Next-Generation Sequencing Gene Panels in Inheritable Cardiomyopathies and Channelopathies: Prevalence of Pathogenic Variants and Variants of Unknown Significance in Uncommon Genes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patient Enrolment and DNA Extraction
2.2. Molecular Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
NGS | Next-generation sequencing |
VUS | Variants of unknown significance |
SCD | Sudden cardiac death |
HCM | Hypertrophic cardiomyopathy |
ACM | Arrhythmogenic cardiomyopathy |
DCM | Dilated cardiomyopathy |
LQTS | Long QT syndrome |
BrS | Brugada syndrome |
SQTS | Short QT syndrome |
CPVT | Catecholaminergic polymorphic ventricular tachycardia |
MYBPC3 | Cardiac myosin binding protein 3 |
MYH7 | β-myosin heavy chain |
TNNT2 | Cardiac troponin T |
TNNI3 | Cardiac troponin I |
TPM1 | α-tropomyosin |
ACTC1 | Cardiac α-actin |
MYL2 | Myosin regulatory light chain |
MYL3 | Myosin essential light chain |
MYOZ2 | Myozenin 2 gene |
ACTN2 | α-actinin-2 |
TTN | Titin |
MYOM1 | Myomesin 1 |
ANKRD1 | Cardiac ankyrin repeat protein 1 |
TCAP | Telethonin |
PKP2 | Plakophilin |
DSP | Desmoplakin |
DSC2 | Desmocollin 2 |
DSG2 | Desmoglein |
TMEM43 | Transmembrane protein 43 |
PLN | Phospholamban |
CDH2 | Cadherin-2 |
CTNNA3 | Catenin alpha 3 |
FLNC | Filamin C |
TJP1 | Tight junction protein 1 |
ANK2 | Ankyrin 2 |
TP63 | Tumor protein P63 |
SCN10A | sodium voltage-gated channel alpha subunit 10 |
CACNA1C | Calcium voltage-gated channel subunit alpha1 c |
ABCC9 | ATP binding cassette subfamily c member 9 |
SCN1B | Sodium voltage-gated channel beta subunit 1 |
KCNH2 | Potassium voltage-gated channel subfamily h member 2 |
CACNB2 | Calcium voltage-gated channel auxiliary subunit beta 2 |
TRPM4 | Transient receptor potential cation channel subfamily m member 4 |
ANK3 | Ankyrin 3 |
CACNA2D1 | Calcium voltage-gated channel auxiliary subunit alpha2delta 1 |
FGF12 | Fibroblast growth factor 12 |
GPD1L | Glycerol-3-phosphate dehydrogenase 1 like |
HCN4 | Hyperpolarization activated cyclic nucleotide gated potassium channel 4 |
KCNQ1 | Potassium voltage-gated channel subfamily q member 1 |
KCNH2 | Potassium voltage-gated channel subfamily h member 2 |
SCN5A | Sodium voltage-gated channel alpha subunit 5 |
AKAP9 | a-Kinase anchoring protein 9 |
RYR2 | Ryanodine receptor 2 |
CASQ2 | Calsequestrin 2 |
CALM1 | Calmodulin 1 |
CALM2 | Calmodulin 2 |
CALM3 | Calmodulin 3 |
KCNJ2 | Potassium inwardly rectifying channel subfamily j member 2 |
TRDN | Triadin |
ACMG | American College of Medical Genetics and Genomics |
RAF1 | RAF-1 proto-oncogene, serine/threonine kinase |
LDLR | Low-density lipoprotein receptor |
GAA | Glucosidase alpha, acid |
LP | Likely pathogenic |
FHL1 | Four and a half LIM domains 1 |
P | Pathogenic |
LP | Likely pathogenic |
B | Benign |
LB | Likely benign |
ESC | European Society of Cardiology |
AHA | American Heart Association |
ACC | American College of Cardiology |
References
- Schaufelberger, M. Cardiomyopathy and pregnancy. Heart 2019, 105, 1543–1551. [Google Scholar] [CrossRef]
- McKenna, W.J.; Maron, B.J.; Thiene, G. Classification, Epidemiology, and Global Burden of Cardiomyopathies. Circ. Res. 2017, 121, 722–730. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burke, M.A.; Cook, S.A.; Seidman, J.G.; Seidman, C.E. Clinical and Mechanistic Insights Into the Genetics of Cardiomyopathy. J. Am. Coll. Cardiol. 2016, 68, 2871–2886. [Google Scholar] [CrossRef] [PubMed]
- Ackerman, M.J.; Priori, S.G.; Willems, S.; Berul, C.; Brugada, R.; Calkins, H.; Camm, A.J.; Ellinor, P.T.; Gollob, M.; Hamilton, R.; et al. HRS/EHRA Expert Consensus Statement on the State of Genetic Testing for the Channelopathies and Cardiomyopathies. Heart Rhythm 2011, 8, 1308–1339. [Google Scholar] [CrossRef]
- Mazzaccara, C.; Mirra, B.; Barretta, F.; Lombardo, B.; Scudiero, O.; Frisso, G. Sudden cardiac death in young athletes: Literature review of molecular basis. Cardiogenetics 2020, 10, 8860. [Google Scholar] [CrossRef] [Green Version]
- Limongelli, G.; Nunziato, M.; D’Argenio, V.; Esposito, M.V.; Monda, E.; Mazzaccara, C.; Caiazza, M.; D’Aponte, A.; D’Andrea, A.; Bossone, E.; et al. Yield and clinical significance of genetic screening in elite and amateur athletes. Eur. J. Prev. Cardiol. 2021, 28, 1081–1090. [Google Scholar] [CrossRef]
- D’Argenio, V.; Esposito, M.V.; Nunziato, M.; De Simone, A.; Buono, P.; Salvatore, F.; Frisso, G. Molecular diagnosis of Brugada syndrome via next-generation sequencing of a multigene panel in a young athlete. Med. Sport 2018, 71, 27–34. [Google Scholar]
- Lombardo, B.; Izzo, V.; Terracciano, D.; Ranieri, A.; Mazzaccara, C.; Fimiani, F.; Cesaro, A.; Gentile, L.; Leggiero, E.; Pero, R.; et al. Laboratory medicine: Health evaluation in elite athletes. Clin. Chem. Labo. Med. 2019, 57, 1450–1473. [Google Scholar] [CrossRef] [PubMed]
