Identification and Characterization of C-Mos in Pearl Mussel Hyriopsis cumingii and Its Role in Gonadal Development
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Material and Sample Collection
2.2. Obtaining RNA and cDNA
2.3. The Full-Length Cloning of C-Mos and Its Sequence Analysis
2.4. Quantitative Real-Time PCR
2.5. Preparation of Paraffin Sections and In Situ Hybridization (ISH)
2.6. RNAi Assay
2.7. Statistical Analysis
3. Results
3.1. Full-Length and Sequence Characteristics of the cDNA of C-Mos
3.2. Expression Analysis of C-Mos in Different Tissues of the H. cumingii
3.3. Analysis of C-Mos Expression at Different Ages in the H. cumingii
3.4. Analysis of C-Mos Relative Expression during the Juvenile Period of the H. cumingii
3.5. Localization of the C-Mos
3.6. RNAi of C-Mos
3.7. Expression Analysis of ERK and P90rsk after RNAi
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sun, Y.; Liu, W.-Z.; Liu, T.; Feng, X.; Yang, N.; Zhou, H.-F. Signaling Pathway of MAPK/ERK in Cell Proliferation, Differentiation, Migration, Senescence and Apoptosis. J. Recept. Signal Transduct. 2015, 35, 600–604. [Google Scholar] [CrossRef] [PubMed]
- Shaul, Y.D.; Seger, R. The MEK/ERK Cascade: From Signaling Specificity to Diverse Functions. Biochim. Biophys. Acta BBA—Mol. Cell Res. 2007, 1773, 1213–1226. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Shibuya, E.K.; Boulton, T.G.; Cobb, M.H.; Ruderman, J.V. Activation of P42 MAP Kinase and the Release of Oocytes from Cell Cycle Arrest. EMBO J. 1992, 11, 3963–3975. [Google Scholar] [CrossRef]
- Tachibana, K. MAP Kinase Links the Fertilization Signal Transduction Pathway to the G1/S-Phase Transition in Starfish Eggs. EMBO J. 1997, 16, 4333–4339. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Liang, C.-G.; Su, Y.-Q.; Fan, H.-Y.; Schatten, H.; Sun, Q.-Y. Mechanisms Regulating Oocyte Meiotic Resumption: Roles of Mitogen-Activated Protein Kinase. Mol. Endocrinol. 2007, 21, 2037–2055. [Google Scholar] [CrossRef]
- Kondoh, E.; Tachibana, K.; Deguchi, R. Intracellular Ca2+ Increase Induces Post-Fertilization Events via MAP Kinase Dephosphorylation in Eggs of the Hydrozoan Jellyfish Cladonema pacificum. Dev. Biol. 2006, 293, 228–241. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Gould, M.C.; Stephano, J.L. MAP Kinase, Meiosis, and Sperm Centrosome Suppression in Urechis caupo. Dev. Biol. 1999, 216, 348–358. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Almog, T.; Naor, Z. The Role of Mitogen Activated Protein Kinase (MAPK) in Sperm Functions. Mol. Cell. Endocrinol. 2010, 314, 239–243. [Google Scholar] [CrossRef]
- Bogani, D.; Siggers, P.; Brixey, R.; Warr, N.; Beddow, S.; Edwards, J.; Williams, D.; Wilhelm, D.; Koopman, P.; Flavell, R.A.; et al. Loss of Mitogen-Activated Protein Kinase Kinase Kinase 4 (MAP3K4) Reveals a Requirement for MAPK Signalling in Mouse Sex Determination. PLoS Biol. 2009, 7, e1000196. [Google Scholar] [CrossRef][Green Version]
- Matsuyama, M.; Mizusaki, H.; Shimono, A.; Mukai, T.; Okumura, K.; Abe, K.; Shimada, K.; Morohashi, K. A Novel Isoform of Vinexin, Vinexin γ, Regulates Sox9 Gene Expression through Activation of MAPK Cascade in Mouse Fetal Gonad: Vinexin in Gonadal Sex Differentiation. Genes Cells 2005, 10, 421–434. [Google Scholar] [CrossRef][Green Version]
