Effects of Hypoxia on Proliferation and Differentiation in Belgian Blue and Hanwoo Muscle Satellite Cells for the Development of Cultured Meat
Abstract
:1. Introduction
2. Materials and Methods
2.1. Primary Bovine Myosatellite Cell Isolation and Fluorescence-Activated Cell Sorting (FACS)
2.2. Myosatellite Cell Culture
2.3. Cell Proliferation Assay
2.4. Cell and Cell Nuclei Counting
2.5. Immunofluorescence Staining
2.6. Fusion Index
2.7. Myotube Diameter
2.8. Total Protein and Western Blotting
2.9. Real-Time Reverse Transcription (RT)-Quantitative PCR
2.10. Statistical Analysis
3. Results
3.1. High Proliferative Capacity in Long-Term Cultures of Belgian Blue Muscle Satellite Cells Cultured under Hypoxic Conditions
3.2. Belgian Blue Muscle Cells Cultured under Hypoxic Conditions Have more Myotube Formation in Differentiation Phases
3.3. High Proliferative Capacity in Long-Term Cultures of Hanwoo Muscle Satellite Cells Cultured under Hypoxic Conditions
3.4. Comparison of Relative Proliferation mRNA Levels and Cell Proliferation Proteins Immunofluorescence Staining in Hanwoo Myosatellite Cells
3.5. Comparison of Muscle Cell Differentiation Marker mRNA and Muscle Differentiation Protein in Hypoxic Conditions
3.6. Differentiation of Hanwoo Myoblasts into Myotubes and Their Characteristics in Hypoxia and Normoxia
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Population Matters. Population: The Numbers. 2021. Available online: https://populationmatters.org/population-numbers? (accessed on 13 June 2022).
- Singh, R.P.; Chintagunta, A.D.; Agarwal, D.K.; Kureel, R.S.; Kumar, S.J. Varietal replacement rate: Prospects and challenges for global food security. Glob. Food Secur. 2020, 25, 100324. [Google Scholar] [CrossRef]
- United Nations. The Sustainable Development Goals Report 2018; United Nations Organization: New York, NY, USA, 2018; pp. 1–40. [Google Scholar]
- Food and Agriculture Organization of the United Nations (FAO). Livestock Geographic Transition. 2005. Available online: http://www.fao.org/3/a0701e/a0701e02.pdf (accessed on 13 June 2022).
- Food and Agriculture Organization of the United Nations (FAO). Meat and Meat Products. 2019. Available online: http://www.fao.org/ag/againfo/themes/en/meat/home.html (accessed on 13 June 2022).
- Asakura, A.; Hirai, H.; Kablar, B.; Morita, S.; Ishibashi, J.; Piras, B.A.; Christ, A.J.; Verma, M.; Vineretsky, K.A.; Rudnicki, M.A. Increased survival of muscle stem cells lacking the MyoD gene after transplantation into regenerating skeletal muscle. Proc. Natl. Acad. Sci. USA 2007, 104, 16552–16557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gayraud-Morel, B.; Chrétien, F.; Flamant, P.; Gomès, D.; Zammit, P.S.; Tajbakhsh, S. A role for the myogenic determination gene Myf5 in adult regenerative myogenesis. Dev. Biol. 2007, 312, 13–28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zammit, P.S.; Partridge, T.A.; Yablonka-Reuveni, Z. The Skeletal Muscle Satellite Cell: The Stem Cell That Came in From the Cold. J. Histochem. Cytochem. 2006, 54, 1177–1191. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lepper, C.; Partridge, T.A.; Fan, C.-M. An absolute requirement for Pax7-positive satellite cells in acute injury-induced skeletal muscle regeneration. Development 2011, 138, 3647–3656. [Google Scholar] [CrossRef] [Green Version]
