Next Article in Journal
Functional Analyses of Three Targeted DNA Antimicrobial Peptides Derived from Goats
Previous Article in Journal
Exploring the Potential Link between Acute Central Serous Chorioretinopathy and Trimethylamine N-Oxide, Phoenixin, Spexin, and Alarin Molecules
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomolecules
Volume 13
Issue 10
10.3390/biom13101456
biomolecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Crustacean Female Sex Hormone Receptor Involved in Sexual Differentiation of a Hermaphroditic Shrimp

by
Fang Liu
,
An Liu
and
Haihui Ye
*
Fisheries College, Jimei University, Xiamen 361021, China
*
Author to whom correspondence should be addressed.
Biomolecules 2023, 13(10), 1456; https://doi.org/10.3390/biom13101456
Submission received: 21 August 2023 / Revised: 22 September 2023 / Accepted: 25 September 2023 / Published: 27 September 2023
(This article belongs to the Section Biomacromolecules: Proteins)
Browse Figures
Review Reports Versions Notes

Abstract

:
The neurohormone crustacean female sex hormone (CFSH) contains a highly conserved interleukin-17 (IL-17) domain in the mature peptide. Although CFSH has been demonstrated to stimulate female sexual differentiation in crustaceans, its receptors (CFSHR) have been poorly reported. The present study identified an IL-17 receptor (named Lvit-IL-17R), a candidate of CFSHR, from the protandric simultaneous hermaphroditic (PSH) shrimp Lysmata vittata through GST pulldown assays and RNAi experiments. Lvit-IL-17R is a transmembrane protein with an SEFIR (similar expression as the fibroblast growth factor and IL-17R) domain, as determined through sequence analysis. A GST pulldown experiment confirmed the interactions between the type I CFSHs (CFSH1a and CFSH1b) and Lvit-IL-17R. Meanwhile, the RNAi results revealed that Lvit-IL-17R displays similar functions to type I CFSHs in regulating sexual differentiation and gonad development. In brief, Lvit-IL-17R is a potential receptor for type I CFSHs aimed at regulating the sexual differentiation of the PSH species. This study helps shed new light on the mechanism of sexual differentiation among crustaceans.

Graphical Abstract

1. Introduction

The sexual systems in decapod crustaceans are diverse [1,2]. Most species exist as functional females or males throughout their lives [1]. In rare cases, some crustaceans may transform into an intersex form under the effect of parasitic infections, abnormal environmental sex determination, genetic abnormity, and pollution [3]. Notably, some or all Caridean species are naturally intersex [1]. These intersex species first mature as males with ovotestis containing both testicular and ovarian morphologies [2,4,5] and can be classified into two types.
In species that undergo complete sex reversal (e.g., strictly sequential protandric hermaphroditism, or SPH), female germ cells are located on the inner side of the ovotestis and are surrounded by male germ cells. As the female germ cells mature, testicular morphologies completely degenerate, and the ovotestis transforms into an ovary [4,5]. In species that eventually possess both male and female reproductive functions (e.g., protandric simultaneous hermaphroditism or PSH), a relatively obvious boundary divides ovotestis into the ovarian region on the anterior sides and the testicular region on the posterior sides (in the dorsal view). Additionally, the testicular region partially degrades as the ovarian regions mature [2,6,7].
The insulin-like androgenic gland hormone (IAG) and crustacean female sex hormone (CFSH) regulate sexual differentiation in both dioecious and hermaphroditic species [8,9,10,11]. IAG, also known as androgenic gland hormone (AGH), is an insulin-like peptide that was first identified in the androgenic gland (AG) of woodlice (Armadillidium vulgare) [12,13]. In decapod crustaceans, IAG was first reported by Manor et al. in 2007 [14]. As silencing IAG expression could ubiquitously block spermatogenesis and/or the development of male secondary sexual phenotypes in decapod crustaceans, IAG is also known as the sexual “IAG-switch” [9,11,15,16,17]. Recent studies have reported that IAG regulates male sexual differentiation via IAG receptors, whose structures resemble insulin-like receptors [18,19,20,21].
On the other hand, CFSH is a neurohormone that was first identified in Atlantic blue crabs (Callinectes sapidus) [22]. This hormone regulates the development of female secondary sexual phenotypes, as demonstrated in Atlantic blue crabs (C. sapidus), Chinese mitten crabs (Eriocheir sinensis) and peppermint shrimps (Lysmata vittata) [10,22,23]. With the rapid advancement in sequencing technology, CFSH transcripts have been identified in various species [24,25,26,27,28,29,30]. Based on the amino acid sequence of deduced mature peptides, two CFSH homologs have been isolated and characterized [27,30]. The type I CFSH possesses eight conserved Cysteine residues and a single conserved N-glycosylation motif (Asn-Xaa-Ser/Thr) in the N-terminal regions. The type II CFSH contains nine or ten cysteine residues, with no N-glycosylation motif [28,29]. Furthermore, a conserved interleukin-17 (IL-17) domain is present in both CFSHs types [27,30].
IL-17 is a specific group of cytokines that are crucial in the hosts’ defense against microbial organisms and the development of inflammatory diseases widespread throughout the animal kingdom [31,32,33]. After IL-17 was first identified in purple sea urchins, Strongylocentrotus purpuratus [34,35], this cytokine and its signaling pathways related to specific molecules have been reported in other invertebrates [31,36]. However, IL-17 was not reported in decapod crustaceans until a recent investigation identified IL-17 homologs in Pacific whiteleg shrimps, Penaeus vannamei [31]. When these IL-17 proteins were compared with other identified CFSHs, they were considered as CFSH of the species [30]. Recently, a candidate CFSH receptor was identified in mud crabs, Scylla paramamosain, which have a conversed SEFIR (similar expression as the fibroblast growth factor and IL-17Rs) domain [37]. Thus, it is reasonable to consider that CFSH is indeed an IL-17 homolog in decapod crustaceans, and CFSH receptors may also share similar structures with the IL-17R of other species.
The peppermint shrimp L. vittata is a small caridean species from the genus Lysmata, of which most shrimps are popular ornamental species and display a unique PSH sexual system [2,38]. It is also suggested as a good model organism for PSH shrimps for its impressive reproductive fecundity and short generation time [11]. Previous studies have demonstrated that two type I CFSHs (Lvit-CFSH1a and Lvit-CFSH1b) act in concert in regulating the development of the female external features of the species [10]. Furthermore, because of a regulatory feedback loop between type I CFSH and IAG, CFSHs also inhibit IAG expression to suppress the male sexual differentiation of the PSH species [10]. In the present study, the cDNA of Lvit-IL-17R was cloned to explore expression profiles. A glutathione s-transferase (GST) pulldown assay was employed to detect the interaction between Lvit-CFSH1a/CFSH1b and Lvit-IL-17R. Short-term and long-term silencing experiments were then performed to clarify the functional relevance between Lvit-CFSH1a/CFSH1b and Lvit-IL-17R in the sexual differentiation of the species.

2. Materials and Methods

2.1. Animals

L. vittata were bred in captivity at the Fisheries College of Jimei University maintained at 25–27 °C, a salinity of 30–32 PSU, and a 12 h light/dark cycle. L. vittata were provided with a commercially formulated shrimp diet on a daily basis. The gonadal development stages were defined according to Chen et al. 2019 [6].

2.2. cDNA Cloning of Lvit-IL-17R

TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) was utilized to extract the total RNA from various tissues according to the manufacturer’s protocol. An Lvit-IL-17R fragment was obtained from a transcript library. The 5′ -untranslated region (5′ UTR) was obtained with the SMART TM RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA) according to the manufacturer’s protocol and the rapid amplification of cDNA ends (RACE). Coding sequences (CDS) were verified using a polymerase chain reaction (PCR) with LA-Taq polymerase (TaKaRa, Dalian, China) under standard PCR conditions. The PCR primers are listed in Table A1.

2.3. The qRT-PCR Assays

The primers used for quantitative real-time PCR (qRT-PCR) were either designed with the Beacon Designer 8.21 software or sourced from a previous study [11]. RT-PCR products were sequenced to ensure accuracy. The amplification efficiency of the primer pairs was also tested. qRT-PCR assays were performed with TB Green Premix Ex Taq II (2X) (TaKaRa, Dalian, China) according to the manufacturer’s protocol.

2.4. Expression Profiles of Lvit-IL-17R

Reverse transcription-PCR (RT-PCR) and qRT-PCR were performed to explore the spatial expression features of Lvit-IL-17R.
First, various tissues at gonadal development stage II were dissected to detect the expression profile of Lvit-IL-17R in various tissues. Following total RNA extraction and first-strand cDNA synthesis, RT-PCR was performed with Ex-Taq polymerase (TaKaRa, Dalian, China) under standard PCR conditions. Lvit-β-actin (GenBank accession no. MT114194) was used as a positive control. PCR products were imaged and photographed using the Gel Image System (Tanon 2500B).
qRT-PCR was then performed to detect the temporal expression profiles of Lvit-IL-17R during gonadal development. The androgenic gland (AG), ovarian regions and the hepatopancreas were collected at different developmental stages (n = 4–5). Total RNA extraction and qRT-PCR assays were performed as described earlier.

