Enhancing Acetate Utilization in Phaeodactylum tricornutum through the Introduction of Acetate Transport Protein
Abstract
1. Introduction
2. Materials and Methods
2.1. Microorganisms and Culture Media
2.2. ADY2 Modification of P. tricornutum
2.3. Culture and Growth
2.4. Dry Weight
2.5. Photosynthetic Pigments
2.6. Photosynthetic Activity
2.7. Microscopic Observation
2.8. Crude Lipid Content
2.9. Fatty Acid Composition
5 × (% pentaenoic) + 6 × (% hexaenoic)
2.10. Chemical Oxygen Demand (COD)
2.11. Statistical Analysis
3. Results and Discussion
3.1. Evaluation of Growth and NaAc Assimilation
3.2. Photosynthesis Evaluation
3.2.1. Photosynthetic Pigments
3.2.2. Photosynthetic Activities
3.3. Lipid and Fatty Acids Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Qi, B.; Fraser, T.; Mugford, S.; Dobson, G.; Sayanova, O.; Butler, J.; Napier, J.A.; Stobart, A.K.; Lazarus, C.M. Production of very long chain polyunsaturated omega-3 and omega-6 fatty acids in plants. Nat. Biotechnol. 2004, 22, 739–745. [Google Scholar] [CrossRef] [PubMed]
- Balamurugan, S.; Wang, X.; Wang, H.-L.; An, C.-J.; Li, H.; Li, D.-W.; Yang, W.-D.; Liu, J.-S.; Li, H.-Y. Occurrence of plastidial triacylglycerol synthesis and the potential regulatory role of AGPAT in the model diatom Phaeodactylum tricornutum. Biotechnol. Biofuels 2017, 10, 97. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Thomas-Hall, S.R.; Chua, E.T.; Schenk, P.M. Development of high-level omega-3 eicosapentaenoic acid (EPA) production from Phaeodactylum tricornutum. J. Phycol. 2021, 57, 258–268. [Google Scholar] [CrossRef] [PubMed]
- Xue, J.; Niu, Y.-F.; Huang, T.; Yang, W.-D.; Liu, J.-S.; Li, H.-Y. Genetic improvement of the microalga Phaeodactylum tricornutum for boosting neutral lipid accumulation. Metab. Eng. 2015, 27, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Duan, S.; Li, A.; Xu, N.; Cai, Z.; Hu, Z. Effects of organic carbon sources on growth, photosynthesis, and respiration of Phaeodactylum tricornutum. J. Appl. Phycol. 2009, 21, 239–246. [Google Scholar] [CrossRef]
- Cerón Garcí, M.C.; Fernández Sevilla, J.M.; Acién Fernández, F.G.; Molina Grima, E.; García Camacho, F. Mixotrophic growth of Phaeodactylum tricornutum on glycerol: Growth rate and fatty acid profile. J. Appl. Phycol. 2000, 12, 239–248. [Google Scholar] [CrossRef]
- Cooksey, K.E. Acetate metabolism by whole cells of Phaeodactylum tricornutum Bohlin. J. Phycol. 1974, 10, 253–257. [Google Scholar] [CrossRef]
- Hayward, J. Studies on the growth of Phaeodaetylum tricornutum: II. The effect of organic substances on growth. Physiol. Plant. 1968, 21, 100–108. [Google Scholar] [CrossRef]
- Li, K.; Xia, Y.; Wang, Z.; Gao, E.; Huo, S.; Chen, H. Progress in the cultivation of diatoms using organic carbon sources. Algal Res. 2023, 74, 103191. [Google Scholar] [CrossRef]
- Young, E.B.; Reed, L.; Berges, J.A. Growth parameters and responses of green algae across a gradient of phototrophic, mixotrophic and heterotrophic conditions. PeerJ 2022, 10, e13776. [Google Scholar] [CrossRef]
- Villanova, V.; Singh, D.; Pagliardini, J.; Fell, D.; Le Monnier, A.; Finazzi, G.; Poolman, M. Boosting biomass quantity and quality by improved mixotrophic culture of the diatom Phaeodactylum tricornutum. Adv. Front. Plant Sci. 2021, 12, 642199. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Fu, R.; Pei, G. A study on lipid production of the mixotrophic microalgae Phaeodactylum tricornutum on various carbon sources. Afr. J. Microbiol. Res 2012, 6, 1041–1047. [Google Scholar]
- Pringsheim, E.G. Beiträge zur physiologie saprophytischer algen und flagellaten. Planta 1937, 26, 665–691. [Google Scholar] [CrossRef]