- Monda, E.; Sarubbi, B.; Russo, M.G.; Caiazza, M.; Mazzaccara, C.; Magrelli, J.; Rubino, M.; Esposito, A.; Perna, A.; Passariello, A.; et al. Unexplained sudden cardiac arrest in children: Clinical and genetic characteristics of survivors. Eur. J. Prev. Cardiol. 2021, 28, 1134–1137. [Google Scholar] [CrossRef]
- Jacoby, D.; McKenna, W.J. Genetics of inherited cardiomyopathy. Eur. Heart J. 2012, 33, 296–304. [Google Scholar] [CrossRef] [Green Version]
- Watkins, H.; Ashrafian, H.; Redwood, C. Inherited cardiomyopathies. N. Engl. J. Med. 2011, 364, 1643–1656. [Google Scholar] [CrossRef] [PubMed]
- Maron, B.J.; Maron, M.S.; Semsarian, C. Genetics of hypertrophic cardiomyopathy after 20 years: Clinical perspectives. J. Am. Coll. Cardiol. 2012, 60, 705–715. [Google Scholar] [CrossRef] [Green Version]
- Norton, N.; Li, D.; Rampersaud, E.; Morales, A.; Martin, E.R.; Zuchner, S.; Guo, S.; Gonzalez, M.; Hedges, D.J.; Robertson, P.D.; et al. Exome sequencing and genome-wide linkage analysis in 17 families illustrate the complex contribution of TTN truncating variants to dilated cardiomyopathy. Circ. Cardiovasc. Genet. 2013, 6, 144–153. [Google Scholar] [CrossRef]
- Hershberger, R.E.; Siegfried, J.D. Update 2011: Clinical and genetic issues in familial dilated cardiomyopathy. J. Am. Coll. Cardiol. 2011, 57, 1641–1649. [Google Scholar] [CrossRef] [Green Version]
- Wilde, A.A.M.; Amin, A. Channelopathies, genetic testing and risk stratification. Int. J. Cardiol. 2017, 237, 53–55. [Google Scholar] [CrossRef]
- Villard, E.; Perret, C.; Gary, F.; Proust, C.; Dilanian, G.; Hengstenberg, C.; Ruppert, V.; Arbustini, E.; Wichter, T.; Germain, M.; et al. A genome-wide association study identifies two loci associated with heart failure due to dilated cardiomyopathy. Eur. Heart J. 2011, 32, 1065–1076. [Google Scholar] [CrossRef] [Green Version]
- Detta, N.; Frisso, G.; Limongelli, G.; Marzullo, M.; Calabro, R.; Salvatore, F. Genetic analysis in a family affected by sick sinus syndrome may reduce the sudden death risk in a young aspiring competitive athlete. Int. J. Cardiol. 2014, 170, E63–E65. [Google Scholar] [CrossRef] [Green Version]
- D’Argenio, V.; Frisso, G.; Precone, V.; Boccia, A.; Fienga, A.; Pacileo, G.; Limongelli, G.; Paolella, G.; Calabro, R.; Salvatore, F. DNA Sequence Capture and Next-Generation Sequencing for the Molecular Diagnosis of Genetic Cardiomyopathies. J. Mol. Diagn. 2014, 16, 32–44. [Google Scholar] [CrossRef]
- Frisso, G.; Limongelli, G.; Pacileo, G.; Del Giudice, A.; Forgione, L.; Calabro, P.; Iacomino, M.; Detta, N.; Di Fonzo, L.M.; Maddaloni, V.; et al. A child cohort study from southern Italy enlarges the genetic spectrum of hypertrophic cardiomyopathy. Clin. Genet. 2009, 76, 91–101. [Google Scholar] [CrossRef]
- Jarcho, J.A.; McKenna, W.; Pare, J.A.; Solomon, S.D.; Holcombe, R.F.; Dickie, S.; Levi, T.; Donis-Keller, H.; Seidman, J.G.; Seidman, C.E. Mapping a gene for familial hypertrophic cardiomyopathy to chromosome 14q1. N. Engl. J. Med. 1989, 321, 1372–1378. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meder, B.; Ruhle, F.; Weis, T.; Homuth, G.; Keller, A.; Franke, J.; Peil, B.; Bermejo, J.L.; Frese, K.; Huge, A.; et al. A genome-wide association study identifies 6p21 as novel risk locus for dilated cardiomyopathy. Eur. Heart J. 2014, 35, 1069–1077. [Google Scholar] [CrossRef]
- Mazzanti, A.; Underwood, K.; Nevelev, D.; Kofman, S.; Priori, S.G. The new kids on the block of arrhythmogenic disorders: Short QT syndrome and early repolarization. J. Cardiovasc. Electr. 2017, 28, 1226–1236. [Google Scholar] [CrossRef] [PubMed]
- Elliott, P.M.; Anastasakis, A.; Borger, M.A.; Borggrefe, M.; Cecchi, F.; Charron, P.; Hagege, A.A.; Lafont, A.; Limongelli, G.; Mahrholdt, H.; et al. 2014 ESC Guidelines on diagnosis and management of hypertrophic cardiomyopathy The Task Force for the Diagnosis and Management of Hypertrophic Cardiomyopathy of the European Society of Cardiology (ESC). Eur. Heart J. 2014, 35, 2733–2779. [Google Scholar]
- Lee, H.H.; Ching, C.K. Practical Aspects in Genetic Testing for Cardiomyopathies and Channelopathies. Clin. Biochem. Rev. 2019, 40, 187–200. [Google Scholar] [CrossRef] [PubMed]
- Biagini, E.; Olivotto, I.; Iascone, M.; Parodi, M.I.; Girolami, F.; Frisso, G.; Autore, C.; Limongelli, G.; Cecconi, M.; Maron, B.J.; et al. Significance of sarcomere gene mutations analysis in the end-stage phase of hypertrophic cardiomyopathy. Am. J. Cardiol. 2014, 114, 769–776. [Google Scholar] [CrossRef]
- Mazzaccara, C.; D’Argenio, V.; Nunziato, M.; Esposito, M.V.; Salvatore, F.; Frisso, G. Clinical molecular biology in the assessment and prevention of cardiological risk in case of participation in sports activity and intense physical activity. Biochim. Clin. 2019, 43, 24–43. [Google Scholar]