2.5. GST Pulldown Assays

GST pulldown assays were conducted to detect the interactions between Lvit-CFSH1a/CFSH1b and Lvit-IL-17R. CFSH1a and CFSH1b recombinant proteins were expressed and purified with 6 × His tag as previously described [10]. The recombinant protein of the Lvit-IL-17R extracellular domain (rIL-17R) with 6 × His and GST tags was also purified using the prokaryotic expression system. The Lvit-IL-17R fragment was inserted into the PET-GST vector with EcoR I and Nhe I restriction enzyme sites and was transformed into E. coli TransB (DE3) for prokaryotic expression. After being induced at 16 °C for 20 h (isopropyl-beta-D-thiogalactopyranoside, IPTG, and 0.5 mM final concentration were added), bacterial cells were harvested. The purification of rIL-17R was then conducted using Glutathione Sepharose 4B (Solarbio, Beijing, China) following the established protocol from the supernatant of crude cell extracts. GST (with 6 × His tag) was expressed and purified using the same method as that used on the negative control after transforming the pET-GST vector into DE3.
After reloading rCFSH into the Glutathione Sepharose 4B (Solarbio, Beijing, China), rCFSH1a/rCFSH1b was added and incubated at 4 °C for 1 h. Next, unbound proteins were removed by washing them with 10 mM phosphate-buffered saline (PBS; pH 7.4). One column volume of elution buffer (50 mM Tris-Cl, 10 mM reduced glutathione, and pH 8.0) was added, and the samples were incubated for 10 min. Supernatant-bound proteins were collected through centrifugation and analyzed using SDS-PAGE and Western blotting with anti-His mouse monoclonal antibody.

2.6. Short-Term Silencing Experiment

A knockdown experiment was carried out by injecting double-stranded RNA (dsRNA) into the shrimps. A specific fragment of Lvit-IL-17R was then selected and cloned into a pGEMT-Easy vector. Next, dsRNA was synthesized with T7 and SP6 RNA Polymerase according to the manufacturer’s instructions. Furthermore, the dsRNA of green fluorescent protein (GFP) was synthesized as the negative control.
Synthetic dsRNA was diluted with 10 mM PBS (pH 7.4) prior to injection. Shrimps (carapace length: 3.15 ± 0.17 mm; body weight: 48.65 ± 5.94 mg) at stage I of growth were equally and randomly assigned into three treatment groups (n = 5). They were injected with ds IL-17R (2 μg/g), ds GFP (2 μg/g), or an equal volume of dilution solution (10 mM PBS, pH 7.4). Twenty-four hours post-injection, the shrimps were anesthetized on ice for 5 min.
Samples from the AG, ovarian regions, and hepatopancreas were then collected to examine knockdown efficiency via dsRNA injection. Expression levels related to male sexual differentiation (IAG1, GenBank accession number: MT114196; IAG2, GenBank accession no. MT114197), and ovarian development (vitellogenin (Vg), GenBank accession number: MT113122; vitellogenin receptor (VgR), GenBank accession number: MT114195) were also detected using qRT-PCR.

2.7. Long-Term Silencing Experiment

For the long-term silencing experiment, shrimps (carapace length: 3.01 ± 0.11 mm; body weight: 43.47 ± 4.38 mg) (n = 13) at stage I of growth were treated with ds IL-17R (2 μg/g), ds GFP (2 μg/g), or an equal volume of dilution solution (10 mM PBS; pH 7.4). During the 36-day experimental period, the shrimps were subjected to an injection once every 4 days (10 injections in total). Twenty-four hours after the tenth injection, the shrimps were anesthetized on ice, and the carapace length and body weight of each shrimp were recorded.
Before tissue collection, the gonad and external features of the male and female external features were photographed. Samples of the AG, the ovarian region, and the hepatopancreas were collected to examine the knockdown efficiency and the effects of IL-17R silencing on the expression levels of genes related to sexual differentiation and ovarian development. The parts of gonad tissues (testicular and partial ovarian regions) were fixed in modified Bouin’s Fixative Solution (Phygene, Fuzhou, China) at 4 °C for 24 h. Following the process of gradient alcohol dehydration and paraffin embedding, tissue blocks were sliced into 6 μm sections for hematoxylin and eosin (H & E) staining.

2.8. Bioinformatics and Statistical Analyses

In addition to the qRT-PCR primers, we used Primer 5.0 software to design the other primers in this study. ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/ (accessed on 5 April 2023)) was employed to predict the open reading frame (ORF). SMART (http://smart.embl-heidelberg.de/ (accessed on 5 April 2023)) was used to predict the signal peptides and transmembrane domains. MEGA7 software was used to generate evolutionary trees.
Statistical analyses were conducted using SPSS 18.0 software. All data display a normal distribution, as determined by the Kolmogorov–Smirnov test. The homogeneity of variances was subsequently assessed using Levene’s test. Statistical significance was assessed through the utilization of one-way ANOVA, followed by Tukey’s multiple range tests, with a significance level set at p < 0.05. The F values of one-way ANOVA analysis are shown. All data are represented as mean ± SD.

3. Results

3.1. Sequence Analysis of Lvit-IL-17R

The ORF of Lvit-IL-17R is 1,878 bp (GenBank accession number: MZ367742), which encodes a 625-aa precursor peptide covering a predicted 19-aa signal peptide, a 295-aa extracellular segment, a 23-aa transmembrane region, and a 288-aa intracellular segment (Figure A1). A 98-aa SEFIR domain was predicted in the intracellular regions (Figure A1). Lvit-IL-17R had 37.9% amino acid similarity with the Sp-IL-17R (GenBank accession number: ON787957), with 38.4% amino acid similarity in the SEFIR domain.
A phylogenetic tree was constructed with Lvit-IL-17R, the SEFIR domain-contained proteins of crustaceans, and IL-17Rs from various categories (Figure 1A). Phylogenetic analysis demonstrated that the IL-17Rs from other categories formed five major clades: IL-17RA, IL-17RB, IL-17RC, IL-17RD, and IL-17RE. Additionally, the SEFIR domain-contained proteins of crustaceans formed a unique clade, into which Lvit-IL-17R was classified.

3.2. Phylogenetic Analysis of IL-17 Domain-Contained Proteins from Decapods

After excluding identical amino acid sequences, we obtained 29 proteins from decapods containing the IL-17 domain from the NCBI database. Interestingly, most of these sequences are annotated as “uncharacterized protein”, rather than CFSH (Table A3). By comparing these sequences with the other CFSHs from previous studies [30], a limited number of sequences (GenBank accession nos. XP_042859036.1, XP_027234405.1, XP_027214658.1, XP_042860457.1, XP_042860456.1, XP_027214657.1, XP_027219797.1, XP_050718041.1, XP_042863675.1, and XP_027237919.1) could be annotated as CFSH. In addition, the IL-17 proteins (GenBank accession nos. XP_027214658.1, XP_027234405.1, XP_027214657.1, XP_027219797.1, and XP_027237919.1) from Pacific whiteleg shrimps, P. vannamei, have been identified as CFSH of the species in previous studies (Table A3) [30,31].
A phylogenetic tree was then constructed with the IL-17 domain-contained proteins of crustaceans (CFSH and other sequences) and the IL-17 from other categories (Figure 1B). Phylogenetic analysis demonstrated that the IL-17 domain-contained proteins of crustaceans were aggregated into a cluster, indicating that CFSH is an IL-17 homolog of decapod crustaceans.

3.3. Expression Profiles of Lvit-IL-17R

Lvit-IL-17R is widely expressed in various tissues (Figure 2A). Lvit-IL-17R in AG, hepatopancreas, and ovarian regions has different expression profiles.
In the present study, the Lvit-IL-17R expression level in the AG significantly decreased by 53.74% at stage II. Subsequently, it significantly increased to 143.39% of the stage I level during stage III. Finally, the Lvit-IL-17R level expression decreased to 78.68% of the stage I level during stage IV (F3,15 = 36.246, p < 0.05) (Figure 2B).
In the hepatopancreas, the Lvit-IL-17R expression level significantly increased to 314.84% at stage II, and then slightly reduced to 265.63% of the stage I level, and eventually, at stage IV, it downregulated to almost the same levels (111.76%) as those during stage I (F3,15 = 12.274, p < 0.05) (Figure 2B).
In the ovarian regions, the Lvit-IL-17R mRNA expression levels increased gradually with gonadal development. The Lvit-IL-17R mRNA expression levels significantly increased to 338.37% of the stage I level during stage II. The increase continued, with a peak expression at stage III at 916.07% of the stage I level. With the maturation of ovarian regions, at stage IV, the Lvit-IL-17R expression level significantly decreased to 413.87% of the stage I level (F3,15 = 57.831, p < 0.05) (Figure 2B).

3.4. Ligand–Receptor Interaction Analysis

The analysis of ligand–receptor interaction was performed through the utilization of GST pulldown assays. Through prokaryotic expression, recombinant proteins CFSH1a (21.0 kDa, containing 6 × His tag), CFSH1b (24.8 kDa, containing 6 × His tag), and IL-17R (62.8 kDa, containing 6 × His tag) (Figure 3) were obtained. The results of the GST pulldown assays demonstrate that rCFSH1a and rCFSH1b can bind to rIL-17R specifically rather than GST (Figure 3).