- García, T.; Castillo, T.; Flores, C.; Galindo, E. Characterization of a new HUP+ Phaeodactylum tricornutum strain having improved production of eicosapentaenoic acid. J. Appl. Chem. Biotechnol. 2024, 99, 474–480. [Google Scholar] [CrossRef]
- Zhang, W.; Zhou, W.; Jiang, S.; Wang, Y.; Chen, L.; Yang, G.; Liu, T. Heterotrophic modification of Phaeodactylum tricornutum Bohlin. Algal Res. 2023, 72, 103137. [Google Scholar] [CrossRef]
- Kim, Y.; Lama, S.; Agrawal, D.; Kumar, V.; Park, S. Acetate as a potential feedstock for the production of value-added chemicals: Metabolism and applications. Biotechnol. Adv. 2021, 49, 107736. [Google Scholar] [CrossRef] [PubMed]
- Dragone, G. Challenges and opportunities to increase economic feasibility and sustainability of mixotrophic cultivation of green microalgae of the genus Chlorella. Renew. Sustain. Energy Rev. 2022, 160, 112284. [Google Scholar] [CrossRef]
- Cheng, J.; Fan, W.; Zheng, L. Development of a mixotrophic cultivation strategy for simultaneous improvement of biomass and photosynthetic efficiency in freshwater microalga Scenedesmus obliquus by adding appropriate concentration of sodium acetate. Biochem. Eng. J 2021, 176, 108177. [Google Scholar] [CrossRef]
- Guillard, R.R.L. Culture of Phytoplankton for Feeding Marine Invertebrates. In Culture of Marine Invertebrate Animals: Proceedings—1st Conference on Culture of Marine Invertebrate Animals Greenport; Smith, W.L., Chanley, M.H., Eds.; Springer: Boston, MA, USA, 1975; pp. 29–60. [Google Scholar]
- Paiva, S.; Devaux, F.; Barbosa, S.; Jacq, C.; Casal, M. Ady2p is essential for the acetate permease activity in the yeast Saccharomyces cerevisiae. Yeast 2004, 21, 201–210. [Google Scholar] [CrossRef]
- Zaslavskaia, L.A.; Lippmeier, J.C.; Kroth, P.G.; Grossman, A.R.; Apt, K.E. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. J. Phycol. 2000, 36, 379–386. [Google Scholar] [CrossRef]
- Krämer, L.C.; Wasser, D.; Haitz, F.; Sabel, B.; Büchel, C. Heterologous expression of HUP1 glucose transporter enables low-light mediated growth on glucose in Phaeodactylum tricornutum. Algal Res. 2022, 64, 102719. [Google Scholar] [CrossRef]
- Lichtenthaler, H.K. Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. Methods Enzymol. 1987, 148, 350–382. [Google Scholar] [CrossRef]
- Greenspan, P.; Mayer, E.P.; Fowler, S.D. Nile Red: A selective fluorescent stain for intracellular lipid droplets. J. Cell Biol. 1985, 100, 965–973. [Google Scholar] [CrossRef] [PubMed]
- Leyland, B.; Novichkova, E.; Dolui, A.K.; Jallet, D.; Daboussi, F.; Legeret, B.; Li, Z.; Li-Beisson, Y.; Boussiba, S.; Khozin-Goldberg, I. Acyl-CoA binding protein is required for lipid droplet degradation in the diatom Phaeodactylum Tricornutum. Plant Physiol. 2024, 194, 958–981. [Google Scholar] [CrossRef] [PubMed]
- Folch, J.; Lees, M.; Stanley, G.S. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef] [PubMed]
- Qiao, H.; Wang, J.; Zhang, L.; Sun, C.; Ma, J.; Song, Z.; Li, B. An improved direct transesterification method for fatty acid determination of Phaeodactylum tricornutum. J. Appl. Phycol. 2015, 27, 697–701. [Google Scholar] [CrossRef]
- Anh, T.P.T.; Borrel-Flood, C.; da Silva, J.V.; Justin, A.M.; Mazliak, P. Effects of water stress on lipid metabolism in cotton leaves. Phytochemistry 1985, 24, 723–727. [Google Scholar] [CrossRef]
- The State Oceanic Administration of China. The Specification for Marine Monitoring—Part 4: Seawater Analysis (In Chinese); Stardards Press of China: Beijing, China, 2008; pp. 101–103.