- Matsubara, Y.; Kawasaki, I.; Urushiyama, S.; Yasuda, T.; Shirakata, M.; Iino, Y.; Shibuya, H.; Yamanashi, Y. The Adaptor-like Protein ROG-1 Is Required for Activation of the Ras-MAP Kinase Pathway and Meiotic Cell Cycle Progression in Caenorhabditis elegans. Genes Cells 2007, 12, 407–420. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.-H.; Ohmachi, M.; Arur, S.; Nayak, S.; Francis, R.; Church, D.; Lambie, E.; Schedl, T. Multiple Functions and Dynamic Activation of MPK-1 Extracellular Signal-Regulated Kinase Signaling in Caenorhabditis elegans Germline Development. Genetics 2007, 177, 2039–2062. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Masui, Y. From Oocyte Maturation to the in Vitro Cell Cycle: The History of Discoveries of Maturation-Promoting Factor (MPF) and Cytostatic Factor (CSF). Differentiation 2001, 69, 1–17. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Gotoh, Y.; Nishida, E. Activation Mechanism and Function of the MAP Kinase Cascade. Mol. Reprod. Dev. 1995, 42, 486–492. [Google Scholar] [CrossRef]
- Valencia, C.; Pérez, F.A.; Matus, C.; Felmer, R.; Arias, M.E. Activation of Bovine Oocytes by Protein Synthesis Inhibitors: New Findings on the Role of MPF/MAPKs. Biol. Reprod. 2021, 104, 1126–1138. [Google Scholar] [CrossRef]
- Gebauer, F.; Richter, J.D. Synthesis and Function of Mos: The Control Switch of Vertebrate Oocyte Meiosis. Bioessays 1997, 19, 23–28. [Google Scholar] [CrossRef]
- Sagata, N.; Daar, I.; Oskarsson, M.; Showalter, S.D.; Vande Woude, G.F. The Product of the Mos Proto-Oncogene as a Candidate “Initiator” for Oocyte Maturation. Science 1989, 245, 643–646. [Google Scholar] [CrossRef]
- Cao, S.-F.; Li, D.; Yuan, Q.; Guan, X.; Xu, C. Spatial and Temporal Expression of C-Mos in Mouse Testis during Postnatal Development. Asian J. Androl. 2008, 10, 277–285. [Google Scholar] [CrossRef]
- Funayama, S.; Matsumoto, T.; Kodera, Y.; Awaji, M. A Novel Peptide Identified from Visceral Ganglia Induces Oocyte Maturation, Spermatozoa Active Motility, and Spawning in the Pen Shell Atrina pectinata. Biochem. Biophys. Res. Commun. 2022, 598, 9–14. [Google Scholar] [CrossRef]
- Sinha, P.B.; Tesfaye, D.; Rings, F.; Hossien, M.; Hoelker, M.; Held, E.; Neuhoff, C.; Tholen, E.; Schellander, K.; Salilew-Wondim, D. MicroRNA-130b Is Involved in Bovine Granulosa and Cumulus Cells Function, Oocyte Maturation and Blastocyst Formation. J. Ovarian Res. 2017, 10, 37. [Google Scholar] [CrossRef][Green Version]
- Wu, X.-J.; Thomas, P.; Zhu, Y. Pgrmc1 Knockout Impairs Oocyte Maturation in Zebrafish. Front. Endocrinol. 2018, 9, 560. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Quiroga Artigas, G.; Lapébie, P.; Leclère, L.; Bauknecht, P.; Uveira, J.; Chevalier, S.; Jékely, G.; Momose, T.; Houliston, E. A G Protein–Coupled Receptor Mediates Neuropeptide-Induced Oocyte Maturation in the Jellyfish Clytia. PLoS Biol. 2020, 18, e3000614. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Masui, Y. 8—Meiotic Arrest in Animal Oocytes. In Biology of Fertilization; Metz, C.B., Monroy, A., Eds.; Academic Press: Cambridge, MA, USA, 1985; pp. 189–219. ISBN 978-0-12-492601-1. [Google Scholar]
- Masui, Y. A Cytostatic Factor in Amphibian Oocytes: Its Extraction and Partial Characterization. J. Exp. Zool. 1974, 187, 141–147. [Google Scholar] [CrossRef] [PubMed]