- Girolami, F.; Frisso, G.; Benelli, M.; Crotti, L.; Iascone, M.; Mango, R.; Mazzaccara, C.; Pilichou, K.; Arbustini, E.; Tomberli, B.; et al. Contemporary genetic testing in inherited cardiac disease: Tools, ethical issues, and clinical applications. J. Cardiovasc. Med. 2018, 19, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Marian, A.J.; Braunwald, E. Hypertrophic Cardiomyopathy Genetics, Pathogenesis, Clinical Manifestations, Diagnosis, and Therapy. Circ. Res. 2017, 121, 749–770. [Google Scholar] [CrossRef]
- Lopes, L.R.; Garcia-Hernandez, S.; Lorenzini, M.; Futema, M.; Chumakova, O.; Zateyshchikov, D.; Isidoro-Garcia, M.; Villacorta, E.; Escobar-Lopez, L.; Garcia-Pavia, P.; et al. Alpha-protein kinase 3 (ALPK3) truncating variants are a cause of autosomal dominant hypertrophic cardiomyopathy. Eur. Heart J. 2021, 42, 3063–3073. [Google Scholar] [CrossRef]
- Chiu, C.; Bagnall, R.D.; Ingles, J.; Yeates, L.; Kennerson, M.; Donald, J.A.; Jormakka, M.; Lind, J.M.; Semsarian, C. Mutations in Alpha-Actinin-2 Cause Hypertrophic Cardiomyopathy A Genome-Wide Analysis. J. Am. Coll. Cardiol. 2010, 55, 1127–1135. [Google Scholar] [CrossRef] [Green Version]
- Jordan, E.; Peterson, L.; Ai, T.; Asatryan, B.; Bronicki, L.; Brown, E.; Celeghin, R.; Edwards, M.; Fan, J.; Ingles, J.; et al. Evidence-Based Assessment of Genes in Dilated Cardiomyopathy. Circulation 2021, 144, 7–19. [Google Scholar] [CrossRef] [PubMed]
- Tabish, A.M.; Azzimato, V.; Alexiadis, A.; Buyandelger, B.; Knoll, R. Genetic epidemiology of titin-truncating variants in the etiology of dilated cardiomyopathy. Biophys. Rev. 2017, 9, 207–223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lakdawala, N.K.; Funke, B.H.; Baxter, S.; Cirino, A.L.; Roberts, A.E.; Judge, D.P.; Johnson, N.; Mendelsohn, N.J.; Morel, C.; Care, M.; et al. Genetic testing for dilated cardiomyopathy in clinical practice. J. Card. Fail. 2012, 18, 296–303. [Google Scholar] [CrossRef]
- Hershberger, R.E.; Hedges, D.J.; Morales, A. Dilated cardiomyopathy: The complexity of a diverse genetic architecture. Nat. Rev. Cardiol. 2013, 10, 531–547. [Google Scholar] [CrossRef]
- Japp, A.G.; Gulati, A.; Cook, S.A.; Cowie, M.R.; Prasad, S.K. The Diagnosis and Evaluation of Dilated Cardiomyopathy. J. Am. Coll. Cardiol. 2016, 67, 2996–3010. [Google Scholar] [CrossRef] [PubMed]
- Favalli, V.; Serio, A.; Grasso, M.; Arbustini, E. Genetic causes of dilated cardiomyopathy. Heart 2016, 102, 2004–2014. [Google Scholar] [CrossRef]
- Zhao, Y.; Feng, Y.; Zhang, Y.M.; Ding, X.X.; Song, Y.Z.; Zhang, A.M.; Liu, L.; Zhang, H.; Ding, J.H.; Xia, X.S. Targeted Next-Generation Sequencing Reveals Hot Spots and Doubly Heterozygous Mutations in Chinese Patients with Familial Cardiomyopathy. Biomed. Res. Int. 2015, 2015, 561819. [Google Scholar] [CrossRef] [Green Version]
- Spezzacatene, A.; Sinagra, G.; Merlo, M.; Barbati, G.; Graw, S.L.; Brun, F.; Slavov, D.; Di Lenarda, A.; Salcedo, E.E.; Towbin, J.A.; et al. Arrhythmogenic Phenotype in Dilated Cardiomyopathy: Natural History and Predictors of Life-Threatening Arrhythmias. J. Am. Heart Assoc. 2015, 4, e002149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zegkos, T.; Panagiotidis, T.; Parcharidou, D.; Efthimiadis, G. Emerging concepts in arrhythmogenic dilated cardiomyopathy. Heart Fail. Rev. 2021, 26, 1219–1229. [Google Scholar] [CrossRef]
- Peters, S.; Kumar, S.; Elliott, P.; Kalman, J.M.; Fatkin, D. Arrhythmic Genotypes in Familial Dilated Cardiomyopathy: Implications for Genetic Testing and Clinical Management. Heart Lung Circ. 2019, 28, 31–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van den Hoogenhof, M.M.G.; Beqqali, A.; Amin, A.S.; van der Made, I.; Aufiero, S.; Khan, M.A.F.; Schumacher, C.A.; Jansweijer, J.A.; van Spaendonck-Zwarts, K.Y.; Remme, C.A.; et al. RBM20 Mutations Induce an Arrhythmogenic Dilated Cardiomyopathy Related to Disturbed Calcium Handling. Circulation 2018, 138, 1330–1342. [Google Scholar] [CrossRef]
- Mazzaccara, C.; Limongelli, G.; Petretta, M.; Vastarella, R.; Pacileo, G.; Bonaduce, D.; Salvatore, F.; Frisso, G. A common polymorphism in the SCN5A gene is associated with dilated cardiomyopathy. J. Cardiovasc. Med. 2018, 19, 344–350. [Google Scholar]
- James, C.A.; Syrris, P.; van Tintelen, J.P.; Calkins, H. The role of genetics in cardiovascular disease: Arrhythmogenic cardiomyopathy. Eur. Heart J. 2020, 41, 1393–1400. [Google Scholar] [CrossRef]
- Stevens, T.L.; Wallace, M.J.; Refaey, M.E.; Roberts, J.D.; Koenig, S.N.; Mohler, P.J. Arrhythmogenic Cardiomyopathy: Molecular Insights for Improved Therapeutic Design. J. Cardiovasc. Dev. Dis. 2020, 7, 21. [Google Scholar]