- Rocheteau, P.; Giraud-Morel, B.; Siegl-Cachedenier, I.; Blasco, M.A.; Tajbakhsh, S. A Subpopulation of Adult Skeletal Muscle Stem Cells Retains All Template DNA Strands after Cell Division. Cell 2012, 148, 112–125. [Google Scholar] [CrossRef] [Green Version]
- Cornelison, D.D.W.; Wold, B.J. Single-Cell Analysis of Regulatory Gene Expression in Quiescent and Activated Mouse Skeletal Muscle Satellite Cells. Dev. Biol. 1997, 191, 270–283. [Google Scholar] [CrossRef] [Green Version]
- Kuang, S.; Kuroda, K.; Le Grand, F.; Fudnicki, M.A. Asymmetric Self-Renewal and Commitment of Satellite Stem Cells in Muscle. Cell 2007, 129, 999–1010. [Google Scholar] [CrossRef] [Green Version]
- Hawke, T.J.; Garry, D.J. Myogenic satellite cells: Physiology to molecular biology. J. Appl. Physiol. 2001, 91, 534–551. [Google Scholar] [CrossRef]
- Collins, C.A.; Olsen, I.; Zammit, P.S.; Heslop, L.; Petrie, A.; Partridge, T.A.; Morgan, J.E. Stem Cell Function, Self-Renewal, and Behavioral Heterogeneity of Cells from the Adult Muscle Satellite Cell Niche. Cell 2005, 122, 289–301. [Google Scholar] [CrossRef] [Green Version]
- Yin, H.; Price, F.; Rudnicki, M.A. Satellite Cells and the Muscle Stem Cell Niche. Physiol. Rev. 2013, 93, 23–67. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhat, Z.F.; Fayaz, H. Prospectus of cultured meat—advancing meat alternatives. J. Food Sci. Technol. 2011, 48, 125–140. [Google Scholar] [CrossRef] [Green Version]
- Stephens, N.; Di Silvio, L.; Dunsford, I.; Ellis, M.; Glencross, A.; Sexton, A. Bringing cultured meat to market: Technical, socio-political, and regulatory challenges in cellular agriculture. Trends Food Sci. Technol. 2018, 78, 155–166. [Google Scholar] [CrossRef] [PubMed]
- Mas-Bargues, C.; Sanz-Ros, J.; Roman-Dominguez, A.; Ingles, M.; Gimeno-Mallench, L.; El Alami, M.; Vina-Almunia, J.; Gambini, J.; Vina, J.; Borras, C. Relevance of Oxygen Concentration in Stem Cell Culture for Regenerative Medicine. Int. J. Mol. Sci. 2019, 20, 1195. [Google Scholar] [CrossRef] [Green Version]
- Brahimi-Horn, M.C.; Pouyssegur, J. Oxygen, a source of life and stress. FEBS Lett. 2007, 581, 3582–3591. [Google Scholar] [CrossRef]
- Greenbaum, A.R.; Etherington, P.J.E.; Manek, S.; O’Hare, D.; Parker, K.H.; Green, C.J.; Pepper, J.R.; Winlove, C.P. Measurements of oxygenation and perfusion in skeletal muscle using multiple microelectrodes. J. Muscle Res. Cell Motil. 1997, 18, 149–159. [Google Scholar] [CrossRef]
- Richardson, R.S.; Noyszewski, E.A.; Leigh, J.S.; Wagner, P.D. Lactate efflux from exercising human skeletal muscle: Role of intracellular PO2. J. Appl. Physiol. 1998, 85, 627–634. [Google Scholar] [CrossRef]
- Li, X.; Zhu, L.; Chen, X.; Fan, M. Effects of hypoxia on proliferation and differentiation of myoblasts. Med. Hypotheses 2007, 69, 629–636. [Google Scholar] [CrossRef]