- Sagata, N.; Watanabe, N.; Vande Woude, G.F.; Ikawa, Y. The C-Mos Proto-Oncogene Product Is a Cytostatic Factor Responsible for Meiotic Arrest in Vertebrate Eggs. Nature 1989, 342, 512–518. [Google Scholar] [CrossRef]
- Kajiura-Kobayashi, H.; Yoshida, N.; Sagata, N.; Yamashita, M.; Nagahama, Y. The Mos/MAPK Pathway Is Involved in Metaphase II Arrest as a Cytostatic Factor but Is Neither Necessary nor Sufficient for Initiating Oocyte Maturation in Goldfish. Dev. Genes Evol. 2000, 210, 416–425. [Google Scholar] [CrossRef]
- Yamamoto, D.S.; Tachibana, K.; Sumitani, M.; Lee, J.M.; Hatakeyama, M. Involvement of Mos–MEK–MAPK Pathway in Cytostatic Factor (CSF) Arrest in Eggs of the Parthenogenetic Insect, Athalia rosae. Mech. Dev. 2008, 125, 996–1008. [Google Scholar] [CrossRef]
- Collin, R. Phylogenetic Patterns and Phenotypic Plasticity of Molluscan Sexual Systems. Integr. Comp. Biol. 2013, 53, 723–735. [Google Scholar] [CrossRef][Green Version]
- Otani, A.; Nakajima, T.; Okumura, T.; Fujii, S.; Tomooka, Y. Sex Reversal and Analyses of Possible Involvement of Sex Steroids in Scallop Gonadal Development in Newly Established Organ-Culture Systems. Zool. Sci. 2017, 34, 86. [Google Scholar] [CrossRef]
- Zhao, Y.; Bai, Z.; Fu, L.; Liu, Y.; Wang, G.; Li, J. Comparison of Growth and Pearl Production in Males and Females of the Freshwater Mussel, Hyriopsis cumingii, in China. Aquacult. Int. 2013, 21, 1301–1310. [Google Scholar] [CrossRef]
- Gu, Y.; Liu, M.; Wang, Y.; Huo, Y.; Liu, Z.; Jin, W.; Wang, G. Identification and Functional Analysis of MAPKAPK2 in Hyriopsis cumingii. Genes 2022, 13, 2060. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, X.; Ge, J.; Wang, G.; Li, J. Identification and Functional Analysis of the Sex-Determiner Transformer-2 Homologue in the Freshwater Pearl Mussel, Hyriopsis cumingii. Front. Physiol. 2021, 12, 704548. [Google Scholar] [CrossRef] [PubMed]
- Qu, Y.; Zhou, M.; Peng, L.; Li, J.; Yan, J.; Yang, P.; Feng, H. Molecular Cloning and Characterization of IKKε Gene from Black Carp Mylopharyngodon Piceus. Fish Shellfish. Immunol. 2015, 47, 122–129. [Google Scholar] [CrossRef] [PubMed]
- Li, H.-H.; Kong, L.-F.; Yu, R.; Yu, H.; Li, Q. Characterization, Expression, and Functional Analysis of Testis-Specific Serine/Threonine Kinase 1 (Tssk1) in the Pen Shell Atrina pectinata. Invertebr. Reprod. Dev. 2016, 60, 118–125. [Google Scholar] [CrossRef]
- Zhang, G.; Song, C.; Zhao, M.-M.; Li, B.; Guo, S.-X. Characterization of an A-Type Cyclin-Dependent Kinase Gene from Dendrobium candidum. Biologia 2012, 67, 360–368. [Google Scholar] [CrossRef]
- Propst, F.; Rosenberg, M.P.; Iyer, A.; Kaul, K.; Vande Woude, G.F. C-Mos Proto-Oncogene RNA Transcripts in Mouse Tissues: Structural Features, Developmental Regulation, and Localization in Specific Cell Types. Mol. Cell. Biol. 1987, 7, 1629–1637. [Google Scholar] [CrossRef]
- Amiel, A.; Leclère, L.; Robert, L.; Chevalier, S.; Houliston, E. Conserved Functions for Mos in Eumetazoan Oocyte Maturation Revealed by Studies in a Cnidarian. Curr. Biol. 2009, 19, 305–311. [Google Scholar] [CrossRef][Green Version]