- De Bortoli, M.; Postma, A.V.; Poloni, G.; Calore, M.; Minervini, G.; Mazzotti, E.; Rigato, I.; Ebert, M.; Lorenzon, A.; Vazza, G.; et al. Whole-Exome Sequencing Identifies Pathogenic Variants in TJP1 Gene Associated With Arrhythmogenic Cardiomyopathy. Circ. Genom. Precis. Med. 2018, 11, e002123. [Google Scholar] [CrossRef] [PubMed]
- Poloni, G.; Calore, M.; Rigato, I.; Marras, E.; Minervini, G.; Mazzotti, E.; Lorenzon, A.; Li Mura, I.E.A.; Telatin, A.; Zara, I.; et al. A targeted next-generation gene panel reveals a novel heterozygous nonsense variant in the TP63 gene in patients with arrhythmogenic cardiomyopathy. Heart Rhythm 2019, 16, 773–780. [Google Scholar] [CrossRef]
- Vio, R.; Angelini, A.; Basso, C.; Cipriani, A.; Zorzi, A.; Melacini, P.; Thiene, G.; Rampazzo, A.; Corrado, D.; Calore, C. Hypertrophic Cardiomyopathy and Primary Restrictive Cardiomyopathy: Similarities, Differences and Phenocopies. J. Clin. Med. 2021, 10, 1954. [Google Scholar] [PubMed]
- Waldmuller, S.; Schroeder, C.; Sturm, M.; Scheffold, T.; Imbrich, K.; Junker, S.; Frische, C.; Hofbeck, M.; Bauer, P.; Bonin, M.; et al. Targeted 46-gene and clinical exome sequencing for mutations causing cardiomyopathies. Mol. Cell. Probes 2015, 29, 308–314. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Barrios, E.; Cesar, S.; Cruzalegui, J.; Hernandez, C.; Arbelo, E.; Fiol, V.; Brugada, J.; Brugada, R.; Campuzano, O.; Sarquella-Brugada, G. Clinical Genetics of Inherited Arrhythmogenic Disease in the Pediatric Population. Biomedicines 2022, 10, 106. [Google Scholar] [CrossRef]
- Brugada, R.; Campuzano, O.; Sarquella-Brugada, G.; Brugada, J.; Brugada, P. Brugada syndrome. Methodist DeBakey Cardiovasc. J. 2014, 10, 25–28. [Google Scholar] [CrossRef] [PubMed]
- Walsh, R.; Adler, A.; Amin, A.S.; Abiusi, E.; Care, M.; Bikker, H.; Amenta, S.; Feilotter, H.; Nannenberg, E.A.; Mazzarotto, F.; et al. Evaluation of gene validity for CPVT and short QT syndrome in sudden arrhythmic death. Eur. Heart J. 2022, 43, 1500–1510. [Google Scholar] [CrossRef] [PubMed]
- Roston, T.M.; Yuchi, Z.; Kannankeril, P.J.; Hathaway, J.; Vinocur, J.M.; Etheridge, S.P.; Potts, J.E.; Maginot, K.R.; Salerno, J.C.; Cohen, M.I.; et al. The clinical and genetic spectrum of catecholaminergic polymorphic ventricular tachycardia: Findings from an international multicentre registry. Europace 2018, 20, 541–547. [Google Scholar] [CrossRef]
- Janin, A.; Januel, L.; Cazeneuve, C.; Deliniere, A.; Chevalier, P.; Millat, G. Molecular Diagnosis of Inherited Cardiac Diseases in the Era of Next-Generation Sequencing: A Single Center’s Experience Over 5 Years. Mol. Diagn. Ther. 2021, 25, 373–385. [Google Scholar] [CrossRef] [PubMed]
- Kalayinia, S.; Goodarzynejad, H.; Maleki, M.; Mahdieh, N. Next generation sequencing applications for cardiovascular disease. Ann. Med. 2018, 50, 91–109. [Google Scholar] [CrossRef]
- D’Argenio, V.; Esposito, M.V.; Barretta, F.; Mirra, B.; Caiazza, M.; Losi, M.A.; Limongelli, G.; Mazzaccara, C.; Frisso, G. Next-generation sequencing gene panels in inheritable cardiomyopathies and channelopaties: Yield of pathogenetic variants and variants of unknown significance in uncommon genes. Eur. Heart J. Suppl. 2020, 22, N83–N84. [Google Scholar]
- Mazzaccara, C.; Mirra, B.; Barretta, F.; Caiazza, M.; Lombardo, B.; Scudiero, O.; Tinto, N.; Limongelli, G.; Frisso, G. Molecular Epidemiology of Mitochondrial Cardiomyopathy: A Search Among Mitochondrial and Nuclear Genes. Int. J. Mol. Sci. 2021, 22, 5742. [Google Scholar] [CrossRef]
- Lombardo, B.; D’Argenio, V.; Monda, E.; Vitale, A.; Caiazza, M.; Sacchetti, L.; Pastore, L.; Limongelli, G.; Frisso, G.; Mazzaccara, C. Genetic analysis resolves differential diagnosis of a familial syndromic dilated cardiomyopathy: A new case of Alstrom syndrome. Mol. Genet. Genom. Med. 2020, 8, e1260. [Google Scholar] [CrossRef]
- Rehm, H.L.; Berg, J.S.; Brooks, L.D.; Bustamante, C.D.; Evans, J.P.; Landrum, M.J.; Ledbetter, D.H.; Maglott, D.R.; Martin, C.L.; Nussbaum, R.L.; et al. ClinGen—The Clinical Genome Resource. N. Engl. J. Med. 2015, 372, 2235–2242. [Google Scholar] [CrossRef] [Green Version]
- Strande, N.T.; Riggs, E.R.; Buchanan, A.H.; Ceyhan-Birsoy, O.; DiStefano, M.; Dwight, S.S.; Goldstein, J.; Ghosh, R.; Seifert, B.A.; Sneddon, T.P.; et al. Evaluating the Clinical Validity of Gene-Disease Associations: An Evidence-Based Framework Developed by the Clinical Genome Resource. Am. J. Hum. Genet. 2017, 100, 895–906. [Google Scholar]
- Assoc, W.M. World Medical Association Declaration of Helsinki Ethical Principles for Medical Research Involving Human Subjects. JAMA 2013, 310, 2191–2194. [Google Scholar]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef] [Green Version]