- Duncan, D.B.J.B. Multiple range and multiple f tests. Biometrics 1955, 11, 1–42. [Google Scholar] [CrossRef]
- Williams, L.J.; Abdi, H.H. Fisher’s least significant difference (LSD) test. Encycl. Res. Des. 2010, 218, 840–853. [Google Scholar]
- Haro, P.; Sáez, K.; Gómez, P.I. Physiological plasticity of a Chilean strain of the diatom Phaeodactylum tricornutum: The effect of culture conditions on the quantity and quality of lipid production. J. Appl. Phycol. 2017, 29, 2771–2782. [Google Scholar] [CrossRef]
- Zaslavskaia, L.; Lippmeier, J.; Shih, C.; Ehrhardt, D.; Grossman, A.; Apt, K. Trophic conversion of an obligate photoautotrophic organism through metabolic engineering. Science 2001, 292, 2073–2075. [Google Scholar] [CrossRef]
- Morales-Sánchez, D.; Martinez-Rodriguez, O.A.; Kyndt, J.; Martinez, A. Heterotrophic growth of microalgae: Metabolic aspects. World J. Microbiol. Biotechnol. 2015, 31, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Fantino, E.; Awwad, F.; Merindol, N.; Garza, A.M.D.; Gélinas, S.-E.; Robles, G.C.G.; Custeau, A.; Meddeb-Mouelhi, F.; Desgagné-Penix, I. Bioengineering Phaeodactylum tricornutum, a marine diatom, for cannabinoid biosynthesis. Algal Res. 2024, 77, 103379. [Google Scholar] [CrossRef]
- Macdonald Miller, S.A. Screening, Mutagenesis and Gene Expression Analysis for Improving Fucoxanthin Biosynthesis in the Marine Diatom Phaeodactylum tricornutum. Ph.D. Thesis, University of Technology Sydney, Sydney, Australia, 2023. [Google Scholar]
- Wang, C.; Zhang, H.; Wang, J.; Sprecher, B.; Lin, S. Glyphosate (Roundup) as phosphorus nutrient enhances carbon and nitrogen accumulation and up-regulates phosphorus metabolisms in the haptophyte Isochrysis galbana. Sci. Total Environ. 2024, 913, 169715. [Google Scholar] [CrossRef] [PubMed]
- Liqun, J.I.N.; Xiaohan, L.I.; Beibei, Z.; Zhiqiang, L.I.U.; Yuguo, Z. Organic acid transporters in microorganisms. Acta Microbiol. Sin. 2023, 63, 3386–3408. [Google Scholar]
- Giovanardi, M.; Baldisserotto, C.; Ferroni, L.; Longoni, P.; Cella, R.; Pancaldi, S. Growth and lipid synthesis promotion in mixotrophic Neochloris oleoabundans (Chlorophyta) cultivated with glucose. Protoplasma 2014, 251, 115–125. [Google Scholar] [CrossRef] [PubMed]
- Ip, P.-F.; Wong, K.-H.; Chen, F. Enhanced production of astaxanthin by the green microalga Chlorella zofingiensis in mixotrophic culture. Process Biochem. 2004, 39, 1761–1766. [Google Scholar] [CrossRef]
- Peng, S.; Cao, Y.; Xie, Z.; Zhang, X.; Ma, S.; Kong, W. Effects of sodium acetate and ammonium acetate on the growth and production of cellular components of Chlorella vulgaris 31. J. Appl. Phycol. 2024, 36, 1–14. [Google Scholar] [CrossRef]
- Kindle, K.L. Expression of a gene for a light-harvesting chlorophyll a/b-binding protein in Chlamydomonas reinhardtii: Effect of light and acetate. Plant Mol. Biol. 1987, 9, 547–563. [Google Scholar] [CrossRef] [PubMed]