- Zhang, Y.-L.; Zheng, W.; Ren, P.; Hu, H.; Tong, X.; Zhang, S.-P.; Li, X.; Wang, H.; Jiang, J.-C.; Jin, J.; et al. Biallelic Mutations in MOS Cause Female Infertility Characterized by Human Early Embryonic Arrest and Fragmentation. EMBO Mol. Med. 2021, 13, e14887. [Google Scholar] [CrossRef]
- Fan, H.-Y.; Sun, Q.-Y. Involvement of Mitogen-Activated Protein Kinase Cascade during Oocyte Maturation and Fertilization in Mammals. Biol. Reprod. 2004, 70, 535–547. [Google Scholar] [CrossRef]
- Cao, L.-R.; Jiang, J.-C.; Fan, H.-Y. Positive Feedback Stimulation of Ccnb1 and Mos MRNA Translation by MAPK Cascade during Mouse Oocyte Maturation. Front. Cell Dev. Biol. 2020, 8, 609430. [Google Scholar] [CrossRef]
- Wang, Y.; Wu, C.; Guo, P.; Wang, G.; Li, J. Molecular Characterization and Expression of the Feminization-1c (Fem-1c) in the Freshwater Mussel (Hyriopsis cumingii). Aquac. Fish. 2018, 3, 6–13. [Google Scholar] [CrossRef]
- Ferrara, D.; Palmiero, C.; Branno, M.; Pierantoni, R.; Minucci, S. Testicular Activity of Mos in the Frog, Rana Esculenta: A New Role in Spermatogonial Proliferation. Biol. Reprod. 2004, 70, 1782–1789. [Google Scholar] [CrossRef] [PubMed]
- Feng, K.; Cui, X.; Song, Y.; Tao, B.; Chen, J.; Wang, J.; Liu, S.; Sun, Y.; Zhu, Z.; Trudeau, V.L.; et al. Gnrh3 Regulates PGC Proliferation and Sex Differentiation in Developing Zebrafish. Endocrinology 2020, 161, bqz024. [Google Scholar] [CrossRef] [PubMed]
- Paronetto, M.P.; Giorda, E.; Carsetti, R.; Rossi, P.; Geremia, R.; Sette, C. Functional Interaction between P90Rsk2 and Emi1 Contributes to the Metaphase Arrest of Mouse Oocytes. EMBO J. 2004, 23, 4649–4659. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Richter, J.D.; Lasko, P. Translational Control in Oocyte Development. Cold Spring Harb. Perspect. Biol. 2011, 3, a002758. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Horie, M.; Kotani, T. Formation of Mos RNA Granules in the Zebrafish Oocyte That Differ from Cyclin B1 RNA Granules in Distribution, Density and Regulation. Eur. J. Cell Biol. 2016, 95, 563–573. [Google Scholar] [CrossRef]
- Tachibana, K.; Tanaka, D.; Isobe, T.; Kishimoto, T. C-Mos Forces the Mitotic Cell Cycle to Undergo Meiosis II to Produce Haploid Gametes. Proc. Natl. Acad. Sci. USA 2000, 97, 14301–14306. [Google Scholar] [CrossRef][Green Version]
- Arur, S. Signaling-Mediated Regulation of Meiotic Prophase I and Transition during Oogenesis. In Signaling-Mediated Control of Cell Division; Springer: Cham, Switzerland, 2017; pp. 101–123. [Google Scholar] [CrossRef][Green Version]
- Sorrenti, M.; Klinger, F.G.; Iona, S.; Rossi, V.; Marcozzi, S.; De Felici, M. Expression and Possible Roles of Extracellular Signal-Related Kinases 1-2 (ERK1-2) in Mouse Primordial Germ Cell Development. J. Reprod. Dev. 2020, 66, 399–409. [Google Scholar] [CrossRef]
- Nishiyama, T.; Ohsumi, K.; Kishimoto, T. Phosphorylation of Erp1 by P90rsk Is Required for Cytostatic Factor Arrest in Xenopus laevis Eggs. Nature 2007, 446, 1096–1099. [Google Scholar] [CrossRef]
- Inoue, D.; Ohe, M.; Kanemori, Y.; Nobui, T.; Sagata, N. A Direct Link of the Mos–MAPK Pathway to Erp1/Emi2 in Meiotic Arrest of Xenopus laevis Eggs. Nature 2007, 446, 1100–1104. [Google Scholar] [CrossRef]
- Gross, S.D.; Schwab, M.S.; Taieb, F.E.; Lewellyn, A.L.; Qian, Y.-W.; Maller, J.L. The Critical Role of the MAP Kinase Pathway in Meiosis II in Xenopus Oocytes Is Mediated by P90Rsk. Curr. Biol. 2000, 10, 430–438. [Google Scholar] [CrossRef][Green Version]
