGGAAGG | |
| GPx1 | CAGTCGGTGTATGCCTTCTCG | GAGGGACGCCACATTCTCG | |
| SOD1 | GAGACTTGGGCAATGTGACTG | TTACACCACAAGCCAAACGA | |
| IRS-1 | ACTGGACATCACAGCAGAATGA | AGAACGTGCAGTTCAGTCAA | |
| PI3K | CCACGACCATCATCAGGTGAA | CCTCACGGAGGCATTCTAAAGT | |
| AKT | TCTATGGCGCTGGAGATTG | TCTTAATGTGCCCGTCCTTG | |
| GSK3β | AGGAGAACCCAATGTTTCGTAT | ATCCCCTGGAAATATTGGTTGT | |
| β-actin | AGCCATGTACGTAGCCATCC | CTCTCAGCTGTGGTGGTGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, Y.; Wang, Y.; Zhang, Q.; Gao, R.; Chang, F.; Li, B.; Huang, K.; Cheng, N.; He, X. Single-Atom Ce-N-C Nanozyme Ameliorates Type 2 Diabetes Mellitus by Improving Glucose Metabolism Disorders and Reducing Oxidative Stress. Biomolecules 2024, 14, 1193. https://doi.org/10.3390/biom14091193
Lin Y, Wang Y, Zhang Q, Gao R, Chang F, Li B, Huang K, Cheng N, He X. Single-Atom Ce-N-C Nanozyme Ameliorates Type 2 Diabetes Mellitus by Improving Glucose Metabolism Disorders and Reducing Oxidative Stress. Biomolecules. 2024; 14(9):1193. https://doi.org/10.3390/biom14091193
Chicago/Turabian StyleLin, Yitong, Yanan Wang, Qi Zhang, Ruxin Gao, Fei Chang, Boran Li, Kunlun Huang, Nan Cheng, and Xiaoyun He. 2024. "Single-Atom Ce-N-C Nanozyme Ameliorates Type 2 Diabetes Mellitus by Improving Glucose Metabolism Disorders and Reducing Oxidative Stress" Biomolecules 14, no. 9: 1193. https://doi.org/10.3390/biom14091193
APA StyleLin, Y., Wang, Y., Zhang, Q., Gao, R., Chang, F., Li, B., Huang, K., Cheng, N., & He, X. (2024). Single-Atom Ce-N-C Nanozyme Ameliorates Type 2 Diabetes Mellitus by Improving Glucose Metabolism Disorders and Reducing Oxidative Stress. Biomolecules, 14(9), 1193. https://doi.org/10.3390/biom14091193