- Lin, Y.; Williams, N.; Wang, D.; Coetzee, W.; Zhou, B.; Eng, L.S.; Um, S.Y.; Bao, R.; Devinsky, O.; McDonald, T.V.; et al. Applying High-Resolution Variant Classification to Cardiac Arrhythmogenic Gene Testing in a Demographically Diverse Cohort of Sudden Unexplained Deaths. Circ. Cardiovasc. Genet. 2017, 10, e001839. [Google Scholar] [CrossRef]
- Van der Zwaag, P.A.; van Rijsingen, I.A.; Asimaki, A.; Jongbloed, J.D.; van Veldhuisen, D.J.; Wiesfeld, A.C.; Cox, M.G.; van Lochem, L.T.; de Boer, R.A.; Hofstra, R.M.; et al. Phospholamban R14del mutation in patients diagnosed with dilated cardiomyopathy or arrhythmogenic right ventricular cardiomyopathy: Evidence supporting the concept of arrhythmogenic cardiomyopathy. Eur. J. Heart Fail. 2012, 14, 1199–1207. [Google Scholar] [CrossRef] [Green Version]
- Frank-Hansen, R.; Page, S.P.; Syrris, P.; McKenna, W.J.; Christiansen, M.; Andersen, P.S. Micro-exons of the cardiac myosin binding protein C gene: Flanking introns contain a disproportionately large number of hypertrophic cardiomyopathy mutations. Eur. J. Hum. Genet. 2008, 16, 1062–1069. [Google Scholar] [CrossRef] [PubMed]
- Brito, D.; Magalhaes, A.; Cortez-Dias, N.; Miltenberger-Miltenyi, G. Rare Association of two Genetic Causes of Sudden Death in a Young Survivor. Arq. Bras. Cardiol. 2017, 108, 184–186. [Google Scholar] [CrossRef]
- Pappone, C.; Monasky, M.M.; Micaglio, E.; Ciconte, G. Right ventricular electromechanical abnormalities in Brugada syndrome: Is this a cardiomyopathy? Eur. Heart J. Suppl. 2020, 22, E101–E104. [Google Scholar] [CrossRef]
- De Maria, E.; Borghi, A.; Tonelli, L.; Selvatici, R.; Cappelli, S.; Gualandi, F. Brugada ECG pattern in hypertrophic cardiomyopathy: Brugada phenocopy or overlapping syndrome? J. Electrocardiol. 2021, 69, 132. [Google Scholar] [CrossRef]
- Fernlund, E.; Kissopoulou, A.; Green, H.; Karlsson, J.E.; Ellegard, R.; Arstrand, H.K.; Jonasson, J.; Gunnarsson, C. Hereditary Hypertrophic Cardiomyopathy in Children and Young Adults-The Value of Reevaluating and Expanding Gene Panel Analyses. Genes 2020, 11, 1472. [Google Scholar] [CrossRef]
- Novelli, V.; Malkani, K.; Cerrone, M. Pleiotropic Phenotypes Associated With PKP2 Variants. Front. Cardiovasc. Med. 2018, 5, 184. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.X.; Liu, J.; Ruan, J.Y.; Yu, S.Q.; Wang, L.M.; Zhao, S.H.; Wang, S.Y.; Kang, L.M.; Wang, J.Z.; Song, L. Deleterious Rare Desmosomal Variants Contribute to Hypertrophic Cardiomyopathy and Are Associated With Distinctive Clinical Features. Can. J. Cardiol. 2022, 38, 41–48. [Google Scholar] [CrossRef]
- Bainbridge, M.N.; Li, L.L.; Tan, Y.L.; Cheong, B.Y.; Marian, A.J. Identification of established arrhythmogenic right ventricular cardiomyopathy mutation in a patient with the contrasting phenotype of hypertrophic cardiomyopathy. BMC Med. Genet. 2017, 18, 24. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Li, X.; Liu, X.; Wang, J.; Zhang, Z.; Wu, J.; Huang, M.; Guo, Y.; Li, F.; Wang, X.; et al. Clinical and mutation profile of pediatric patients with RASopathy-associated hypertrophic cardiomyopathy: Results from a Chinese cohort. Orphanet. J. Rare Dis. 2019, 14, 29. [Google Scholar] [CrossRef]
- Walsh, R.; Buchan, R.; Wilk, A.; John, S.; Felkin, L.E.; Thomson, K.L.; Chiaw, T.H.; Loong, C.C.W.; Pua, C.J.; Raphael, C.; et al. Defining the genetic architecture of hypertrophic cardiomyopathy: Re-evaluating the role of non-sarcomeric genes. Eur. Heart J. 2017, 38, 3461–3468. [Google Scholar] [CrossRef] [PubMed]
- Spracklen, T.F.; Kasher, P.R.; Kraus, S.; Botha, T.L.; Page, D.J.; Kamuli, S.; Booi, Z.; Chin, A.; Laing, N.; Keavney, B.D.; et al. Identification of a POLG Variant in a Family With Arrhythmogenic Cardiomyopathy and Left Ventricular Fibrosis. Circ. Genom. Precis. Med. 2021, 14, e003138. [Google Scholar] [CrossRef] [PubMed]
- Carsana, A.; Frisso, G.; Tremolaterra, M.R.; Ricci, E.; De Rasmo, D.; Salvatore, F. A larger spectrum of intragenic short tandem repeats improves linkage analysis and localization of intragenic recombination detection in the dystrophin gene: An analysis of 93 families from southern Italy. J. Mol. Diagn. 2007, 9, 64. [Google Scholar] [CrossRef] [Green Version]
- Giuca, A.; Mitu, C.; Popescu, B.O.; Bastian, A.E.; Capsa, R.; Mursa, A.; Radoi, V.; Popescu, B.A.; Jurcut, R. Novel FHL1 mutation variant identified in a patient with nonobstructive hypertrophic cardiomyopathy and myopathy—A case report. BMC Med. Genet. 2020, 21, 188. [Google Scholar] [CrossRef]
- D’Argenio, V. The High-Throughput Analyses Era: Are We Ready for the Data Struggle? High Throughput 2018, 7, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Limongelli, G.; Nunziato, M.; Mazzaccara, C.; Intrieri, M.; D’Argenio, V.; Esposito, M.V.; Monda, E.; Di Maggio, F.; Frisso, G.; Salvatore, F. Genotype-Phenotype Correlation: A Triple DNA Mutational Event in a Boy Entering Sport Conveys an Additional Pathogenicity Risk. Genes 2020, 11, 524. [Google Scholar] [CrossRef] [PubMed]