- Urbani, L.; Piccoli, M.; Franzin, C.; Pozzobon, M.; De Coppi, P. Hypoxia Increases Mouse Satellite Cell Clone Proliferation Maintaining both In Vitro and In Vivo Heterogeneity and Myogenic Potential. PLoS ONE 2012, 7, e49860. [Google Scholar] [CrossRef]
- Redshaw, Z.; Loughna, P.T. Oxygen concentration modulates the differentiation of muscle stem cells toward myogenic and adipogenic fates. Differentiation 2012, 84, 193–202. [Google Scholar] [CrossRef]
- Grayson, W.L.; Zhao, F.; Bunnell, B.; Ma, T. Hypoxia enhances proliferation and tissue formation of human mesenchymal stem cells. Biochem. Biophys. Res. Commun. 2007, 358, 948–953. [Google Scholar] [CrossRef] [PubMed]
- Koning, M.; Werker, P.M.N.; van Luyn, M.J.; Harmsen, M.C. Hypoxia Promotes Proliferation of Human Myogenic Satellite Cells: A Potential Benefactor in Tissue Engineering of Skeletal Muscle. Tissue Eng. Part A 2011, 17, 1747–1758. [Google Scholar] [CrossRef]
- Agley, C.C.; Velloso, C.P.; Lazarus, N.R.; Harridge, S.D. An Image Analysis Method for the Precise Selection and Quantitation of Fluorescently Labeled Cellular Constituents. J. Histochem. Cytochem. 2012, 60, 428–438. [Google Scholar] [CrossRef] [Green Version]
- Kambadur, R.; Sharma, M.; Smith, T.P.L.; Bass, J.J. Mutations in myostatin (GDF8) in Double-Muscled Belgian Blue and Piedmontese Cattle. Genome Res. 1997, 7, 910–916. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, S.H.; Park, B.H.; Sharma, A.; Dang, C.G.; Lee, S.S.; Choi, T.J.; Choy, Y.H.; Kim, H.C.; Jeon, K.J.; Kim, S.D.; et al. Hanwoo Cattle: Origin, Domestication, Breeding, Strategies and Genomic Selection. J. Anim. Sci. Technol. 2014, 56, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kook, S.H.; Son, Y.O.; Lee, K.Y.; Lee, H.Y.; Chung, W.T.; Choi, K.C.; Lee, J.C. Hypoxia affects positively the proliferation of bovine satellite cells and their myogenic differentiation through up-regulation of MyoD. Cell Biol. Int. 2008, 32, 871–878. [Google Scholar] [CrossRef]
- Martin, N.R.; Passey, S.L.; Player, D.J.; Mudera, V.; Baar, K.; Greensmith, L.; Lewis, M.P. Neuromuscular Junction Formation in Tissue-Engineered Skeletal Muscle Augments Contractile Function and Improves Cytoskeletal Organization. Tissue Eng. Part A 2015, 21, 2595–2604. [Google Scholar] [CrossRef] [Green Version]
- Jones, J.M.; Player, D.J.; Martin, N.R.W.; Capel, A.J.; Lewis, M.P.; Mudera, V. An Assessment of Myotube Morphology, Matrix Deformation, and Myogenic mRNA Expression in Custom-Built and Commercially Available Engineered Muscle Chamber Configurations. Front. Physiol. 2018, 9, 483. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Rodgers, J.T.; King, K.Y.; Brett, J.O.; Cromie, M.J.; Charville, G.W.; Maguire, K.K.; Brunson, C.; Mastey, N.; Liu, L.; Tsai, C.R.; et al. mTORC1 controls the adaptive transition of quiescent stem cells from G0 to GAlert. Nature 2014, 510, 393–396. [Google Scholar] [CrossRef]