- Qiao, H.; Wang, G.; Liu, K.; Gu, W. Short-term effects of acetate and microaerobic conditions on photosynthesis and respiration in Chlorella sorokiniana GXNN 01 (Chlorophyta). J. Phycol. 2012, 48, 992–1001. [Google Scholar] [CrossRef]
- Lemaire, S.D.; Guillon, B.; Le Maréchal, P.; Keryer, E.; Miginiac-Maslow, M.; Decottignies, P. New thioredoxin targets in the unicellular photosynthetic eukaryote Chlamydomonas reinhardtii. Proc. Natl. Acad. Sci. USA 2004, 101, 7475–7480. [Google Scholar] [CrossRef]
- Kovács, L.; Wiessner, W.; Kis, M.; Nagy, F.; Mende, D.; Demeter, S. Short-and long-term redox regulation of photosynthetic light energy distribution and photosystem stoichiometry by acetate metabolism in the green alga, Chlamydobotrys stellata. Photosynth. Res. 2000, 65, 231–247. [Google Scholar] [CrossRef] [PubMed]
- Huang, P.-L.; Li, L.; Li, J.-J.; Li, X.-Y. Effects of S-metolachlor on photosynthetic characteristics of Microcystis flos-aquae. Res. J. Environ. Sci. 2020, 33, 1885–1893. [Google Scholar]
- Kitano, M.; Matsukawa, R.; Karube, I. Changes in eicosapentaenoic acid content of Navicula saprophila, Rhodomonas salina and Nitzschia sp. under mixotrophic conditions. J. Appl. Phycol. 1997, 9, 559–563. [Google Scholar]
- Abida, H.; Dolch, L.-J.; Meï, C.; Villanova, V.; Conte, M.; Block, M.A.; Finazzi, G.; Bastien, O.; Tirichine, L.; Bowler, C. Membrane glycerolipid remodeling triggered by nitrogen and phosphorus starvation in Phaeodactylum tricornutum. Plant Physiol. 2015, 167, 118–136. [Google Scholar] [CrossRef]
- Schnurr, J.A.; Shockey, J.M.; de Boer, G.-J.; Browse, J.A. Fatty acid export from the chloroplast. Molecular characterization of a major plastidial acyl-coenzyme A synthetase from Arabidopsis. Plant Physiol. 2002, 129, 1700–1709. [Google Scholar] [CrossRef] [PubMed]
- Li-Beisson, Y.; Thelen, J.J.; Fedosejevs, E.; Harwood, J.L. The lipid biochemistry of eukaryotic algae. Prog. Lipid Res. 2019, 74, 31–68. [Google Scholar] [CrossRef] [PubMed]
- Smith, R.; Jouhet, J.; Gandini, C.; Nekrasov, V.; Marechal, E.; Napier, J.A.; Sayanova, O. Plastidial acyl carrier protein Δ9-desaturase modulates eicosapentaenoic acid biosynthesis and triacylglycerol accumulation in Phaeodactylum tricornutum. Plant J. 2021, 106, 1247–1259. [Google Scholar] [CrossRef] [PubMed]
- Guschina, I.A.; Harwood, J.L. Lipids and lipid metabolism in eukaryotic algae. Prog. Lipid Res. 2006, 45, 160–186. [Google Scholar] [CrossRef] [PubMed]
- Mendoza Guzmán, H.; de la Jara Valido, A.; Carmona Duarte, L.; Freijanes Presmanes, K. Analysis of interspecific variation in relative fatty acid composition: Use of flow cytometry to estimate unsaturation index and relative polyunsaturated fatty acid content in microalgae. J. Appl. Phycol. 2011, 23, 7–15. [Google Scholar] [CrossRef]
- Mendoza Guzmán, H.; de la Jara Valido, A.; Freijanes Presmanes, K.; Carmona Duarte, L. Quick estimation of intraspecific variation of fatty acid composition in Dunaliella salina using flow cytometry and Nile Red. J. Appl. Phycol. 2012, 24, 1237–1243. [Google Scholar] [CrossRef]