3.5. Short-Term Silencing Experiment In Vivo

The results demonstrate that compared with the PBS treatment, the transcripts levels of Lvit-IL-17R were inhibited by 56.2%, 46.6%, and 47.7% in the AG (F2,12 = 7.491, p < 0.05) (Figure 4A), hepatopancreas (F2,12 =20.662, p < 0.05) (Figure 4B), and ovarian regions (F2,12 = 22.197, p < 0.05) (Figure 4C), respectively.
The expression levels of the genes related to male sexual differentiation and ovarian development were also examined. Based on qRT-PCR, Lvit-IL-17R knockdown induced the significant upregulation of Lvit-IAG1 (F2,12 = 64.934, p < 0.05) (Figure 4D) and Lvit-IAG2 levels (F2,12 = 56.374, p < 0.05) (Figure 4E) in the AG, indicating that Lvit-IL-17R may suppress male sexual differentiation by inhibiting IAG expression. Following the knockdown of Lvit-IL-17R, the expression of Lvit-Vg (F2,12 = 20.633, p < 0.05) (Figure 4F) and Lvit-VgR (F2,12 = 43.263, p < 0.05) (Figure 4G) were also downregulated, suggesting the potential role of Lvit-IL-17R in ovarian development.

3.6. Long-Term Silencing Experiment In Vivo

Firstly, we evaluated the efficacy of gene knockdown in a long-term experiment. The injection of dsRNA successfully induced the knockdown of Lvit-IL-17R in the AG, hepatopancreas, and ovarian regions. Compared with the PBS treatment, the Lvit-IL-17R transcripts were inhibited by 77.7%, 73.6%, and 73.8% in the AG (F2,14 = 31.259, p < 0.05) (Figure 5A), hepatopancreas (F2,14 = 57.096, p < 0.05) (Figure 5B), and ovarian regions (F2,14 = 16.343, p < 0.05) (Figure 5C), respectively (Figure 5). In addition, it was observed that the silencing of Lvit-IL-17R had no discernible impact on the growth of the shrimps (carapace length: F2,14 = 0.172, p = 0.844 > 0.05; body weight: F2,14 = 1.057, p = 0.374 > 0.05) (Figure 5D,E).

3.6.1. Effects of Lvit-IL-17R Silencing on Female Sexual Differentiation

The retardation of female sexual traits (female gonopores) was observed in the absence of Lvit-IL-17R. In the PBS and dsRNA GFP treatments, female gonopores were two distinct bulges located on the coxa of the third pair of pereiopods. The top edge of the female gonopores was surrounded by lush plumose setae. Following long-term Lvit-IL-17R silencing, the female gonopores became flattened and visually inapparent. The feathery setae surrounding female gonopores became sparse and were relatively short (Figure 6A).
The results demonstrated that Lvit-IL-17R silencing impeded the process of ovarian development. In the dsRNA Lvit-IL-17R treatment, the ovarian regions became smaller and filled with less-developed germ cells (Figure 6B). Relatively smaller oocytes and fewer follicular cells were observed during the dsRNA Lvit-IL-17R treatment (Figure 6B). We then measured the average oocyte diameter of the three treatments. The average oocyte diameters in both control groups were 58.89 ± 0.47 μm (n = 5) and 59.05 ± 1.06 μm (n = 6). This metric decreased to 37.00 ± 0.95 μm after Lvit-IL-17R silencing (n = 6) (F2,14 = 201.459, p < 0.05) (Figure 6C). Meanwhile, subsequent to the knockdown of Lvit-IL-17R, the genes associated with ovarian development were also significantly repressed. The Lvit-Vg (F2,14 = 244.880, p < 0.05) and Lvit-VgR (F2,14 = 17.844, p < 0.05) expression levels were significantly downregulated by 99.72% and 65.83%, respectively (Figure 6D).

3.6.2. Effects of Lvit-IL-17R Silencing on Male Sexual Differentiation

Per the short-term silencing experiment, Lvit-IL-17R knockdown resulted in a notable elevation in the expression levels of Lvit-IAG1 (F2,14 =8.667, p < 0.05) and Lvit-IAG2 (F2,14 =33.143, p < 0.05) (Figure 7A).
Moreover, Lvit-IL-17R knockdown partially contributed to the development of male external phenotypes. Lvit-IL-17R gene knockdown significantly promotes appendices masculinae (AM) development (F2,14 = 6.676, p < 0.05) (Figure 7B,C). However, there were no significant variations observed in the other external male phenotypes, such as the male gonopores and cincinnuli (Figure 7B).
Meanwhile, Lvit-IL-17R knockdown dramatically promotes testicular development. Gonadal histology analysis revealed that the injection of Lvit-IL-17R dsRNA yielded different germ cell compositions. For both control groups, the majority of the cells were poorly developed germ cells, including spermatogonia (Sg) and spermatocytes I (Sc I), indicating less active spermatogenesis (Figure 7D). On the contrary, a more mature profile of germ cell compositions was established with the dsRNA Lvit-IL-17R treatment. Abundant mature germ cells, such as the spermatid (Sd) and spermatozoa (Sz), were observed in the testicular regions (Figure 7D).

4. Discussion

In both dioecious and hermaphrodite crustaceans, IAG and CFSH play pivotal roles in sexual differentiation [9,10,11,22,23]. IAG receptors have been identified in several crustacean species [18,19,20,21]. On the other hand, research regarding CFSH receptors remains scarce. In 2023, a candidate CFSH receptor for regulating IAG expression was identified from mud crabs, S. paramamosain [37]. We are unsure whether the receptors with similar structures regulate sexual differentiation in shrimps. The present study identified a CFSH receptor from PSH shrimps, L. vittata.
Previous studies have shown that the IL-17 domain is highly conserved in the mature peptides of all known CFSHs [24,25,26,27,28,29,30]. Also, we found that the recently identified IL-17 proteins were indeed CFSHs described in previous studies (Table A3) [30,31]. Thus, we suspected that CFSH was the IL-17 homolog in decapod crustaceans. To further confirm this suspicion, we constructed a phylogenetic tree with the IL-17 domain-contained proteins of crustaceans (CFSH and other sequences) and IL-17 from other categories (Figure 1B). Via phylogenetic analysis, we demonstrated that the IL-17 domain-contained proteins of crustaceans form a unique clade similar to other known IL-17. Thus, it is reasonable to suggest that CFSH is the IL-17 in decapod crustaceans.
Various IL-17Rs have been identified in vertebrates, from IL-17RA to IL-17RE [33,39,40]. In addition, the N-terminal regions of IL-17Rs are also varied in invertebrates [31,41,42]. IL-17 binds to different IL-17 receptors by triggering downstream signals [33,39,40,43]. Moreover, IL-17 receptors are all single-pass transmembrane receptors with a conversed SEFIR domain in the intracellular regions [31,33,36,39,40,41,42]. Therefore, the transcript of the SEFIR domain-contained protein was successfully obtained for further analysis. RACE cloning and bioinformatics analyses confirmed that the SEFIR-contained protein shares a similar structure with the other IL-17 receptors, including a signal peptide, a transmembrane domain, and an SEFIR domain at the cytoplasmic tail [33,36,39,40]. Thus, the transcript was named Lvit-IL-17R, rather than NF-κB activator 1 (Act1), a cytosolic protein containing the SEFIR domain [33]. Moreover, a recently identified CFSH receptor from mud crabs (S. paramamosain) also has a similar structure to those of the other IL-17R [37]. Thus, Lvit-IL-17R was speculated to be a candidate CFSH receptor of the PSH species.
By examining the tissue expression profile, Lvit-IL-17R was confirmed to be widely distributed in various tissues. Previous studies have also demonstrated that CFSH could suppress IAG expression in the AG and stimulate Vg expression in the hepatopancreas and VgR expression in the ovarian region, indicating that the AG, the hepatopancreas, and the ovarian region were target tissues of CFSH in these particular species [10]. To elucidate this, we examined the expression profiles in these three tissues. The results demonstrated that Lvit-IL-17R exhibited similar temporal expression profiles of Lvit-CFSH1b in the hepatopancreas and the ovarian region. However, Lvit-IL-17R displayed the opposite expression trend to those of Lvit-IAG1 and Lvit-IAG2, which are more highly expressed in the male phase rather than the female phase [11]. The present findings suggest that Lvit-IL-17R may play a role in CFSH’s inhibition of IAG and CFSH’s promotion of ovarian development.
To explore the interaction between Lvit-IL-17R and Lvit-CFSHs, we performed GST pulldown assays with rCFSH1s and the extracellular segment of IL-17R. The results revealed that the extracellular segment of Lvit-IL-17R could bind to both Lvit-CFSHs. These findings suggest that Lvit-IL-17R is likely a receptor of type I CFSH in PSH shrimps.
According to the previous studies, both type I CFSHs (CFSH1a and CFSH1b) co-regulate sexual differentiation in L.vittata [10]. In detail, CFSH1a and CFSH1b regulate the development of female gonopores. Furthermore, CFSH1b has been proposed to regulate ovarian development via vitellogenesis [10]. Although CFSH1a and CFSH1b suppress IAG expression in the AG, only CFSH1b is closely related to male sexual differentiation in the species [10]. Thus, an in vivo silencing experiment was conducted to explore whether Lvit-IL-17R had any functional relevance with CFSHs in the PSH species.
In the short-term silencing experiment, during the subsequent knockdown of Lvit-IL-17R, there was a notable increase in the expression levels of both Lvit-IAGs, whereas Lvit-Vg and Lvit-VgR were downregulated. Similar expression trends were observed for these genes in a previous study involving Lvit-CFSH1b [10]. These results suggest a correlation between Lvit-CFSH1b and Lvit-IL-17R in ovarian development and male sexual differentiation in this crustacean species.
To clarify the regulation roles of Lvit-IL-17R in sexual differentiation, we performed a long-term silencing experiment utilizing shrimps at the early gonadal development stages. The results indicate that Lvit-IL-17R knockdown hindered the development of female phenotypes (female gonopores), suggesting its regulatory role in female sexual differentiation. Moreover, the development of ovarian regions was also suppressed. Following Lvit-IL-17R knockdown, the ovarian regions were less developed with significantly smaller oocytes. Simultaneously, the transcripts of genes related to ovarian development were also inhibited. Similar results have been produced from the knockdown of either CFSH1a or CFSH1b in previous studies [10]. These findings suggest a relationship between Lvit-IL-17R and the two type I CFSHs (CFSH1a and CFSH1b) aimed at the female sexual differentiation of the PSH species.
Previous studies have shown that Lvit-IAG1 and Lvit-IAG2 co-regulate the development of male external phenotypes and spermatogenesis in PSH shrimps, L. vittata [11]. As IAG is regulated by type I CFSH through a negative feedback loop in both dioecious and hermaphrodite crustaceans [10,23], male sexual differentiation is also negatively regulated by CFSH1b in L. vittata [10]. The present results demonstrate that Lvit-IL-17R negatively regulates male sexual differentiation in this species. Lvit-IL-17R knockdown induces the promotion of the development of both testicular regions and male-related external phenotypes. These results also correspond to studies involving CFSH1b [10]. The combined results suggest that Lvit-IL-17R is a receptor of CFSH1b in the sexual differentiation of the PSH species.
Moreover, Lvit-IL-17R is also related to the biological functions of CFSH1a. A previous study demonstrated that Lvit-CFSH1a could also regulate female and male sexual differentiation by inhibiting Lvit-IAG2 expression. Following Lvit-CFSH1a knockdown, the development of female gonopores was hindered, and the expression of Lvit-IAG2 was promoted in the AG [10]. In the present study, Lvit-IL-17R knockdown also resulted in similar results. Moreover, Lvit-IL-17R could also bind to Lvit-CFSH1a. These findings suggest that Lvit-IL-17R is also a receptor of Lvit-CFSH1a.