- Shea, K.L.; Xiang, W.; LaPorta, V.S.; Licht, J.D.; Keller, C.; Basson, M.A.; Brack, A.S. Sprouty1 Regulates Reversible Quiescence of a Self-Renewing Adult Muscle Stem Cell Pool during Regeneration. Cell Stem Cell 2010, 6, 117–129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zammit, P.S. All muscle satellite cells are equal, but are some more equal than others? J. Cell Sci. 2008, 121, 2975–2982. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parrinello, S.; Samper, E.; Krtolica, A.; Goldstein, J.; Melov, S.; Campisi, J. Oxygen sensitivity severely limits the replicative lifespan of murine fibroblasts. Nat. Cell Biol. 2003, 5, 741–747. [Google Scholar] [CrossRef] [PubMed]
- Crist, C.G.; Montarras, D.; Buckingham, M. Muscle Satellite Cells Are Primed for Myogenesis but Maintain Quiescence with Sequestration of Myf5 mRNA Targeted by microRNA-31 in mRNP Granules. Cell Stem Cell 2012, 11, 118–126. [Google Scholar] [CrossRef] [Green Version]
- Dinicu, A. Characterization of MyoD and Myf5 Double-Knockout Muscle Stem Cells during Muscle Development. Honors Thesis, University of Connecticut, Storrs, CT, USA, 2017. [Google Scholar]
- Wakelam, M.J.O.; Pette, D.; Barnoy, S.; Supino-Rosin, L.; Kosower, N.S.; Holland, P.C.; Herscovics, A. The fusion of myoblasts. Biochem. J. 1985, 228, 1. [Google Scholar] [CrossRef] [PubMed]
- Ren, K.; Crouzier, T.; Roy, C.; Picart, C. Polyelectrolyte Multilayer Films of Controlled Stiffness Modulate Myoblast Cell Differentiation. Adv. Funct. Mater. 2008, 18, 1378–1389. [Google Scholar] [CrossRef] [Green Version]
- Vito, A.; El-Sayes, N.; Mossman, K. Hypoxia-Driven Immune Escape in the Tumor Microenvironment. Cells 2020, 9, 992. [Google Scholar] [CrossRef]
Primer | Sequence (5′-3′) |
---|---|
Pax7 | F: CTCCCTCTGAAGCGTAAGCA R: GGGTAGTGGGTCCTCTCGAA |
Myf5 | F: AGGATCCAGCCTCTCTCTCC R: TTGCTTTGGGGTTTTTGGTA |
MyoD | F: GCAACAGCGGACGACTTCTA R: AGGGAAGTGCGAGTGTTCCT |
HIF-1ɑ | F: AGGACAAGTCACAACAGGAC R: AAAATCAAGTCGTGCTGAAT |
Myogenin | F: AGAAGGTGAATGAAGCCTTCGA R: GCAGGCGCTCTATGTACTGGAT |
Myosin | F: CGACAAGATCGAGGACATGG R: AGATGGAGAAGATGTGGGGC |
TOM20 | F: GAATATGAGAAGGGTGTGGA R: AATTGTTGGGAGCTTAGTCA |
GAPDH | F: CACCACCATGGAGAAGGCCG R: GAACACGGAAGGCCATGCCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, S.; Gagliardi, M.; Swennen, G.; Dogan, A.; Kim, Y.; Park, Y.; Park, G.; Oh, S.; Post, M.; Choi, J. Effects of Hypoxia on Proliferation and Differentiation in Belgian Blue and Hanwoo Muscle Satellite Cells for the Development of Cultured Meat. Biomolecules 2022, 12, 838. https://doi.org/10.3390/biom12060838
Park S, Gagliardi M, Swennen G, Dogan A, Kim Y, Park Y, Park G, Oh S, Post M, Choi J. Effects of Hypoxia on Proliferation and Differentiation in Belgian Blue and Hanwoo Muscle Satellite Cells for the Development of Cultured Meat. Biomolecules. 2022; 12(6):838. https://doi.org/10.3390/biom12060838
Chicago/Turabian StylePark, Sanghun, Mick Gagliardi, Geertje Swennen, Arin Dogan, Yuna Kim, Yunhwan Park, Gyutae Park, Sehyuk Oh, Mark Post, and Jungseok Choi. 2022. "Effects of Hypoxia on Proliferation and Differentiation in Belgian Blue and Hanwoo Muscle Satellite Cells for the Development of Cultured Meat" Biomolecules 12, no. 6: 838. https://doi.org/10.3390/biom12060838