- Frisso, G.; Detta, N.; Coppola, P.; Mazzaccara, C.; Pricolo, M.R.; D’Onofrio, A.; Limongelli, G.; Calabro, R.; Salvatore, F. Functional Studies and In Silico Analyses to Evaluate Non-Coding Variants in Inherited Cardiomyopathies. Int. J. Mol. Sci. 2016, 17, 1883. [Google Scholar] [CrossRef] [Green Version]
- Pricolo, M.R.; Herrero-Galan, E.; Mazzaccara, C.; Losi, M.A.; Alegre-Cebollada, J.; Frisso, G. Protein Thermodynamic Destabilization in the Assessment of Pathogenicity of a Variant of Uncertain Significance in Cardiac Myosin Binding Protein C. J. Cardiovasc. Transl. Res. 2020, 13, 867–877. [Google Scholar] [CrossRef]
- Esposito, M.V.; Minopoli, G.; Esposito, L.; D’Argenio, V.; Di Maggio, F.; Sasso, E.; D’Aiuto, M.; Zambrano, N.; Salvatore, F. A Functional Analysis of the Unclassified Pro2767Ser BRCA2 Variant Reveals Its Potential Pathogenicity that Acts by Hampering DNA Binding and Homology-Mediated DNA Repair. Cancers 2019, 11, 1454. [Google Scholar] [CrossRef] [Green Version]
- Esposito, M.V.; Nunziato, M.; Starnone, F.; Telese, A.; Calabrese, A.; D’Aiuto, G.; Pucci, P.; D’Aiuto, M.; Baralle, F.; D’Argenio, V.; et al. A Novel Pathogenic BRCA1 Splicing Variant Produces Partial Intron Retention in the Mature Messenger RNA. Int. J. Mol. Sci. 2016, 17, 2145. [Google Scholar] [CrossRef]
Gene | Transcript | HGVS * Coding (cDNA) | HGVS * Protein Level | Patient’s Phenotype | ClinGen ** | Variant Classification | |||||
---|---|---|---|---|---|---|---|---|---|---|---|
Reference SNP ID | ClinVar | HGMD § | ACMG *** | ACMG Supporting Criteria # | gnomAD Frequency | ||||||
ABCC9 | NM_020297.4 | c.2937G>A | p.Trp979Ter | HCM | NR | NR | NR | NR | P | PVS1/PM2/PP3 | NF |
ANK2 | NM_001354273.1 | c.187-3C>G | - | HCM | NR | rs1562805147 | NR | NR | VUS | PM2/PP3 | 0.00000402 |
ANK2 | NM_001354273.1 | c.190G>A | p.Gly64Arg | BrS | DISPUTED | NR | NR | NR | VUS | PM2/PP3 | NF |
CACNA1D | NM_000720.4 | c.4187C>A | p.Ala1396Asp | BrS | DISPUTED | rs745689505 | NR | NR | VUS | PM2/PP3 | NF |
CACNA1D | NM_000720.4 | c.1059C>G | p.Ala353Ala | HCM | NR | NR | NR | NR | VUS | PM2/BP7 | NF |
CACNA2D1 | NM_001366867.1 | c.1516-4C>A | - | BrS | DISPUTED | rs1371737796 | NR | NR | VUS | PM2/BP4 | NF |
CACNB2 | NM_201570.3 | c.645G>T | p.Met215Ile | ACM | NR | NR | NR | NR | VUS | PM27PP3 | NF |
CACNB2 | NM_201570.3 | c.1652G>T | p.Arg551Met | ACM | NR | NR | NR | NR | VUS | PM2 | NF |
CASQ2 | NM_001232.4 | c.562C>T | p.His188Tyr | BrS | NR | NR | NR | P | VUS | PM2 | NF |
CASQ2 | NM_001232.4 | c.928G>A | p.Asp310Asn | BrS | NR | rs141314684 | CI | P | LB | BS1/BP6 | 0.0007 vs. 0.00001 ° |
CAV3 | NM_033337.3 | c.233C>T | p.Thr78Met | HCM | NR | rs72546668 | CI | P | B | PP3/PP2/BS1/BS2 | 0.00263 vs. 0.0004 ° |
CAV3 | NM_033337.3 | c.* 682delG | - | BrS | NR | NR | NR | NR | VUS | PM2/BP7 | NF |
CTNNA3 | NM_013266.4 | c.334C>T | p.Pro112Ser | HCM | NR | rs1485074194 | NR | NR | VUS | PM2 | NF |
DSC2 | NM_024422.6 | c.926C>T | p.Ser 309Phe | BrS | NR | NR | NR | NR | VUS | PM2 | NF |
DSP | NM_004415.4 | c.2848delA | p.Ile950LeufsTer27 | ACM | DEFINITIVE | NR | P | P | P | PVS1/PM2 | NF |
DSP | NM_004415.4 | c.5428C>T | p.Glu1810Ter | ACM | DEFINITIVE | rs397516946 | LP | P | P | PM2/PVS1 | NF |
DSP§§ | NM_004415.4 | c.8471_8483delGGTCCCGCTCCGG | p.Gly2824AlafsTer55 | ACM | DEFINITIVE | NR | VUS | NR | P | PVS1/PM2 | NF |
DSP | NM_004415.4 | c.8171A>G | p.Glu2724Arg | HCM | NR | NR | VUS | NR | VUS | PM2 | NF |
FHL1 | NM_001159699.2 | c.764G>C | p.Cys255Ser | HCM | NR | rs869025431 | NR | P | LP | PM2/PP3/PP2/PP5 | 0.00000904 |
FLNC | NM_001127487.2 | c.2830G>A | p.Val944Met | DCM | DEFINITIVE | NR | NR | NR | VUS | PM2/PP3 | NF |
HCN4 | NM_005477.3 | c.1748A>G | p.Asn583Ser | ACM | NR | rs1204195890 | VUS | NR | VUS | PM2 | 0.0000131 |
KCNE3 | NM_005472.5 | c.-41+1G>C | - | ACM | NR | NR | NR | NR | LP | PVS1/PM2 | NF |
KCNE3 | NM_005472.5 | c.157C>T | p.Arg53Cys | BrS | DISPUTED | rs371666083 | NR | NR | VUS | PM2 | 0.0000199 |
KCNH2 | NM_000238.4 | c.453dupC | p.Thr152HisfsTer180 | LQTS | DEFINITIVE | rs761863251 | CI | P | P | PVS1/PM2/PP5 | 0.000028 vs. 0.000008 ° |
KCNH2 | NM_000238.4 | c.2785dupG | p.Glu929GlyfsTer11 | LQTS | DEFINITIVE | rs794728458 | CI | P | P | PVS1/PP5/PM2 | NF |
KCNQ1 | NM_181798.1 | c.-62C>G | - | DCM | NR | NR | NR | NR | VUS | PM2/BP7 | NF |
KCNQ1 | NM_000218.3 | c.569G>T | p.Arg190Leu | LQTS | DEFINITIVE | rs120074178 | P/LP | P | P | PS3/PM1/PM2/PP3/PP5/BP1 | 0.00000401 |
KCNQ1 | NM_000218.3 | c.877C>T | p.Arg293Cys | HCM | NR | rs199472737 | CI | P | LP | PM1/PM5/PM2/PP3/PP5 | 0.000036 |
KCNQ1 | NM_000218.3 | c.1265delA | p.Lys422SerfsTer10 | LQTS | DEFINITIVE | rs397508083 | P/LP | P | P | PVS1/PP5/PM2 | 0.000012 vs. 0.000008 ° |
KRAS | NM_001369786.1 | c.533C>G | p.Pro178Arg | BrS | NR | NR | NR | NR | VUS | PM2/PP2 | NF |
KRT17 | NM_000422.3 | c. 960+5G>A | - | LQTS | NR | rs370554150 | P | NR | LP | PM2/PP3/PP5 | 0.000008 |
LAMA3 | NM_198129.4 | c.9685T>C | p-Ser3229Pro | LQTS | NR | rs765495036 | NR | NR | VUS | PM2 | 0.00000398 |
LDB3 | NM_001171610.2 | c.860G>A | p.Gly287Glu | ACM | DISPUTED | NR | NR | NR | VUS | PM2 | NF |
LMNA | NM_001282626.2 | c.949G>A | p.Glu317Lys | DCM | DEFINITIVE | rs56816490 | P/LP | P | LP | PM1/PM2/PP3/PP5 | 0.00000657 |
MYBPC3 | NM_000256.3 | c.906-1G>C | - | BrS | NR | rs587776700 | P | P | P | PVS1/PP5/PS3/PM2 | 0.00000433 |
MYBPC3 | NM_000256.3 | c.1591G>C | p.Gly531Arg | HCM | DEFINITIVE | rs397515912 | LP | P | LP | PM1/PM2/PP3/PP5/BS2 | 0.0000121 |
MYBPC3§§§ | NM_000256.3 | c.1790G>A | p.Arg597Gln | HCM | DEFINITIVE | rs727503195 | CI | P | LP | PP3/PM1/PP5/BS2 | 0.00003 |
MYBPC3 | NM_000256.3 | c.1928-2A>G | - | HCM | DEFINITIVE | rs397515937 | P | P | P | PVS1/PM2/PP5 | NF |
MYBPC3 | NM_000256.3 | c.2955G>T | p.Lys958Asn | HCM | DEFINITIVE | NR | NR | NR | VUS | PM2 | 0.00000657 |
MYBPC3 | NM_000256.3 | c.3627+2T>A | - | HCM | DEFINITIVE | rs1299079662 | NR | P | LP | PVS1/PM2 | 0.00000405 |
MYBPC3 | NM_000256.3 | c.3775C>T | p.Gln1259Ter | HCM | DEFINITIVE | rs730880605 | P | P | P | PVS1/PM2/PP3/PP5 | NF |
MYH6 | NM_002471.4 | c.5629G>A | p.Val1877Ile | ACM | NR | NR | NR | NR | VUS | PM2 | NF |
MYH7 | NM_000257.4 | c.1615A>C | p.Met539Leu | HCM | DEFINITIVE | rs730880930 | LP | P | LP | PM1/PM2/PP2/PP3/PP5/BP1 | NF |
MYH7 | NM_000257.4 | c.2155C>T | p. Arg719Trp | HCM | DEFINITIVE | rs121913637 | P | P | LP | PM1/PM2/PP2/PP3/PP5/BP1 | 0.00000657 |
MYH7 | NM_000257.4 | c.4066G>A | p.Glu1356Lys | HCM | DEFINITIVE | rs727503246 | LP | P | LP | PM1/PM2/PP2/PP3/PP5/BP1 | 0.00000657 |
MYH7# | NM_000257.4 | c.4130C>T | p.Thr1377Met | HCM | DEFINITIVE | rs397516201 | LP | P | LP | PM1/PM2/PP2/PP3/PP5/BP1 | 0.00000398 |
MYL2 | NM_000432.4 | c.484G>A | p.Gly162Arg | HCM | DEFINITIVE | rs199474814 | CI | P | P | PM1/PM2/PP2/PM5/PP3/PP5 | NF |
OBSCN | NM_001271223.2 | c.22911_22912delGT | p.Ser7638MetfsTer30 | HCM | NR | rs1558418533 | NR | NR | LP | PVS1/PM2 | 0.00000402 |
PKP2 | NM_004572.4 | c.368G>A | p.Trp123Ter | ACM | DEFINITIVE | rs760576804 | P | P | P | PVS1/PM2/PP3/PP5 | NF |
PKP2 | NM_004572.4 | c.948_949delAG | p.Arg316SerfsTer19 | ACM | DEFINITIVE | NR | NR | NR | LP | PVS1/PM2 | NF |
PKP2 | NM_004572.4 | c.1378+1G>C | - | HCM | NR | rs397516994 | P/LP | P | P | PVS1/PP5/PM2 | 0.00000399 |
PLN# | NM_002667.5 | c.40_42delAGA | p.Arg14del | ACM/DCM | DEFINITIVE in DCM MODERATE in ACM | rs397516784 | CI | P | LP | PS3/PM2/PM4/PP5 | 0.00000398 |
POLG | NM_002693.3 | c.530G>A | p.Arg177Gln | LQTS | NR | NR | NR | NR | VUS | PM2/PP2 | NF |
POLG | NM_002693.3 | c.752C>T | p.Thr251Ile | ACM | NR | rs113994094 | CI | P | LP | PM2/PP2/PP5 | 0.00155 vs. 0.00009 ° |
POLG | NM_002693.3 | c.1402A>G | p.Asn468Asp | BrS | NR | rs145843073 | CI | P | LP | PP5/PM2/BP4 | 0.000473 vs. 0.00001 ° |
POLG | NM_002693.3 | c.1760C>T | p.Pro587Leu | ACM | NR | rs113994096 | CI | P | P | PS3/PM2/PP5/PP3 | 0.00155 vs. 0.00009 ° |
PRDM16 | NM_022114.4 | c.1400C>A | p.Pro467His | BrS | NR | NR | NR | NR | VUS | PM2 | NF |
RAF1 | NM_001354689.3 | c.709G>A | p.Ala237Thr | HCM | NR | rs587777588 | P | P | LP | PM2/PM1/PP5 | 0.0000159 |
RAF1 | NM_001354689.3 | c.945T>G | p.Ser315Arg | HCM | NR | NR | NR | NR | VUS | PM2/PP2 | NF |
RYR2 | NM_001035.3 | c.5475C>T | p.Phe1825Phe | DCM | NR | NR | NR | NR | VUS | PM2/BP7 | NF |
RYR2 | NM_001035.3 | c.8215A>G | p.Asn2739Asp | HCM | LIMITED | NR | NR | NR | VUS | PM2/PP2 | NF |
RYR2 | NM_001035.3 | c.13457C>G | p.Ala4486Gly | ACM | REFUTED | rs779309213 | VUS | NR | VUS | PM2/PP2 | 0.0000122 |
SCN10A | NM_006514.3 | c.3088C>T | p.Gln1030Ter | HCM | NR | rs778772059 | NR | NR | VUS | PM2 | 0.00000409 |
SCN10A | NM_006514.3 | c.4948A>T | p.Ser1650Cys | HCM | NR | rs780649338 | VUS | NR | VUS | PM2/PP3 | 0.0000159 |
SCN3B | NM_001040151.2 | c.354C>T | p.Tyr118Tyr | LQTS | NR | NR | NR | NR | VUS | PM2/BP7 | 0.00000657 |
SCN5A | NM_198056.3 | c.2441G>A | p.Arg814Gln | BrS | DEFINITIVE | rs199473584 | CI | P | LP | PS3/PM5/PP3/PP5 | 0.0000242 vs. 0.00001 ° |
SCN5A | NM_198056.3 | c.4414_4416delAAC | p.Asn1472del | LQTS | DEFINITIVE | NR | NR | P | LP | PM1/PM2/PM4 | NF |
SCN5A | NM_198056.3 | c.5494C>G | p.Gln1832Glu | BrS | DEFINITIVE | rs199473320 | CI | P | VUS | BP6 | 0.0000601 vs. 0.00001 ° |
SGCD | NM_000337.6 | c.451T>G | p.Ser151Ala | BrS | NR | rs121909298 | VUS | P | VUS | PP3 | 0.000202 vs. 0.00001 ° |
TBX1 | NM_080647.1 | c.684+7G>T | - | DCM | NR | NR | NR | NR | VUS | PM2/BBP4 | NF |
TGFB3 | NM_001329939.1 | c.8T>C | p.Met3Thr | BrS | NR | NR | NR | NR | VUS | PM2/PP3 | NF |
TGFB3 | NM_001329939.1 | c.* 495C>T | - | HCM | NR | rs387906514 | P | P | VUS | PM2 | 0.00000667 |
TNNI3 | NM_000363.5 | c.434G>A | p.Arg145Gln | HCM | DEFINITIVE | rs397516349 | P/LP | P | P | PP5/PS3/PM1/PM5/PM2/PP3 | 0.0000161 |
TNNI3 | NM_000363.5 | c.485G>A | p.Arg162Gln | HCM | DEFINITIVE | rs397516354 | P/LP | P | P | PP5/PM1/PM5/PM2/PP3 | 0.0000402 |
TNNI3K | NM_015978.3 | c.2187 G>T | p.Met729Ile | HCM | DEFINITIVE | rs1372831124 | NR | NR | VUS | PM2 | 0.00000404 |
TNNT2 | NM_001276347.2 | c.388C>T | p.Arg130Cys | HCM | DEFINITIVE | rs397516463 | NR | P | P | PM1/PM2/PP2/PP3/PP5 | NF |
TRPM4 | NM_017636.4 | c.3329-2A>G | - | DCM | NR | rs751095080 | NR | NR | LP | PVS1/PM2 | 0.00000401 |
TTN | NM_001267550.2 | c.8854_ 8874delACATTTGTCTGTGGCAATGAC | p.Thr2952_Asp2958del | DCM | DEFINITIVE | NR | NR | NR | VUS | PM2/PM4 | NF |
TTN | NM_001267550.2 | c.50255C>G | p.Pro16752Arg | HCM | LIMITED | NR | NR | NR | VUS | PM2 | NF |
TTN | NM_001267550.2 | c.83378A>G | p.Asp27793Gly | DCM | DEFINITIVE | NR | NR | NR | VUS | PM2 | NF |
TTN | NM_001267550.2 | c.69500G>A | p.Gly23167Asp | HCM | LIMITED | rs747019187 | NR | NR | VUS | PM2 | NF |
TTN | NM_001267550.2 | c.102565G>C | p.Asp34189His | BrS | NR | NR | NR | NR | VUS | PM2 | NF |
ID | Age at Diagnosis (Years) | Sex | Family History | Symptoms * | ECG * | Gene | Nucleotide Variant (Aminoacid Change) | Echocardiography/CMR ** | Definitive Diagnosis |
---|---|---|---|---|---|---|---|---|---|
NA01 | 20 | M | Negative for SCD and HCM | Exertional dyspnoea (NYHA Class II) | Signs of LVH, diffuse repolarization abnormalities | ABCC9 | c.2937G>A (p.Trp979Ter) | Symmetric LVH with MWT (18 mm) at the level of the basal IVS and first-degree diastolic dysfunction | HCM |
NA02 | 47 | M | Negative for SCD, and ACM | Asymptomatic | Diffuse repolarization abnormalities | KCNE3 | c.-41+1G>C | Regional dyskinesia of right ventricle free wall. Identification of regional fibrosis with LGE | ACM |
NA03 | 44 | M | Negative for SCD and HCM | Asymptomatic | Right axis deviation; delayed intraventricular left conduction | KCNQ1 | c.877C>T (p.Arg293Cys) | Symmetric LVH with MWT (22 mm) at the level of the basal IVS | HCM |
NA04 | 51 | F | Negative for SCD and BrS | Syncope | Brugada type 1 pattern | MYBPC3 | c.906-1G>C | Normal wall thicknesses and chamber diameters | BrS |
NA05 | 79 | M | Negative for SCD and HCM | Asymptomatic | diffuse repolarization abnormalities | PKP2 | c.1378+1G>C | Asymmetrical LVHMWT: 19 mm | HCM |
NA06 | 9 | M | Negative for SCD and BrS | Asymptomatic | Flecainide-induced Brugada type 1 pattern | POLG | c.1402A>G (p.Asn468Asp) | Normal wall thicknesses and chamber diameters | BrS |
NA07 | 20 | M | Positive for SCD and ACM | Syncope | Diffuse repolarization abnormalities | POLG | c.752C>T (p.Thr251Ile); c.1760C>T (p.Pro587Leu) | Normal wall thicknesses and chamber diameters. Presence of diffuse late gadolinium enhancement with subepicardial distribution in the basal segment of the inferior and lateral walls at CMR | ACM |
NA08 | 18 | M | Negative for SCD and HCM | Exertional dyspnoea (NYHA Class II) | Signs of LVH, negative T-waves in aVL, V5, V6 leads | RAF1 | c.709G>A (p.Ala237Thr) | Asymmetric obstructive LVH with MWT (15 mm) at the level of the basal IVS | HCM |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mazzaccara, C.; Lombardi, R.; Mirra, B.; Barretta, F.; Esposito, M.V.; Uomo, F.; Caiazza, M.; Monda, E.; Losi, M.A.; Limongelli, G.; et al. Next-Generation Sequencing Gene Panels in Inheritable Cardiomyopathies and Channelopathies: Prevalence of Pathogenic Variants and Variants of Unknown Significance in Uncommon Genes. Biomolecules 2022, 12, 1417. https://doi.org/10.3390/biom12101417
Mazzaccara C, Lombardi R, Mirra B, Barretta F, Esposito MV, Uomo F, Caiazza M, Monda E, Losi MA, Limongelli G, et al. Next-Generation Sequencing Gene Panels in Inheritable Cardiomyopathies and Channelopathies: Prevalence of Pathogenic Variants and Variants of Unknown Significance in Uncommon Genes. Biomolecules. 2022; 12(10):1417. https://doi.org/10.3390/biom12101417
Chicago/Turabian StyleMazzaccara, Cristina, Raffaella Lombardi, Bruno Mirra, Ferdinando Barretta, Maria Valeria Esposito, Fabiana Uomo, Martina Caiazza, Emanuele Monda, Maria Angela Losi, Giuseppe Limongelli, and et al. 2022. "Next-Generation Sequencing Gene Panels in Inheritable Cardiomyopathies and Channelopathies: Prevalence of Pathogenic Variants and Variants of Unknown Significance in Uncommon Genes" Biomolecules 12, no. 10: 1417. https://doi.org/10.3390/biom12101417