5. Conclusions

In summary, a receptor of type I CFSH aimed at regulating sexual differentiation was identified through protein interaction and biological function experiments. To the best of the authors’ knowledge, the present study provides the first report on CFSH receptors involved in sexual differentiation in PSH species. We confirmed that type I CFSHs promote the development of both female external features and ovarian regions via Lvit-IL-17R in the PSH species. Moreover, Lvit-IL-17R is involved in the inhibition of IAG through CFSH, suppressing male sexual differentiation. These findings expand our understanding of crustacean reproductive endocrinology and clarify the mechanisms of sexual differentiation in crustaceans.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biom13101456/s1, File S1: Original WB images of Figure 2 and Figure 3.

Author Contributions

Conceptualization, F.L. and H.Y.; methodology, F.L., A.L. and H.Y.; software, F.L.; validation, F.L.; formal analysis, F.L.; investigation, F.L.; resources, F.L. and H.Y.; data curation, F.L.; writing—original draft preparation, F.L.; writing—review and editing, F.L., A.L. and H.Y.; visualization, F.L.; supervision, H.Y.; project administration, H.Y.; funding acquisition, F.L. and H.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China, grant number 32273113, and China Postdoctoral Science Foundation, grant number 2022M721329.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Animal Care and Use Committee of the Fisheries College of Jimei University (Approval Code: 2021-04; Approval Date: 22 January 2021).

Data Availability Statement

The original contributions presented in the study are publicly available. This data can be found here: (GenBank accession no. MZ367742).