- Roessler, P.G. Environmental control of glycerolipid metabolism in microalgae: Commercial implications and future research directions. J. Phycol. 1990, 26, 393–399. [Google Scholar] [CrossRef]






| Primer | Sequence (5′-3′) |
|---|---|
| ADY2-PCR-F | CATGCATGCTCTCGTTATTAGTAGGTCGTGC |
| ADY2-PCR-R | CGCGGATCCGTTGGATCGTATTTCCCTGAG |
| Strains | Initial COD (mg L−1) | Final COD (mg L−1) | COD Removal Rate (%) |
|---|---|---|---|
| WT | 180.58 ± 8.21 | 24.86 ± 1.23 a | 86.23 ± 0.25 a |
| ADY2-4 | 180.58 ± 8.21 | 17.51 ± 1.25 b | 90.30 ± 0.27 b |
| Fatty Acids | Groups | |||
|---|---|---|---|---|
| WT-0M | ADY2-4-0M | WT-0.01M | ADY2-4-0.01M | |
| C14:0 | 8.92 ± 0.28 a | 7.69 ± 0.32 b | 7.69 ± 0.12 b | 6.17 ± 0.16 c |
| C16:0 | 11.97 ± 0.75 a | 14.63 ± 0.29 b | 23.64 ± 1.05 c | 22.76 ± 0.37 c |
| C16:1n-7 | 16.01 ± 0.56 a | 20.50 ± 0.54 b | 28.17 ± 1.95 c | 33.82 ± 0.76 d |
| C18:1n-9 | 9.33 ± 0.13 a | 8.17 ± 0.20 b | 9.41 ± 0.33 a | 6.58 ± 0.12 c |
| EPA | 27.19 ± 0.65 a | 24.42 ± 0.25 b | 13.41 ± 0.33 c | 12.59 ± 0.45 c |
| C16:4 | 3.00 ± 0.25 a | 3.53 ± 0.15 b | 1.40 ± 0.10 c | 1.25 ± 0.09 c |
| C18:0 | 0.56 ± 0.09 a | 0.55 ± 0.02 a | 1.44 ± 0.19 b | 0.82 ± 0.03 a |
| C18:1n-7 | 0.55 ± 0.02 a | 0.81 ± 0.03 b | 1.19 ± 0.08 c | 2.17 ± 0.14 d |
| C18:2n-6 | 2.91 ± 0.04 a | 2.15 ± 0.18 b | 1.22 ± 0.05 c | 1.35 ± 0.06 c |
| C20:3n-3 | 1.79 ± 0.15 a | 1.36 ± 0.02 b | 1.02 ± 0.06 c | 0.05 ± 0.00 d |
| C20:4n-3 | 1.06 ± 0.05 a | 0.50 ± 0.11 b | 0.33 ± 0.03 b | 0.44 ± 0.02 b |
| C24:0 | 1.51 ± 0.11 a | 1.53 ± 0.03 a | 0.89 ± 0.06 b | 0.84 ± 0.02 b |
| Minor FAs * | 2.39 ± 0.04 a | 2.52 ± 0.03 a | 2.66 ± 0.40 a | 1.81 ± 0.06 b |
| UI | 200.59 ± 3.51 a | 188.80 ± 0.92 b | 129.36 ± 2.32 c | 124.20 ± 2.73 c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, P.; Ma, N.; Dong, S.; Qiao, H.; Zhang, J.; Guan, B.; Tong, S.; Zhao, Y. Enhancing Acetate Utilization in Phaeodactylum tricornutum through the Introduction of Acetate Transport Protein. Biomolecules 2024, 14, 822. https://doi.org/10.3390/biom14070822
Song P, Ma N, Dong S, Qiao H, Zhang J, Guan B, Tong S, Zhao Y. Enhancing Acetate Utilization in Phaeodactylum tricornutum through the Introduction of Acetate Transport Protein. Biomolecules. 2024; 14(7):822. https://doi.org/10.3390/biom14070822
Chicago/Turabian StyleSong, Pu, Ning Ma, Shaokun Dong, Hongjin Qiao, Jumei Zhang, Bo Guan, Shanying Tong, and Yancui Zhao. 2024. "Enhancing Acetate Utilization in Phaeodactylum tricornutum through the Introduction of Acetate Transport Protein" Biomolecules 14, no. 7: 822. https://doi.org/10.3390/biom14070822
APA StyleSong, P., Ma, N., Dong, S., Qiao, H., Zhang, J., Guan, B., Tong, S., & Zhao, Y. (2024). Enhancing Acetate Utilization in Phaeodactylum tricornutum through the Introduction of Acetate Transport Protein. Biomolecules, 14(7), 822. https://doi.org/10.3390/biom14070822