- Bhatt, R.R.; Ferrell, J.E. The Protein Kinase P90 Rsk as an Essential Mediator of Cytostatic Factor Activity. Science 1999, 286, 1362–1365. [Google Scholar] [CrossRef] [PubMed]
- Fan, H.-Y.; Tong, C.; Lian, L.; Li, S.-W.; Gao, W.-X.; Cheng, Y.; Chen, D.-Y.; Schatten, H.; Sun, Q.-Y. Characterization of Ribosomal S6 Protein Kinase P90rsk during Meiotic Maturation and Fertilization in Pig Oocytes: Mitogen-Activated Protein Kinase-Associated Activation and Localization1. Biol. Reprod. 2003, 68, 968–977. [Google Scholar] [CrossRef] [PubMed]
- Mori, M.; Hara, M.; Tachibana, K.; Kishimoto, T. P90Rsk Is Required for G1 Phase Arrest in Unfertilized Starfish Eggs. Development 2006, 133, 1823–1830. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Dumont, J.; Umbhauer, M.; Rassinier, P.; Hanauer, A.; Verlhac, M.-H. P90Rsk Is Not Involved in Cytostatic Factor Arrest in Mouse Oocytes. J. Cell Biol. 2005, 169, 227–231. [Google Scholar] [CrossRef] [PubMed][Green Version]
Primer Name | Sequence (5′ to 3′) | Application |
---|---|---|
M-OUTER | CACCATGTCTAAATCCGGCCCTGTCT | 3′RACE |
M-INNER | CAGAAGTTGAACGCAGGGCCAGATTT | 3′RACE |
qPCR-Mos-F | AGTATGAACGAACATCGGAGG | qRT-PCR |
qPCR-Mos-R | TGAGAACATCCAAAGTCGCC | qRT-PCR |
qPCR-P90rsk-F | GGTCCTATGGCGTGCTAATG | qRT-PCR |
qPCR-P90rsk-R | GATTCTTCCAGTCTATGCTTGC | qRT-PCR |
qPCR-ERK -F | AGAATCACGGTAGAAGAGGCT | qRT-PCR |
qPCR-ERK-R | TTCCTGTCCATTGGTTGTGT | qRT-PCR |
qPCR-EFl-αF | GGAACTTCCCAGGCAGACTGTGC | qRT-PCR |
qPCR-EFl-αR | TCAAAACGGGCCGCAGAGAAT | qRT-PCR |
ISH-MOS-F | TACATACGCCTACCGTGCCC | ISH |
T7 + ISH-MOS-R | TAATACGACTCACTATAGGGGTCCCATACGCAACAACCC | ISH |
T7 + RNAi-MOS-F1 | TAATACGACTCACTATAGGGAGGCTGTGTTTTTGCTCTGA | RNAi |
T7 + RNAi-MOS-R1 | TAATACGACTCACTATAGGGGCCGCTGGATTTTTCGTAA | RNAi |
T7 + RNAi-MOS-F2 | TAATACGACTCACTATAGGGACTTGGCGACTTTGGATGT | RNAi |
T7 + RNAi-MOS-R2 | TAATACGACTCACTATAGGGCGTTTCAGTTACCGTAGGCA | RNAi |
T7 + RNAi-MOS-F3 | TAATACGACTCACTATAGGGACTGTGAGTCCCACTGAAAGAT | RNAi |
T7 + RNAi-MOS-R3 | TAATACGACTCACTATAGGGACTAAGACAGCCAAGGTTTCC | RNAi |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Z.; Jin, X.; Miao, Y.; Wang, P.; Gu, Y.; Shangguan, X.; Chen, L.; Wang, G. Identification and Characterization of C-Mos in Pearl Mussel Hyriopsis cumingii and Its Role in Gonadal Development. Biomolecules 2023, 13, 931. https://doi.org/10.3390/biom13060931
Liu Z, Jin X, Miao Y, Wang P, Gu Y, Shangguan X, Chen L, Wang G. Identification and Characterization of C-Mos in Pearl Mussel Hyriopsis cumingii and Its Role in Gonadal Development. Biomolecules. 2023; 13(6):931. https://doi.org/10.3390/biom13060931
Chicago/Turabian StyleLiu, Zongyu, Xin Jin, Yulin Miao, Ping Wang, Yang Gu, Xiaozhao Shangguan, Lijing Chen, and Guiling Wang. 2023. "Identification and Characterization of C-Mos in Pearl Mussel Hyriopsis cumingii and Its Role in Gonadal Development" Biomolecules 13, no. 6: 931. https://doi.org/10.3390/biom13060931
APA StyleLiu, Z., Jin, X., Miao, Y., Wang, P., Gu, Y., Shangguan, X., Chen, L., & Wang, G. (2023). Identification and Characterization of C-Mos in Pearl Mussel Hyriopsis cumingii and Its Role in Gonadal Development. Biomolecules, 13(6), 931. https://doi.org/10.3390/biom13060931