Acknowledgments

We express our gratitude to all laboratory members for their valuable input and productive deliberation.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table A1. Primers used in this study.
Table A1. Primers used in this study.
PrimerSequence (5′-3′)Application
IL17RFTTCGTCGCCTCGTCTCTCTTCACACFragment validation
IL17RRAAAGGTCATCTACCAAGGAACCCG
UPMCTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT5′RACE
5IL17RoutACGAAGCAGATGCCTTGGAGCAGG
5IL17RinGTGCGATGGTGAGAACGAGTAACAAG
CFSH1aQFCAAGGACGGCGATGATGART-PCR/qRT-PCR
CFSH1aQRGCGAAGGATCTGAGATGTGTA
CFSH1bQFATCCACACCTCAGAACTCATC
CFSH1bQRGCACAGGCTACGGTTATCT
IAG1QFCTAATCTTGCTGCCTCATTCTAC
IAG1QRGCGTCGTTCTCTGTAATAATCG
IAG2QFTCAGTCTCAGCCATCTCCT
IAG2QRTGAACCGACCACCTCTAATG
VgQFGCAAAAGTGGGAGCCGAAAG
VgQRATCACCCGTAGAGGGTAGGG
VgRQFCTGCGTCTCGGAACTCAA
VgRQRGTGCTGGTGGTGAAGATGA
IL17RQFGGTTCCTGTGGTGGTTGT
IL17RQRGAGTAGCGATGTTCCTGTCA
actinFCGTGACCTGACTGATTACC
actinRCGTTACCGATAGTGATTACCT
IL17RdsFGTGTAGCACCAACTTCAGAGCdsRNA synthesis
IL17RdsRAACAGTGACGACCGCCTC
GFPdsFTGGGCGTGGATAGCGGTTTG
GFPdsRGGTCGGGGTAGCGGCTGAAG
T7primerTAATACGACTCACTATAGGG
SP6primerATTTAGGTGACACTATAG
IL17RyhFCGCGGATCCAGTGATCAAAGTTGTCCTAAAGATCProkaryotic expression
IL17RyhRCTAGCTAGCTCGGTGGTCCGGTTTAATTTCTAAT
Table A2. Sequences used in phylogenetic tree analysis of IL-17Rs.
Table A2. Sequences used in phylogenetic tree analysis of IL-17Rs.
SequenceGenebank Accession NumberNR Description
IL-17RA Homo sapiensNP_055154.3interleukin-17 receptor A isoform 1 precursor [Homo sapiens]
IL-17RA Trichosurus vulpeculaXP_036616840.1interleukin-17 receptor A [Trichosurus vulpecula]
IL-17RA Anas platyrhynchosXP_027319183.2interleukin-17 receptor A [Anas platyrhynchos]
IL-17RA Corvus cornix cornixXP_039426789.1interleukin-17 receptor A [Corvus cornix cornix]
IL-17RA Ctenopharyngodon idellaAXF94778.1IL17RA [Ctenopharyngodon idella]
IL-17RA Xiphophorus helleriiXP_032445247.1interleukin-17 receptor A [Xiphophorus hellerii]
IL-17RA Labrus bergyltaXP_020500355.1interleukin-17 receptor A [Labrus bergylta]
IL-17RA Crotalus tigrisXP_039218521.1interleukin-17 receptor A [Crotalus tigris]
IL-17RA Thamnophis elegansXP_032077075.1interleukin-17 receptor A [Thamnophis elegans]
IL-17RB Bos taurusAAI33637.1IL17RB protein [Bos taurus]
IL-17RB Mus musculusNP_062529.2interleukin-17 receptor B precursor [Mus musculus]
IL-17RB Homo sapiensNP_061195.2interleukin-17 receptor B precursor [Homo sapiens]
IL-17RB Protobothrops mucrosquamatusXP_015671688.1interleukin-17 receptor B [Protobothrops mucrosquamatus]
IL-17RB Notechis scutatusXP_026532517.1interleukin-17 receptor B isoform X1 [Notechis scutatus]
IL-17RB Pantherophis guttatusXP_034293105.1interleukin-17 receptor B isoform X2 [Pantherophis guttatus]
IL-17RB Cygnus atratusXP_035414138.1LOW QUALITY PROTEIN: interleukin-17 receptor B [Cygnus atratus]
IL-17RB Gavia stellataXP_009818499.1PREDICTED: interleukin-17 receptor B [Gavia stellata]
IL-17RB Crocodylus porosusXP_019392467.1PREDICTED: interleukin-17 receptor B isoform X3 [Crocodylus porosus]
IL-17RB Mauremys reevesiiXP_039402548.1interleukin-17 receptor B [Mauremys reevesii]
IL-17RB Chelonoidis abingdoniiXP_032650202.1interleukin-17 receptor B isoform X1 [Chelonoidis abingdonii]
IL-17RB Trachemys scripta elegansXP_034631495.1interleukin-17 receptor B isoform X1 [Trachemys scripta elegans]
IL-17RC Mus musculusAAH04759.1Il17rc protein [Mus musculus]
IL-17RC Homo sapiensNP_001190193.2interleukin-17 receptor C isoform 5 precursor [Homo sapiens]
IL-17RC Kryptolebias marmoratusXP_017290980.1interleukin-17 receptor C [Kryptolebias marmoratus]
IL-17RC Cyprinodon tularosaXP_038135791.1interleukin-17 receptor C isoform X1 [Cyprinodon tularosa]
IL-17RC Nematolebias whiteiXP_037535779.1interleukin-17 receptor C [Nematolebias whitei]
IL-17RC Oryzias melastigmaXP_024125869.1interleukin-17 receptor C [Oryzias melastigma]
IL-17RC Passer montanusXP_039590153.1interleukin-17 receptor C [Passer montanus]
IL-17RC Anas platyrhynchosXP_038041828.1interleukin-17 receptor C [Anas platyrhynchos]
IL-17RC Falco rusticolusXP_037241131.1interleukin-17 receptor C [Falco rusticolus]
IL-17RC Parus majorXP_033373328.1interleukin-17 receptor C [Parus major]
IL-17RC Crotalus tigrisXP_039189296.1interleukin-17 receptor C [Crotalus tigris]
IL-17RC Lacerta agilisXP_032997296.1interleukin-17 receptor C [Lacerta agilis]
IL-17RC Thamnophis elegansXP_032068166.1interleukin-17 receptor C [Thamnophis elegans]
IL-17RC Chelonoidis abingdoniiXP_032645769.1interleukin-17 receptor C [Chelonoidis abingdonii]
IL-17RC Rana temporariaXP_040214946.1interleukin-17 receptor C [Rana temporaria]
IL-17RC Xenopus tropicalisXP_002941718.2interleukin-17 receptor C [Xenopus tropicalis]
IL-17RD Homo sapiensAAI11703.2Interleukin 17 receptor D [Homo sapiens]
IL-17RD Camelus dromedariusKAB1264165.1Interleukin-17 receptor D [Camelus dromedarius]
IL-17RD Mus pahariXP_021059177.1interleukin-17 receptor D [Mus pahari]
IL-17RD Epinephelus coioidesASU91965.1interleukin 17 receptor D [Epinephelus coioides]
IL-17RD Oncorhynchus mykissXP_021422760.1interleukin-17 receptor D [Oncorhynchus mykiss]
IL-17RD Oryzias melastigmaXP_024149401.1interleukin-17 receptor D [Oryzias melastigma]
IL-17RD Larimichthys croceaTMS19695.1Interleukin-17 receptor D [Larimichthys crocea]
IL-17RD Serinus canariaXP_009089302.2interleukin-17 receptor D [Serinus canaria]
IL-17RD Parus majorXP_015496904.1interleukin-17 receptor D [Parus major]
IL-17RD Phasianus colchicusXP_031464092.1interleukin-17 receptor D [Phasianus colchicus]
IL-17RD Geospiza fortisXP_014163114.1interleukin-17 receptor D [Geospiza fortis]
IL-17RD Protobothrops mucrosquamatusXP_029142521.1interleukin-17 receptor D [Protobothrops mucrosquamatus]
IL-17RD Pseudonaja textilisXP_026579511.1interleukin-17 receptor D [Pseudonaja textilis]
IL-17RD Notechis scutatusXP_026533350.1interleukin-17 receptor D [Notechis scutatus]
IL-17RD Crassostrea gigasXP_034308350.1interleukin-17 receptor D [Crassostrea gigas]
IL-17RD Mizuhopecten yessoensisOWF39523.1Interleukin-17 receptor D [Mizuhopecten yessoensis]
IL-17RD Mytilus coruscusCAC5416786.1IL17RD [Mytilus coruscus]
IL-17RD Sepia pharaonisCAE1176245.1IL17RD [Sepia pharaonis]
IL-17RE Ochotona princepsXP_004581715.1interleukin-17 receptor E [Ochotona princeps]
IL-17RE Mastomys couchaXP_031236803.1interleukin-17 receptor E [Mastomys coucha]
IL-17RE Bos indicusXP_019840332.1PREDICTED: interleukin-17 receptor E [Bos indicus]
IL-17RE Epinephelus coioidesASU91966.1interleukin 17 receptor E [Epinephelus coioides]
IL-17RE Anabarilius grahamiROI74335.1Interleukin-17 receptor E [Anabarilius grahami]
IL-17RE Periophthalmus magnuspinnatusXP_033824756.1interleukin-17 receptor E [Periophthalmus magnuspinnatus]
IL-17RE Syngnathus acusXP_037134538.1interleukin-17 receptor E [Syngnathus acus]
IL-17RE Calypte annaXP_030314349.1interleukin-17 receptor E [Calypte anna]
IL-17RE Manacus vitellinusXP_029814192.1interleukin-17 receptor E [Manacus vitellinus]
IL-17RE Gallus gallusXP_015148829.1interleukin-17 receptor E [Gallus gallus]
IL-17RE Amazona aestivaKQK84533.1interleukin-17 receptor E [Amazona aestiva]
IL-17RE Crotalus tigrisXP_039189291.1interleukin-17 receptor E isoform X2 [Crotalus tigris]
IL-17RE Thamnophis elegansXP_032065471.1interleukin-17 receptor E [Thamnophis elegans]
IL-17RE Alligator sinensisXP_006036694.2interleukin-17 receptor E [Alligator sinensis]
IL-17R1 Penaeus monodonXP_037788272.1uncharacterized protein LOC119583705 isoform X1 [Penaeus monodon]
IL-17R1 Penaeus vannameiXP_027209688.1 uncharacterized protein LOC113803161 isoform X3 [Penaeus vannamei]
IL-17R Homarus americanusXP_042224392.1uncharacterized protein LOC121868143 [Homarus americanus]
IL-17R Penaeus japonicusXP_042872695.1uncharacterized protein LOC122253547 isoform X1 [Penaeus japonicus]
IL-17R2 Penaeus vannameiXP_027210315.1uncharacterized protein LOC113803705 [Penaeus vannamei]
IL-17R2 Penaeus monodonXP_037791606.1uncharacterized protein LOC119586945 [Penaeus monodon]
IL-17R Scylla paramamosainON787957female sex hormone receptor [Scylla paramamosain]
IL-17R Lysmata vittataMZ367742interleukin 17 receptor [Lysmata vittata]
Table A3. Sequences used in phylogenetic tree analysis of IL-17 and CFSH.
Table A3. Sequences used in phylogenetic tree analysis of IL-17 and CFSH.
SequenceGenebank Accession NumberNR Description
CFSH1a L. vittataQOD42431.1crustacean female sex hormone 2 [Lysmata vittata]
CFSH1b L. vittataQOD42430.1crustacean female sex hormone 1 [Lysmata vittata]
CFSH1c P. japonicusXP_042859036.1uncharacterized protein LOC122245152 [Penaeus japonicus]
CFSH1c P. vannameiXP_027234405.1uncharacterized protein LOC113825772 [Penaeus vannamei]
CFSH1c P. monodonXP_037783148.1uncharacterized protein LOC119579417 [Penaeus monodon]
CFSH1c1 P. chinensisXP_047497145.1uncharacterized protein LOC125044498 [Penaeus chinensis]
CFSH1c2 P. chinensisXP_047496354.1uncharacterized protein LOC125043989 [Penaeus chinensis]
CFSH1b P. vannameiXP_027214658.1uncharacterized protein LOC113807568 [Penaeus vannamei]
CFSH1b P. japonicusXP_042860457.1uncharacterized protein LOC122246162 [Penaeus japonicus]
CFSH1a P. japonicusXP_042860456.1uncharacterized protein LOC122246161 [Penaeus japonicus]
CFSH1a P. vannameiXP_027214657.1uncharacterized protein LOC113807567 [Penaeus vannamei]
CFSH1a P. monodonXP_037787591.1uncharacterized protein LOC119583157 [Penaeus monodon]
CFSH1d P. japonicusXP_042858179.1uncharacterized protein LOC122244361 [Penaeus japonicus]
CFSH1d P. vannameiXP_027219797.1uncharacterized protein LOC113812164 [Penaeus vannamei]
CFSH1d P. chinensisXP_047496468.1uncharacterized protein LOC125044066 [Penaeus chinensis]
CFSH1d P. monodonXP_037783482.1uncharacterized protein LOC119579641 [Penaeus monodon]
CFSH1 P. clarkiiXP_045612404.1uncharacterized protein LOC123766959 [Procambarus clarkii]
CFSH1 S. paramamosainQIH29133.1crustacean female sex hormone [Scylla paramamosain]
CFSH1 P. trituberculatusXP_045110383.1uncharacterized protein LOC123504127 [Portunus trituberculatus]
CFSH1 C. sapidusADO00266.1crustacean female hormone [Callinectes sapidus]
CFSH2b C. quadricarinatusXP_053635083.1uncharacterized protein LOC128690428 [Cherax quadricarinatus]
CFSH2b P. clarkiiXP_045592388.1uncharacterized protein LOC123754223 [Procambarus clarkii]
CFSH2b E. sinensisXP_050718041.1uncharacterized protein LOC126999466 [Eriocheir sinensis]
CFSH2a E. sinensisXP_050685866.1uncharacterized protein LOC126980239 [Eriocheir sinensis]
CFSH2a P. clarkiiXP_045612404.1uncharacterized protein LOC123766959 [Procambarus clarkii]
CFSH2a C. quadricarinatusXP_053655536.1uncharacterized protein LOC128704410 [Cherax quadricarinatus]
CFSH2 P. japonicusXP_042863675.1uncharacterized protein LOC122248000 [Penaeus japonicus]
CFSH2 P. vannameiXP_027237919.1 uncharacterized protein LOC113829039 [Penaeus vannamei]
CFSH2 P. monodonXP_037797660.1uncharacterized protein LOC119592827 [Penaeus monodon]
IL-17F H. sapiensAAH70124.1Interleukin 17F [Homo sapiens]
IL-17F M. musculusAAQ88439.1interleukin 17F [Mus musculus]
IL-17A H. sapiensAAH67504.1Interleukin 17A [Homo sapiens]
IL-17A M. musculusEDL14378.1interleukin 17A [Mus musculus]
IL-17F G. gallusADR73041.1interleukin 17F [Gallus gallus]
IL-17A G. gallusCAO79600.1interleukin-17A [Gallus gallus]
IL-17A O. mykissCCG00933.1Interleukin 17A [Oncorhynchus mykiss]
IL-17F O. mykissXP_036818687.1interleukin-17F [Oncorhynchus mykiss]
IL-17D F. rusticolusXP_037233120.1interleukin-17D [Falco rusticolus]
IL-17D H. sapiensAAH36243.1Interleukin 17D [Homo sapiens]
IL-17D C. idellaAGW43284.1interleukin 17D [Ctenopharyngodon idella]
IL-17B A. chrysaetos chrysaetosXP_029853932.1interleukin-17B [Aquila chrysaetos chrysaetos]
IL-17B M. musculusEDL09761.1interleukin 17B [Mus musculus]
IL-17B H. sapiensAAF28104.1interleukin 17B [Homo sapiens]
IL-17B F. heteroclitusXP_012710165.2interleukin-17B [Fundulus heteroclitus]
IL-17C C. idellaAKM20918.1interleukin 17C [Ctenopharyngodon idella]
IL-17E O. niloticusXP_005447866.2interleukin-25 isoform X3 [Oreochromis niloticus]
IL-17C M. musculusNP_665833.4interleukin-17C [Mus musculus]
IL-17C H. sapiensAAF28105.1interleukin 17C [Homo sapiens]
IL-17C M. aterXP_036246432.1interleukin-17C [Molothrus ater]
IL-17E A. sinensisXP_025048580.1interleukin-25 [Alligator sinensis]
IL-17E T. vulpeculaXP_036592492.1interleukin-25 [Trichosurus vulpecula]
IL-17E M. musculusNP_542767.1interleukin-25 [Mus musculus]
IL-17E S. scrofaAXF36091.1interleukin 17E [Sus scrofa]
IL-17E H. sapiensAAG40848.1interleukin 17E [Homo sapiens]
IL-6 H. sapiensAAD13886.1interleukin-6 [Homo sapiens]

Appendix B

Biomolecules 13 01456 g0a1
Figure A1. Molecular characterization of Lvit-IL-17R. (A) The ORF and deduced amino acid sequence of Lvit-IL-17R. The signal peptide is shown in red; black underline indicates transmembrane region; the SEFIR domain is boxed in gray. (B) Schematic diagram of Lvit-IL-17R. Signal peptide, transmembrane region, and the SEFIR domain are boxed in red, blue, and purple, respectively. SP: signal peptide; TM: transmembrane region; SEFIR: similar expression as the fibroblast growth factor and IL-17R.
Figure A1. Molecular characterization of Lvit-IL-17R. (A) The ORF and deduced amino acid sequence of Lvit-IL-17R. The signal peptide is shown in red; black underline indicates transmembrane region; the SEFIR domain is boxed in gray. (B) Schematic diagram of Lvit-IL-17R. Signal peptide, transmembrane region, and the SEFIR domain are boxed in red, blue, and purple, respectively. SP: signal peptide; TM: transmembrane region; SEFIR: similar expression as the fibroblast growth factor and IL-17R.
Biomolecules 13 01456 g0a1

References

  1. Juchault, P. Hermaphroditism and gonochorism. A new hypothesis on the evolution of sexuality in Crustacea. C. R. Acad. Sci. III 1999, 322, 423–427. [Google Scholar] [CrossRef]
  2. Bauer, R.T. Simultaneous hermaphroditism in caridean shrimps: A unique and puzzling sexual system in the Decapoda. J. Crustac. Biol. 2000, 20, 116–128. [Google Scholar] [CrossRef]
  3. Ford, A.T. Intersexuality in Crustacea: An environmental issue? Aquat. Toxicol. 2012, 108, 125–129. [Google Scholar] [CrossRef] [PubMed]
  4. Levy, T.; Tamone, S.L.; Manor, R.; Bower, E.D.; Sagi, A. The protandric life history of the Northern spot shrimp Pandalus platyceros: Molecular insights and implications for fishery management. Sci. Rep. 2020, 10, 1287. [Google Scholar] [CrossRef] [PubMed]
  5. Levy, T.; Tamone, S.L.; Manor, R.; Aflalo, E.D.; Sklarz, M.Y.; Chalifa-Caspi, V.; Sagi, A. The IAG-switch and further transcriptomic insights into sexual differentiation of a protandric shrimp. Front. Mar. Sci. 2020, 7, 587454. [Google Scholar] [CrossRef]
  6. Chen, D.M.; Liu, F.; Zhu, Z.H.; Lin, Q.; Zeng, C.S.; Ye, H.H. Ontogenetic development of gonads and external sexual characters of the protandric simultaneous hermaphrodite peppermint shrimp, Lysmata vittata (Caridea: Hippolytidae). PLoS ONE 2019, 14, e0215406. [Google Scholar] [CrossRef]
  7. Alves, D.F.R.; Greco, L.S.L.; Barros-Alves, S.D.; Hirose, G.L. Sexual system, reproductive cycle and embryonic development of the red-striped shrimp Lysmata vittata, an invader in the western Atlantic Ocean. PLoS ONE 2019, 14, e0210723. [Google Scholar] [CrossRef]
  8. Toyota, K.; Miyakawa, H.; Hiruta, C.; Sato, T.; Katayama, H.; Ohira, T.; Iguchi, T. Sex determination and differentiation in decapod and cladoceran crustaceans: An overview of endocrine regulation. Genes 2021, 12, 305. [Google Scholar] [CrossRef]
  9. Levy, T.; Sagi, A. The “IAG-switch”—A key controlling element in decapod crustacean sex differentiation. Front. Endocrinol. 2020, 11, 651. [Google Scholar] [CrossRef]
  10. Liu, F.; Liu, A.; Zhu, Z.; Wang, Y.; Ye, H. Crustacean female sex hormone: More than a female phenotypes-related hormone in a protandric simultaneous hermaphroditism shrimp. Int. J. Biol. Macromol. 2023, 238, 124181. [Google Scholar] [CrossRef]
  11. Liu, F.; Shi, W.Y.; Ye, H.H.; Liu, A.; Zhu, Z.H. RNAi Reveals Role of insulin-like androgenic gland hormone 2 (IAG2) in sexual differentiation and growth in hermaphrodite shrimp. Front. Mar. Sci. 2021, 8, 666763. [Google Scholar] [CrossRef]
  12. Martin, G.; Sorokine, O.; Moniatte, M.; Vandorsselaer, A. The androgenic hormone of the crustacean isopod Armadillidium vulgare. In Trends in Comparative Endocrinology and Neurobiology: From Molecular to Integrative Biology; Vaudry, H., Tonon, M.C., Roubos, E.W., de Loof, A., Eds.; Annals of the New York Academy of Sciences: New York, NY, USA, 1998; Volume 839, pp. 111–117. [Google Scholar]
  13. Martin, G.; Sorokine, O.; Moniatte, M.; Bulet, P.; Hetru, C.; Van Dorsselaer, A. The structure of a glycosylated protein hormone responsible for sex determination in the isopod, Armadillidium vulgare. Eur. J. Biochem. 1999, 262, 727–736. [Google Scholar] [CrossRef] [PubMed]
  14. Manor, R.; Weil, S.; Oren, S.; Glazer, L.; Aflalo, E.D.; Ventura, T.; Chalifa-Caspi, V.; Lapidot, M.; Sagi, A. Insulin and gender: An insulin-like gene expressed exclusively in the androgenic gland of the male crayfish. Gen. Comp. Endocrinol. 2007, 150, 326–336. [Google Scholar] [CrossRef] [PubMed]
  15. Ventura, T.; Manor, R.; Aflalo, E.D.; Weil, S.; Raviv, S.; Glazer, L.; Sagi, A. Temporal silencing of an androgenic gland-specific insulin-like gene affecting phenotypical gender differences and spermatogenesis. Endocrinology 2009, 150, 1278–1286. [Google Scholar] [CrossRef]
  16. Rosen, O.; Manor, R.; Weil, S.; Gafni, O.; Linial, A.; Aflalo, E.D.; Ventura, T.; Sagi, A. A sexual shift induced by silencing of a single insulin-like gene in crayfish: Ovarian upregulation and testicular degeneration. PLoS ONE 2010, 5, e15281. [Google Scholar] [CrossRef]
  17. Fu, C.P.; Li, F.J.; Wang, L.F.; Wu, F.R.; Wang, J.M.; Fan, X.L.; Liu, T. Molecular characteristics and abundance of insulin-like androgenic gland hormone and effects of RNA interference in Eriocheir sinensis. Anim. Reprod. Sci. 2020, 215, 106332. [Google Scholar] [CrossRef]
  18. Aizen, J.; Chandler, J.C.; Fitzgibbon, Q.P.; Sagi, A.; Battaglene, S.C.; Elizur, A.; Ventura, T. Production of recombinant insulin-like androgenic gland hormones from three decapod species: In Vitro testicular phosphorylation and activation of a newly identified tyrosine kinase receptor from the Eastern spiny lobster, Sagmariasus verreauxi. Gen. Comp. Endocrinol. 2016, 229, 8–18. [Google Scholar] [CrossRef]
  19. Sharabi, O.; Manor, R.; Weil, S.; Aflalo, E.D.; Lezer, Y.; Levy, T.; Aizen, J.; Ventura, T.; Mather, P.B.; Khalaila, I.; et al. Identification and characterization of an insulin-like receptor involved in crustacean reproduction. Endocrinology 2016, 157, 928–941. [Google Scholar] [CrossRef]
  20. Guo, Q.; Li, S.H.; Lv, X.J.; Xiang, J.H.; Sagi, A.; Manor, R.; Li, F.H. A putative insulin-like androgenic gland hormone receptor gene specifically expressed in male Chinese shrimp. Endocrinology 2018, 159, 2173–2185. [Google Scholar] [CrossRef]
  21. Tan, K.; Li, Y.; Zhou, M.; Wang, W. siRNA knockdown of MrIR induces sex reversal in Macrobrachium rosenbergii. Aquaculture 2020, 523, 735172. [Google Scholar] [CrossRef]
  22. Zmora, N.; Chung, J.S. A novel hormone is required for the development of reproductive phenotypes in adult female crabs. Endocrinology 2014, 155, 230–239. [Google Scholar] [CrossRef] [PubMed]
  23. Zhu, D.; Feng, T.; Mo, N.; Han, R.; Lu, W.; Shao, S.; Cui, Z. New insights for the regulatory feedback loop between type 1 crustacean female sex hormone (CFSH-1) and insulin-like androgenic gland hormone (IAG) in the Chinese mitten crab (Eriocheir sinensis). Front. Physiol. 2022, 13, 1054773. [Google Scholar] [CrossRef] [PubMed]
  24. Ventura, T.; Cummins, S.F.; Fitzgibbon, Q.; Battaglene, S.; Elizur, A. Analysis of the central nervous system transcriptome of the eastern rock lobster Sagmariasus verreauxi reveals its putative neuropeptidome. PLoS ONE 2014, 9, e97323. [Google Scholar] [CrossRef] [PubMed]
  25. Veenstra, J.A. The power of next-generation sequencing as illustrated by the neuropeptidome of the crayfish Procambarus clarkii. Gen. Comp. Endocrinol. 2015, 224, 84–95. [Google Scholar] [CrossRef]
  26. Nguyen, T.V.; Cummins, S.F.; Elizur, A.; Ventura, T. Transcriptomic characterization and curation of candidate neuropeptides regulating reproduction in the eyestalk ganglia of the Australian crayfish, Cherax quadricarinatus. Sci. Rep. 2016, 6, 38658. [Google Scholar] [CrossRef] [PubMed]
  27. Veenstra, J.A. Similarities between decapod and insect neuropeptidomes. PeerJ 2016, 4, e2043. [Google Scholar] [CrossRef]
  28. Kotaka, S.; Ohira, T. cDNA cloning and in situ localization of a crustacean female sex hormone-like molecule in the kuruma prawn Marsupenaeus japonicus. Fish. Sci. 2018, 84, 53–60. [Google Scholar] [CrossRef]
  29. Tsutsui, N.; Kotaka, S.; Ohira, T.; Sakamoto, T. Characterization of distinct ovarian isoform of crustacean female sex hormone in the kuruma prawn Marsupenaeus japonicus. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2018, 217, 7–16. [Google Scholar] [CrossRef]
  30. Thongbuakaew, T.; Suwansa-ard, S.; Sretarugsa, P.; Sobhon, P.; Cummins, S.F. Identification and characterization of a crustacean female sex hormone in the giant freshwater prawn, Macrobrachium rosenbergii. Aquaculture 2019, 507, 56–68. [Google Scholar] [CrossRef]
  31. Saco, A.; Rey-Campos, M.; Rosani, U.; Novoa, B.; Figueras, A. The evolution and diversity of interleukin-17 highlight an expansion in marine invertebrates and its conserved role in mucosal immunity. Front. Immunol. 2021, 12, 692997. [Google Scholar] [CrossRef]
  32. Gonzalez-Fernandez, C.; Chaves-Pozo, E.; Cuesta, A. Identification and regulation of interleukin-17 (IL-17) family ligands in the teleost fish European sea bass. Int. J. Mol. Sci. 2020, 21, 2439. [Google Scholar] [CrossRef] [PubMed]
  33. Gu, C.F.; Wu, L.; Li, X.X. IL-17 family: Cytokines, receptors and signaling. Cytokine 2013, 64, 477–485. [Google Scholar] [CrossRef] [PubMed]
  34. Rast, J.P.; Smith, L.C.; Loza-Coll, M.; Hibino, T.; Litman, G.W. Review—Genomic insights into the immune system of the sea urchin. Science 2006, 314, 952–956. [Google Scholar] [CrossRef] [PubMed]
  35. Hibino, T.; Loza-Coll, M.; Messier, C.; Majeske, A.J.; Cohen, A.H.; Terwilliger, D.P.; Buckley, K.M.; Brockton, V.; Nair, S.V.; Berney, K.; et al. The immune gene repertoire encoded in the purple sea urchin genome. Dev. Biol. 2006, 300, 349–365. [Google Scholar] [CrossRef]
  36. Huang, X.D.; Zhang, H.; He, M.X. Comparative and evolutionary analysis of the Interleukin 17 gene family in invertebrates. PLoS ONE 2015, 10, e0132802. [Google Scholar] [CrossRef]
  37. Liu, F.; Huang, L.; Liu, A.; Jiang, Q.; Huang, H.; Ye, H. Identification of a putative CFSH receptor inhibiting IAG expression in crabs. Int. J. Mol. Sci. 2023, 24, 12240. [Google Scholar] [CrossRef]
  38. Baeza, J.A.; Behringer, D.C. Integrative taxonomy of the ornamental ‘peppermint’ shrimp public market and population genetics of Lysmata boggessi, the most heavily traded species worldwide. PeerJ 2017, 5, e3786. [Google Scholar] [CrossRef]
  39. Gaffen, S.L. Structure and signalling in the IL-17 receptor family. Nat. Rev. Immunol. 2009, 9, 556–567. [Google Scholar] [CrossRef]
  40. Amatya, N.; Garg, A.V.; Gaffen, S.L. IL-17 signaling: The Yin and the Yang. Trends. Immunol. 2017, 38, 310–322. [Google Scholar] [CrossRef]
  41. Cao, W.Q.; Wang, W.L.; Fan, S.Q.; Li, J.L.; Li, Q.; Wu, S.S.; Wang, L.L.; Song, L.S. The receptor CgIL-17R1 expressed in granulocytes mediates the CgIL-17 induced haemocytes proliferation in Crassostrea gigas. Dev. Comp. Immunol. 2022, 131, 104376. [Google Scholar] [CrossRef]
  42. Rosani, U.; Varotto, L.; Gerdol, M.; Pallavicini, A.; Venier, P. IL-17 signaling components in bivalves: Comparative sequence analysis and involvement in the immune responses. Dev. Comp. Immunol. 2015, 52, 255–268. [Google Scholar] [CrossRef] [PubMed]
  43. Terajima, D.; Yamada, S.; Uchino, R.; Ikawa, S.; Ikeda, M.; Shida, K.; Arai, Y.; Wang, H.G.; Satoh, N.; Satake, M. Identification and sequence of seventy-nine new transcripts expressed in hemocytes of Ciona intestinalis, three of which may be involved in characteristic cell-cell communication. DNA Res. 2003, 10, 203–212. [Google Scholar] [CrossRef] [PubMed]
Biomolecules 13 01456 g001
Figure 1. Phylogenetic tree of IL-17Rs (A) and CFSHs (B). Phylogenetic analysis was conducted using the Neighbor-Joining method, which is based on the Poisson model of MEGA7. The sequences used in the phylogenetic tree analysis of IL-17Rs and CFSHs are listed in Table A2 and Table A3, respectively. The numbers indicate bootstrap values based on 1000 replicates, as shown next to the branches. Lvit-IL-17R is indicated by a red solid arrow.
Figure 1. Phylogenetic tree of IL-17Rs (A) and CFSHs (B). Phylogenetic analysis was conducted using the Neighbor-Joining method, which is based on the Poisson model of MEGA7. The sequences used in the phylogenetic tree analysis of IL-17Rs and CFSHs are listed in Table A2 and Table A3, respectively. The numbers indicate bootstrap values based on 1000 replicates, as shown next to the branches. Lvit-IL-17R is indicated by a red solid arrow.
Biomolecules 13 01456 g001
Biomolecules 13 01456 g002
Figure 2. Spatial and temporal expression profiles of Lvit-IL-17R in L. vittata. (A) The tissue distribution profile of Lvit-IL-17R was generated using the RT-PCR assays of shrimps at the gonadal development of stage II. Lvit-β-actin was used as a positive control. (B) The expression profiles of Lvit-IL-17R in the androgenic gland, hepatopancreas, and ovarian regions during gonadal development through qRT-PCR. The Lvit-IL-17R expression levels were standardized using Lvit-β-actin expression levels (“A, B and C”, “a and b”, an “α, β, and γ”; p < 0.05; n = 4–5). Original WB images can be found in File S1.
Figure 2. Spatial and temporal expression profiles of Lvit-IL-17R in L. vittata. (A) The tissue distribution profile of Lvit-IL-17R was generated using the RT-PCR assays of shrimps at the gonadal development of stage II. Lvit-β-actin was used as a positive control. (B) The expression profiles of Lvit-IL-17R in the androgenic gland, hepatopancreas, and ovarian regions during gonadal development through qRT-PCR. The Lvit-IL-17R expression levels were standardized using Lvit-β-actin expression levels (“A, B and C”, “a and b”, an “α, β, and γ”; p < 0.05; n = 4–5). Original WB images can be found in File S1.
Biomolecules 13 01456 g002
Biomolecules 13 01456 g003
Figure 3. Pulldown assays conducted to detect the interaction between rCFSHs and Lvit-IL-17R. (A) Pulldown assays with rCFSH1a and rLvit-IL-17R. Lane M; protein marker; Lane 1: initially purified rCFSH1a; Lane 2: initially purified rLvit-IL-17R; Lane 3: initially purified GST protein; Lane 4: Eluent of beads after co-incubation with rCFSH1a and rLvit-IL-17R; Lane 5: Eluent of beads after co-incubation with GST and rLvit-IL-17R. (B) Pulldown assays with rCFSH1b and rLvit-IL-17R. Lane M; protein marker; Lane 1: initially purified rCFSH1b; Lane 2: initially purified rLvit-IL-17R; Lane 3: initially purified GST protein; Lane 4: Eluent of beads after co-incubation with rCFSH1b and rLvit-IL-17R; Lane 5: Eluent of beads after co-incubation with GST and rLvit-IL-17R. rCFSH1a, ~21.0 kDa, marked with purple dashed box; rCFSH1b, ~24.8 kDa, marked with red dashed box; GST protein, ~28.3 kDa, marked with gray dashed box; rLvit-IL-17R, ~62.8 kDa, marked with blue dashed box. Original WB images can be found in File S1.
Figure 3. Pulldown assays conducted to detect the interaction between rCFSHs and Lvit-IL-17R. (A) Pulldown assays with rCFSH1a and rLvit-IL-17R. Lane M; protein marker; Lane 1: initially purified rCFSH1a; Lane 2: initially purified rLvit-IL-17R; Lane 3: initially purified GST protein; Lane 4: Eluent of beads after co-incubation with rCFSH1a and rLvit-IL-17R; Lane 5: Eluent of beads after co-incubation with GST and rLvit-IL-17R. (B) Pulldown assays with rCFSH1b and rLvit-IL-17R. Lane M; protein marker; Lane 1: initially purified rCFSH1b; Lane 2: initially purified rLvit-IL-17R; Lane 3: initially purified GST protein; Lane 4: Eluent of beads after co-incubation with rCFSH1b and rLvit-IL-17R; Lane 5: Eluent of beads after co-incubation with GST and rLvit-IL-17R. rCFSH1a, ~21.0 kDa, marked with purple dashed box; rCFSH1b, ~24.8 kDa, marked with red dashed box; GST protein, ~28.3 kDa, marked with gray dashed box; rLvit-IL-17R, ~62.8 kDa, marked with blue dashed box. Original WB images can be found in File S1.
Biomolecules 13 01456 g003
Biomolecules 13 01456 g004
Figure 4. Short-term silencing experiment in vivo. The effectiveness of gene knockdown was evaluated in the androgenic gland (A), hepatopancreas (B), and ovarian regions (C). The expression of genes related to sexual differentiation (Lvit-IAG1 and Lvit-IAG2) (D,E) and ovarian development (Lvit-Vg and Lvit-VgR) (F,G) were also detected. The gene expression levels were standardized by Lvit-β-actin expression levels and represented as mean ± SD (“a and b”, p < 0.05; n = 5).
Figure 4. Short-term silencing experiment in vivo. The effectiveness of gene knockdown was evaluated in the androgenic gland (A), hepatopancreas (B), and ovarian regions (C). The expression of genes related to sexual differentiation (Lvit-IAG1 and Lvit-IAG2) (D,E) and ovarian development (Lvit-Vg and Lvit-VgR) (F,G) were also detected. The gene expression levels were standardized by Lvit-β-actin expression levels and represented as mean ± SD (“a and b”, p < 0.05; n = 5).
Biomolecules 13 01456 g004
Biomolecules 13 01456 g005
Figure 5. Long-term silencing experiment in vivo. The effectiveness of gene knockdown was evaluated in the androgenic gland (A), hepatopancreas (B), and ovarian regions (C). The effect of Lvit-IL-17R knockdown on L. vittata growth was also assessed. The carapace length (D) and body weight (E) were measured (“a and b”, p < 0.05; n = 5–6).
Figure 5. Long-term silencing experiment in vivo. The effectiveness of gene knockdown was evaluated in the androgenic gland (A), hepatopancreas (B), and ovarian regions (C). The effect of Lvit-IL-17R knockdown on L. vittata growth was also assessed. The carapace length (D) and body weight (E) were measured (“a and b”, p < 0.05; n = 5–6).
Biomolecules 13 01456 g005
Biomolecules 13 01456 g006
Figure 6. Effect of long-term Lvit-IL-17R silencing on female sexual differentiation. (A) Effect of long-term Lvit-IL-17R silencing on female gonopores. Female gonopores were marked with red dotted circles. (B) Effect of long-term Lvit-IL-17R silencing on ovarian development. Ovotestes were photographed to examine tissue morphology. The histological features were further analyzed via H & E staining. Ovd: oviduct; Ova: ovary; Spd: sperm duct; Tes: testis; Ooc: oocytes; Fc: follicular cell. (C) The long and short axis lengths of each oocyte were measured and averaged, yielding the diameter for each cell (“a and b”, p < 0.05; n = 5–6). (D) Expression levels of Lvit-VgR in ovarian regions and Lvit-Vg in hepatopancreas were also detected (“a and b”, p < 0.05; n = 5–6).
Figure 6. Effect of long-term Lvit-IL-17R silencing on female sexual differentiation. (A) Effect of long-term Lvit-IL-17R silencing on female gonopores. Female gonopores were marked with red dotted circles. (B) Effect of long-term Lvit-IL-17R silencing on ovarian development. Ovotestes were photographed to examine tissue morphology. The histological features were further analyzed via H & E staining. Ovd: oviduct; Ova: ovary; Spd: sperm duct; Tes: testis; Ooc: oocytes; Fc: follicular cell. (C) The long and short axis lengths of each oocyte were measured and averaged, yielding the diameter for each cell (“a and b”, p < 0.05; n = 5–6). (D) Expression levels of Lvit-VgR in ovarian regions and Lvit-Vg in hepatopancreas were also detected (“a and b”, p < 0.05; n = 5–6).
Biomolecules 13 01456 g006
Biomolecules 13 01456 g007
Figure 7. Effect of long-term Lvit-IL-17R silencing on male sexual differentiation. (A) Expression levels of Lvit-IAG1 and Lvit-IAG2 in androgenic gland were detected (“a and b”, p < 0.05; n = 5–6). (B) Effect of long-term Lvit-IL-17R silencing on the development of male external phenotypes. AM and AI are represented by yellow and white dash lines, respectively. Cincinnuli are marked with red solid arrows. Male gonopores were indicated by blue dotted circles. AM: appendices masculinae; AI: appendix interna. (C) The length of AM and AI were measured, and the normalized length of AM (AM/AI) was calculated (“a and b”, p < 0.05; n = 5–6). (D) Effect of long-term Lvit-IL-17R silencing on testicular development. H & E staining was employed to analyze histological features of testicular regions. Sg: spermatogonia; Sc I: primary spermatocyte; Sd: spermatid; Sz: spermatozoa.
Figure 7. Effect of long-term Lvit-IL-17R silencing on male sexual differentiation. (A) Expression levels of Lvit-IAG1 and Lvit-IAG2 in androgenic gland were detected (“a and b”, p < 0.05; n = 5–6). (B) Effect of long-term Lvit-IL-17R silencing on the development of male external phenotypes. AM and AI are represented by yellow and white dash lines, respectively. Cincinnuli are marked with red solid arrows. Male gonopores were indicated by blue dotted circles. AM: appendices masculinae; AI: appendix interna. (C) The length of AM and AI were measured, and the normalized length of AM (AM/AI) was calculated (“a and b”, p < 0.05; n = 5–6). (D) Effect of long-term Lvit-IL-17R silencing on testicular development. H & E staining was employed to analyze histological features of testicular regions. Sg: spermatogonia; Sc I: primary spermatocyte; Sd: spermatid; Sz: spermatozoa.
Biomolecules 13 01456 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, F.; Liu, A.; Ye, H. Identification of Crustacean Female Sex Hormone Receptor Involved in Sexual Differentiation of a Hermaphroditic Shrimp. Biomolecules 2023, 13, 1456. https://doi.org/10.3390/biom13101456

AMA Style

Liu F, Liu A, Ye H. Identification of Crustacean Female Sex Hormone Receptor Involved in Sexual Differentiation of a Hermaphroditic Shrimp. Biomolecules. 2023; 13(10):1456. https://doi.org/10.3390/biom13101456

Chicago/Turabian Style

Liu, Fang, An Liu, and Haihui Ye. 2023. "Identification of Crustacean Female Sex Hormone Receptor Involved in Sexual Differentiation of a Hermaphroditic Shrimp" Biomolecules 13, no. 10: 1456. https://doi.org/10.3390/biom13101456

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop