Mining Grapevine Downy Mildew Susceptibility Genes: A Resource for Genomics-Based Breeding and Tailored Gene Editing
Abstract
1. Introduction
2. Materials and Methods
2.1. Genetic Material and Target Genes
2.2. Amplicon Sequencing and Read Processing
2.3. Sanger Sequencing
2.4. Data Mining and Protein Model
3. Results
3.1. Sequencing and Mapping
3.2. Genetic Diversity Assessment
3.3. Mutation Impact Evaluation
3.4. Mutated DMR and DLO Gene Combinations
3.5. Mutation Mapping on Amino Acid Sequences and Protein Structural Model
4. Discussion
4.1. Wealth of Genetic Variability
4.2. Relevance of Mutation Impact
4.3. The Value of Haplotype Consideration
4.4. Scouting of Amino Acid Changes
4.5. Ultimate Application of S Genes
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gururani, M.A.; Venkatesh, J.; Upadhyaya, C.P.; Nookaraju, A.; Pandey, S.K.; Park, S.W. Plant disease resistance genes: Current status and future directions. Physiol. Mol. Plant Pathol. 2012, 78, 51–65. [Google Scholar] [CrossRef]
- Jones, J.D.G.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef] [PubMed]
- Meyers, B.C.; Kaushik, S.; Nandety, R.S. Evolving disease resistance genes. Curr. Opin. Plant Biol. 2005, 8, 129–134. [Google Scholar] [CrossRef] [PubMed]
- Van Schie, C.C.N.; Takken, F.L.W. Susceptibility genes 101: How to be a good host. Annu. Rev. Phytopathol. 2014, 52, 551–581. [Google Scholar] [CrossRef]
- Fawke, S.; Doumane, M.; Schornack, S. Oomycete Interactions with Plants: Infection Strategies and Resistance Principles. Microbiol. Mol. Biol. Rev. 2015, 79, 263–280. [Google Scholar] [CrossRef]
- Jorgensen, J.H. Discovery, characterization and exploitation of Mlo powdery mildew. Euphytica 1992, 66, 141–152. [Google Scholar] [CrossRef]
- Kusch, S.; Panstruga, R. mlo-Based Resistance: An Apparently Universal “Weapon” to Defeat Powdery Mildew Disease. Mol. Plant Microbe Interact. 2017, 30, 179–189. [Google Scholar] [CrossRef]
- Van Damme, M.; Andel, A.; Huibers, R.P.; Panstruga, R.; Weisbeek, P.J.; Van Den Ackerveken, G. Identification of Arabidopsis loci required for susceptibility to the downy mildew pathogen Hyaloperonospora parasitica. Mol. Plant Microbe Interact. 2005, 18, 583–592. [Google Scholar] [CrossRef] [PubMed]
- Van Damme, M.; Huibers, R.P.; Elberse, J.; Van Den Ackerveken, G. Arabidopsis DMR6 encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. Plant J. 2008, 54, 785–793. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Halitschke, R.; Yin, C.; Liu, C.-J.; Gan, S.-S. Salicylic acid 3-hydroxylase regulates Arabidopsis leaf longevity by mediating salicylic acid catabolism. Proc. Natl. Acad. Sci. USA 2013, 110, 14807–14812. [Google Scholar] [CrossRef]
- Zeilmaker, T.; Ludwig, N.R.; Elberse, J.; Seidl, M.F.; Berke, L.; Van Doorn, A.; Schuurink, R.C.; Snel, B.; Van Den Ackerveken, G. Downy mildew resistant 6 and DMR6-like oxygenase 1 are partially redundant but distinct suppressors of immunity in Arabidopsis. Plant J. 2015, 81, 210–222. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.J.; Zhao, L.; Zhao, J.Z.; Li, Y.J.; Wang, J.B.; Guo, R.; Gan, S.S.; Liu, C.J.; Zhanga, K.W. S5H/DMR6 encodes a salicylic acid 5-hydroxylase that fine-tunes salicylic acid homeostasis. Plant Physiol. 2017, 175, 1082–1093. [Google Scholar] [CrossRef] [PubMed]
- De Toledo Thomazella, D.P.; Brail, Q.; Dahlbeck, D.; Staskawicz, B.J. CRISPR-Cas9 mediated mutagenesis of a DMR6 ortholog in tomato confers broad-spectrum disease resistance. bioRxiv 2016, 064824. [Google Scholar] [CrossRef]
- Schouten, H.J.; Krauskopf, J.; Visser, R.G.F.; Bai, Y. Identification of candidate genes required for susceptibility to powdery or downy mildew in cucumber. Euphytica 2014, 200, 475–486. [Google Scholar] [CrossRef]
- Sun, K.; van Tuinen, A.; van Kan, J.A.L.; Wolters, A.M.A.; Jacobsen, E.; Visser, R.G.F.; Bai, Y. Silencing of DND1 in potato and tomato impedes conidial germination, attachment and hyphal growth of Botrytis cinerea. BMC Plant Biol. 2017, 17, 235. [Google Scholar] [CrossRef]
- Zhang, W.; Mirlohi, S.; Li, X.; He, Y. Identification of functional single-nucleotide polymorphisms affecting leaf hair number in Brassica rapa. Plant Physiol. 2018, 177, 490–503. [Google Scholar] [CrossRef]
- Ganal, M.W.; Altmann, T.; Röder, M.S. SNP identification in crop plants. Curr. Opin. Plant Biol. 2009, 12, 211–217. [Google Scholar] [CrossRef]
- Brookes, A.J. The essence of SNPs [Review]. Gene 1999, 234, 177–186. [Google Scholar] [CrossRef]
- Andersen, J.R.; Lübberstedt, T. Functional markers in plants. Trends Plant Sci. 2003, 8, 554–560. [Google Scholar] [CrossRef]
- Polanco, C.; Sáenz de Miera, L.E.; González, A.I.; García, P.; Fratini, R.; Vaquero, F.; Javier Vences, F.; De La Vega, M.P. Construction of a high-density interspecific (Lens culinaris × L. Odemensis) genetic map based on functional markers for mapping morphological and agronomical traits, and QTLs affecting resistance to Ascochyta in lentil. PLoS ONE 2019, 14, e0214409. [Google Scholar] [CrossRef]
- Burow, G.; Chopra, R.; Sattler, S.; Burke, J.; Acosta-Martinez, V.; Xin, Z. Deployment of SNP (CAPS and KASP) markers for allelic discrimination and easy access to functional variants for brown midrib genes bmr6 and bmr12 in Sorghum bicolor. Mol. Breed. 2019, 39. [Google Scholar] [CrossRef]
- Fan, C.; Yu, S.; Wang, C.; Xing, Y. A causal C-A mutation in the second exon of GS3 highly associated with rice grain length and validated as a functional marker. Theor. Appl. Genet. 2009, 118, 465–472. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Zhang, H.; Xuan, N.; Chen, G.; Liu, X.; Yao, F.; Ding, H. Identification of blast resistance genes in 358 rice germplasms (Oryza sativa L.) using functional molecular markers. Eur. J. Plant Pathol. 2017, 148, 567–576. [Google Scholar] [CrossRef]
- Edwards, D.; Forster, J.W.; Cogan, N.O.; Batley, J.; Chagné, D. Single nucleotide polymorphism discovery. In Association Mapping in Plants; Springer: New York, NY, USA, 2007. [Google Scholar]
- Varshney, R.K.; Nayak, S.N.; May, G.D.; Jackson, S.A. Next-generation sequencing technologies and their implications for crop genetics and breeding. Trends Biotechnol. 2009, 27, 522–530. [Google Scholar] [CrossRef] [PubMed]
- Schadt, E.E.; Turner, S.; Kasarskis, A. A window into third-generation sequencing. Hum. Mol. Genet. 2010, 19, 227–240. [Google Scholar] [CrossRef]
- Arabidopsis Genome Initiative. Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 2000, 408, 796–815. [Google Scholar] [CrossRef] [PubMed]
- Ching, A.; Caldwell, K.S.; Jung, M.; Dolan, M.; Smith, O.S.H.; Tingey, S.; Morgante, M.; Rafalski, A.J. SNP frequency, haplotype structure and linkage disequilibrium in elite maize inbred lines. BMC Genet. 2002, 3, 1–14. [Google Scholar] [CrossRef]
- Atwell, S.; Huang, Y.S.; Vilhjálmsson, B.J.; Willems, G.; Horton, M.; Li, Y.; Meng, D.; Platt, A.; Tarone, A.M.; Hu, T.T.; et al. Genome-wide association study of 107 phenotypes in Arabidopsis thaliana inbred lines. Nature 2010, 465, 627–631. [Google Scholar] [CrossRef]
- Xu, X.; Liu, X.; Ge, S.; Jensen, J.D.; Hu, F.; Li, X.; Dong, Y.; Gutenkunst, R.N.; Fang, L.; Huang, L.; et al. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes. Nat. Biotechnol. 2012, 30, 105–111. [Google Scholar] [CrossRef]
- Raman, H.; Dalton-Morgan, J.; Diffey, S.; Raman, R.; Alamery, S.; Edwards, D.; Batley, J. SNP markers-based map construction and genome-wide linkage analysis in Brassica napus. Plant Biotechnol. J. 2014, 12, 851–860. [Google Scholar] [CrossRef]
- Vos, P.G.; Uitdewilligen, J.G.A.M.L.; Voorrips, R.E.; Visser, R.G.F.; van Eck, H.J. Development and analysis of a 20K SNP array for potato (Solanum tuberosum): An insight into the breeding history. Theor. Appl. Genet. 2015, 128, 2387–2401. [Google Scholar] [CrossRef] [PubMed]
- Hulse-Kemp, A.M.; Ashrafi, H.; Plieske, J.; Lemm, J.; Stoffel, K.; Hill, T.; Luerssen, H.; Pethiyagoda, C.L.; Lawley, C.T.; Ganal, M.W.; et al. A HapMap leads to a Capsicum annuum SNP infinium array: A new tool for pepper breeding. Hortic. Res. 2016, 3, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Peterson, G.W.; Dong, Y.; Horbach, C.; Fu, Y.B. Genotyping-by-sequencing for plant genetic diversity analysis: A lab guide for SNP genotyping. Diversity 2014, 6, 665–680. [Google Scholar] [CrossRef]
- Campbell, N.R.; Harmon, S.A.; Narum, S.R. Genotyping-in-Thousands by sequencing (GT-seq): A cost effective SNP genotyping method based on custom amplicon sequencing. Mol. Ecol. Resour. 2015, 15, 855–867. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Banks, T.W.; Cloutier, S. SNP discovery through next-generation sequencing and its applications. Int. J. Plant Genomics 2012, 2012. [Google Scholar] [CrossRef] [PubMed]
- Durstewitz, G.; Polley, A.; Plieske, J.; Luerssen, H.; Graner, E.M.; Wieseke, R.; Ganal, M.W. SNP discovery by amplicon sequencing and multiplex SNP genotyping in the allopolyploid species Brassica napus. Genome 2010, 53, 948–956. [Google Scholar] [CrossRef]
- Yang, S.; Fresnedo-Ramírez, J.; Wang, M.; Cote, L.; Schweitzer, P.; Barba, P.; Takacs, E.M.; Clark, M.; Luby, J.; Manns, D.C.; et al. A next-generation marker genotyping platform (AmpSeq) in heterozygous crops: A case study for marker-assisted selection in grapevine. Hortic. Res. 2016, 3. [Google Scholar] [CrossRef]
- Cho, Y.B.; Jones, S.I.; Vodkin, L.O. Mutations in Argonaute5 illuminate epistatic interactions of the K1 and I loci leading to saddle seed color patterns in glycine max. Plant Cell 2017, 29, 708–725. [Google Scholar] [CrossRef]
- Shimray, P.W.; Bajaj, D.; Srivastava, R.; Daware, A.; Upadhyaya, H.D.; Kumar, R.; Bharadwaj, C.; Tyagi, A.K.; Parida, S.K. Identifying Transcription Factor Genes Associated with Yield Traits in Chickpea. Plant Mol. Biol. Report. 2017, 35, 562–574. [Google Scholar] [CrossRef]
- Hong, Y.; Liao, D.; Hu, A.; Wang, H.; Chen, J.; Khan, S.; Su, J.; Li, H. Diversity of endophytic and rhizoplane bacterial communities associated with exotic Spartina alterniflora and native mangrove using Illumina amplicon sequencing. Can. J. Microbiol. 2015, 61, 723–733. [Google Scholar] [CrossRef]
- Kinoti, W.M.; Constable, F.E.; Nancarrow, N.; Plummer, K.M.; Rodoni, B. Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV) using amplicon next generation sequencing. PLoS ONE 2017, 12, e0179284. [Google Scholar] [CrossRef] [PubMed]
- Gupta, P.K.; Roy, J.K.; Prasad, M. Single nucleotide polymorphisms: A new paradigm for molecular marker technology and DNA polymorphism detection with emphasis on their use in plants. Curr. Sci. 2001, 80, 524–535. [Google Scholar]
- Bianco, L.; Cestaro, A.; Linsmith, G.; Muranty, H.; Denancé, C.; Théron, A.; Poncet, C.; Micheletti, D.; Kerschbamer, E.; Di Pierro, E.A.; et al. Development and validation of the Axiom®Apple480K SNP genotyping array. Plant J. 2016, 86, 62–74. [Google Scholar] [CrossRef] [PubMed]
- Marrano, A.; Martínez-García, P.J.; Bianco, L.; Sideli, G.M.; Di Pierro, E.A.; Leslie, C.A.; Stevens, K.A.; Crepeau, M.W.; Troggio, M.; Langley, C.H.; et al. A new genomic tool for walnut (Juglans regia L.): Development and validation of the high-density AxiomTM J. regia 700K SNP genotyping array. Plant Biotechnol. J. 2019, 17, 1027–1036. [Google Scholar] [CrossRef] [PubMed]
- Hardner, C.M.; Hayes, B.J.; Kumar, S.; Vanderzande, S.; Cai, L.; Piaskowski, J.; Quero-Garcia, J.; Campoy, J.A.; Barreneche, T.; Giovannini, D.; et al. Prediction of genetic value for sweet cherry fruit maturity among environments using a 6K SNP array. Hortic. Res. 2019, 6. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Singh, J.; Qin, M.; Li, S.; Zhang, X.; Zhang, M.; Khan, A.; Zhang, S.; Wu, J. Development of an integrated 200K SNP genotyping array and application for genetic mapping, genome assembly improvement and genome wide association studies in pear (Pyrus). Plant Biotechnol. J. 2019, 17, 1582–1594. [Google Scholar] [CrossRef] [PubMed]
- Merot-L’anthoene, V.; Tournebize, R.; Darracq, O.; Rattina, V.; Lepelley, M.; Bellanger, L.; Tranchant-Dubreuil, C.; Coulée, M.; Pégard, M.; Metairon, S.; et al. Development and evaluation of a genome-wide Coffee 8.5K SNP array and its application for high-density genetic mapping and for investigating the origin of Coffea arabica L. Plant Biotechnol. J. 2019, 17, 1418–1430. [Google Scholar] [CrossRef]
- Mercati, F.; De Lorenzis, G.; Brancadoro, L.; Lupini, A.; Abenavoli, M.R.; Barbagallo, M.G.; Di Lorenzo, R.; Scienza, A.; Sunseri, F. High-throughput 18K SNP array to assess genetic variability of the main grapevine cultivars from Sicily. Tree Genet. Genomes 2016, 12. [Google Scholar] [CrossRef]
- Laucou, V.; Launay, A.; Bacilieri, R.; Lacombe, T.; Adam-Blondon, A.F.; Bérard, A.; Chauveau, A.; De Andrés, M.T.; Hausmann, L.; Ibáñez, J.; et al. Extended diversity analysis of cultivated grapevine Vitis vinifera with 10K genome-wide SNPs. PLoS ONE 2018, 13, e0192540. [Google Scholar] [CrossRef]
- Feuillet, C.; Leach, J.E.; Rogers, J.; Schnable, P.S.; Eversole, K. Crop genome sequencing: Lessons and rationales. Trends Plant Sci. 2011, 16, 77–88. [Google Scholar] [CrossRef]
- Bolger, M.E.; Weisshaar, B.; Scholz, U.; Stein, N.; Usadel, B.; Mayer, K.F.X. Plant genome sequencing—Applications for crop improvement. Curr. Opin. Biotechnol. 2014, 26, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Owens, C.L. SNP detection and genotyping in Vitis. Acta Hortic. 2003, 603, 139–140. [Google Scholar] [CrossRef]
- Jaillon, O. The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 2007. [Google Scholar] [CrossRef]
- Velasco, R.; Zharkikh, A.; Troggio, M.; Cartwright, D.A.; Cestaro, A.; Pruss, D.; Pindo, M.; FitzGerald, L.M.; Vezzulli, S.; Reid, J.; et al. A High Quality Draft Consensus Sequence of the Genome of a Heterozygous Grapevine Variety. PLoS ONE 2007, 2, e1326. [Google Scholar] [CrossRef]
- Carrier, G.; Le Cunff, L.; Dereeper, A.; Legrand, D.; Sabot, F.; Bouchez, O.; Audeguin, L.; Boursiquot, J.M.; This, P. Transposable elements are a major cause of somatic polymorphism in Vitis vinifera L. PLoS ONE 2012, 7, e32973. [Google Scholar] [CrossRef]
- Gambino, G.; Dal Molin, A.; Boccacci, P.; Minio, A.; Chitarra, W.; Avanzato, C.G.; Tononi, P.; Perrone, I.; Raimondi, S.; Schneider, A.; et al. Whole-genome sequencing and SNV genotyping of “Nebbiolo” (Vitis vinifera L.) clones. Sci. Rep. 2017, 7, 1–15. [Google Scholar] [CrossRef]
- Roach, M.J.; Johnson, D.L.; Bohlmann, J.; van Vuuren, H.J.J.; Jones, S.J.M.; Pretorius, I.S.; Schmidt, S.A.; Borneman, A.R. Population sequencing reveals clonal diversity and ancestral inbreeding in the grapevine cultivar Chardonnay. PLoS Genet. 2018, 14. [Google Scholar] [CrossRef]
- Minio, A.; Massonnet, M.; Figueroa-Balderas, R.; Castro, A.; Cantu, D. Diploid genome assembly of the wine grape carménère. Genes Genomes Genet. 2019, 9, 1331–1337. [Google Scholar] [CrossRef]
- Girollet, N.; Rubio, B.; Bert, P.-F. De novo phased assembly of the Vitis riparia grape genome. Sci. Data 2019, 6, 1–8. [Google Scholar] [CrossRef]
- Cochetel, N.; Minio, A.; Vondras, A.M.; Figueroa-Balderas, R.; Cantu, D. Diploid chromosome-scale assembly of the Muscadinia rotundifolia genome supports chromosome fusion and disease resistance gene expansion during Vitis and Muscadinia divergence. bioRxiv 2020. [Google Scholar] [CrossRef]
- Topfer, R.; Hausmann, L. Table of Loci for Traits in Grapevine Relevant for Breeding and Genetics. VIVC Vitis Int. Var. Cat. 2010, 40024, 2–5. [Google Scholar]
- Sargolzaei, M.; Maddalena, G.; Bitsadze, N.; Maghradze, D.; Bianco, P.A.; Failla, O.; Toffolatti, S.L.; Lorenzis, G. De Rpv29, Rpv30 and Rpv31: Three Novel Genomic Loci Associated With Resistance to Plasmopara viticola in Vitis vinifera. Front. Plant Sci. 2020, 11, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Barba, P.; Cadle-Davidson, L.; Harriman, J.; Glaubitz, J.C.; Brooks, S.; Hyma, K.; Reisch, B. Grapevine powdery mildew resistance and susceptibility loci identified on a high-resolution SNP map. Theor. Appl. Genet. 2014, 127, 73–84. [Google Scholar] [CrossRef] [PubMed]
- Winterhagen, P.; Howard, S.F.; Qiu, W.; Kovács, L.G. Transcriptional up-regulation of grapevine MLO genes in response to powdery mildew infection. Am. J. Enol. Vitic. 2008, 59, 159–168. [Google Scholar]
- Feechan, A.; Jermakow, A.M.; Dry, I.B. Grapevine MLO candidates required for powdery mildew pathogenicity? Plant Signal. Behav. 2009, 4, 522–523. [Google Scholar] [CrossRef]
- Pessina, S.; Lenzi, L.; Perazzolli, M.; Campa, M.; Dalla Costa, L.; Urso, S.; Valè, G.; Salamini, F.; Velasco, R.; Malnoy, M. Knockdown of MLO genes reduces susceptibility to powdery mildew in grapevine. Hortic. Res. 2016, 3. [Google Scholar] [CrossRef]
- Madeira, F.; Park, Y.M.; Lee, J.; Buso, N.; Gur, T.; Madhusoodanan, N.; Basutkar, P.; Tivey, A.R.N.; Potter, S.C.; Finn, R.D.; et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 2019, 47, W636–W641. [Google Scholar] [CrossRef]
- Vitulo, N.; Forcato, C.; Carpinelli, E.; Telatin, A.; Campagna, D.; D’Angelo, M.; Zimbello, R.; Corso, M.; Vannozzi, A.; Bonghi, C.; et al. A deep survey of alternative splicing in grape reveals changes in the splicing machinery related to tissue, stress condition and genotype. BMC Plant Biol. 2014, 14, 99. [Google Scholar] [CrossRef]
- Canaguier, A.; Grimplet, J.; Di Gaspero, G.; Scalabrin, S.; Duchêne, E.; Choisne, N.; Mohellibi, N.; Guichard, C.; Rombauts, S.; Le Clainche, I.; et al. A new version of the grapevine reference genome assembly (12X.v2) and of its annotation (VCost.v3). Genomics Data 2017, 14, 56–62. [Google Scholar] [CrossRef]
- Li, H.; Durbin, R. Fast and accurate long-read alignment with Burrows–Wheeler transform. Bioinformatics 2010, 26, 589–595. [Google Scholar] [CrossRef]
- Staden, R.; Beal, K.F.; Bonfield, J.K. The staden package, 1998. In Bioinformatics Methods and Protocols; Humana Press: Totowa, NJ, USA, 2000; pp. 115–130. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Danecek, P.; Auton, A.; Abecasis, G.; Albers, C.A.; Banks, E.; DePristo, M.A.; Handsaker, R.E.; Lunter, G.; Marth, G.T.; Sherry, S.T.; et al. The variant call format and VCFtools. Bioinformatics 2011, 27, 2156–2158. [Google Scholar] [CrossRef] [PubMed]
- Cingolani, P.; Platts, A.; Wang, L.L.; Coon, M.; Nguyen, T.; Wang, L.; Land, S.J.; Lu, X.; Ruden, D.M. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff. Fly 2012, 6, 80–92. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Henikoff, S.; Ng, P.C. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat. Protoc. 2009, 4, 1073–1082. [Google Scholar] [CrossRef] [PubMed]
- Betts, M.J.; Russel, R.B. Amino acid properties and consequences of substitutions. In Bioinformatics for Geneticists; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2003; pp. 289–316. ISBN 0-470-84393-4. [Google Scholar]
- Stephens, M.; Smith, N.J.; Donnelly, P. A new statistical method for haplotype reconstruction from population data. Am. J. Hum. Genet. 2001, 68, 978–989. [Google Scholar] [CrossRef]
- OIV (International Organisation of Vine and Wine). OIV Descriptor List for Grape Varieties and Vitis Species; OIV: Paris, France, 2009. [Google Scholar]
- Zeilmaker, T. Functional and Applied Aspects of the DOWNY MILDEW RESISTANT 1 and 6 Genes in Arabidopsis. Ph.D. Thesis, Utrecht University, Utrecht, The Netherlands, 2012. [Google Scholar]
- Proost, S.; Van Bel, M.; Vaneechoutte, D.; Van De Peer, Y.; Inzé, D.; Mueller-Roeber, B.; Vandepoele, K. PLAZA 3.0: An access point for plant comparative genomics. Nucleic Acids Res. 2015, 43, D974–D981. [Google Scholar] [CrossRef]
- Zimmermann, L.; Stephens, A.; Nam, S.Z.; Rau, D.; Kübler, J.; Lozajic, M.; Gabler, F.; Söding, J.; Lupas, A.N.; Alva, V. A Completely Reimplemented MPI Bioinformatics Toolkit with a New HHpred Server at its Core. J. Mol. Biol. 2018, 430, 2237–2243. [Google Scholar] [CrossRef]
- Kluza, A.; Niedzialkowska, E.; Kurpiewska, K.; Wojdyla, Z.; Quesne, M.; Kot, E.; Porebski, P.J.; Borowski, T. Crystal structure of thebaine 6-O-demethylase from the morphine biosynthesis pathway. J. Struct. Biol. 2018, 202, 229–235. [Google Scholar] [CrossRef]
- Amrine, K.C.H.; Blanco-Ulate, B.; Riaz, S.; Pap, D.; Jones, L.; Figueroa-Balderas, R.; Walker, M.A.; Cantu, D. Comparative transcriptomics of Central Asian Vitis vinifera accessions reveals distinct defense strategies against powdery mildew. Hortic. Res. 2015, 2. [Google Scholar] [CrossRef]
- Cadle-Davidson, L. Variation within and between Vitis spp. for foliar resistance to the downy mildew pathogen Plasmopara viticola. Plant Dis. 2008, 92, 1577–1584. [Google Scholar] [CrossRef]
- Lijavetzky, D.; Cabezas, J.; Ibáñez, A.; Rodríguez, V.; Martínez-Zapater, J.M. High throughput SNP discovery and genotyping in grapevine (Vitis vinifera L.) by combining a re-sequencing approach and SNPlex technology. BMC Genomics 2007, 8, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Vezzulli, S.; Micheletti, D.; Riaz, S.; Pindo, M.; Viola, R.; This, P.; Walker, M.A.; Troggio, M.; Velasco, R. A SNP transferability survey within the genus Vitis. BMC Plant Biol. 2008, 8, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Vezzulli, S.; Troggio, M.; Coppola, G.; Jermakow, A.; Cartwright, D.; Zharkikh, A.; Stefanini, M.; Grando, M.S.; Viola, R.; Adam-Blondon, A.F.; et al. A reference integrated map for cultivated grapevine (Vitis vinifera L.) from three crosses, based on 283 SSR and 501 SNP-based markers. Theor. Appl. Genet. 2008, 117, 499–511. [Google Scholar] [CrossRef]
- Salmaso, M.; Faes, G.; Segala, C.; Stefanini, M.; Salakhutdinov, I.; Zyprian, E.; Toepfer, R.; Grando, M.S.; Velasco, R. Genome diversity and gene haplotypes in the grapevine (Vitis. Mol. Breed. 2004, 385–395. [Google Scholar] [CrossRef]
- Marrano, A.; Birolo, G.; Prazzoli, M.L.; Lorenzi, S.; Valle, G.; Grando, M.S. SNP-discovery by RAD-sequencing in a germplasm collection of wild and cultivated grapevines (V. vinifera L.). PLoS ONE 2017, 12, e170655. [Google Scholar] [CrossRef]
- Schneider, K.; Weisshaar, B.; Borchardt, D.C.; Salamini, F. SNP frequency and allelic haplotype structure of Beta vulgaris expressed genes. Mol. Breed. 2001, 8, 63–74. [Google Scholar] [CrossRef]
- Simko, I.; Haynes, K.G.; Jones, R.W. Assessment of linkage disequilibrium in potato genome with single nucleotide polymorphism markers. Genetics 2006, 173, 2237–2245. [Google Scholar] [CrossRef]
- Byers, R.L.; Harker, D.B.; Yourstone, S.M.; Maughan, P.J.; Udall, J.A. Development and mapping of SNP assays in allotetraploid cotton. Theor. Appl. Genet. 2012, 124, 1201–1214. [Google Scholar] [CrossRef]
- Zhu, Y.L.; Song, Q.J.; Hyten, D.L.; Van Tassell, C.P.; Matukumalli, L.K.; Grimm, D.R.; Hyatt, S.M.; Fickus, E.W.; Young, N.D.; Cregan, P.B. Single-nucleotide polymorphisms in soybean. Genetics 2003, 163, 1123–1134. [Google Scholar] [PubMed]
- Wu, S.B.; Wirthensohn, M.G.; Hunt, P.; Gibson, J.P.; Sedgley, M. High resolution melting analysis of almond SNPs derived from ESTs. Theor. Appl. Genet. 2008, 118, 1–14. [Google Scholar] [CrossRef]
- Salmaso, M.; Malacarne, G.; Troggio, M.; Faes, G.; Stefanini, M.; Grando, M.S.; Velasco, R. A grapevine (Vitis vinifera L.) genetic map integrating the position of 139 expressed genes. Theor. Appl. Genet. 2008, 116, 1129–1143. [Google Scholar] [CrossRef] [PubMed]
- Aranzana, M.J.; Illa, E.; Howad, W.; Arús, P. A first insight into peach [Prunus persica (L.) Batsch] SNP variability. Tree Genet. Genomes 2012, 8, 1359–1369. [Google Scholar] [CrossRef]
- Tuskan, G.A.; Difazio, S.; Jansson, S.; Bohlmann, J.; Grigoriev, I.; Hellsten, U.; Putnam, N.; Ralph, S.; Rombauts, S.; Salamov, A.; et al. The Genome of Black Cottonwood Populus trichocarpa (Torr. & Gray). Science 2006, 313, 1596–1604. [Google Scholar] [CrossRef] [PubMed]
- Thavamanikumar, S.; McManus, L.J.; Tibbits, J.F.G.; Bossinger, G. The significance of single nucleotide polymorphisms (SNPs) in Eucalyptus globulus breeding programs. Aust. For. 2011, 74, 23–29. [Google Scholar] [CrossRef]
- Emanuelli, F.; Lorenzi, S.; Grzeskowiak, L.; Catalano, V.; Stefanini, M.; Troggio, M.; Myles, S.; Martinez-Zapater, J.M.; Zyprian, E.; Moreira, F.M.; et al. Genetic diversity and population structure assessed by SSR and SNP markers in a large germplasm collection of grape. BMC Plant Biol. 2013, 13, 1–17. [Google Scholar] [CrossRef]
- Jones, E.S.; Sullivan, H.; Bhattramakki, D.; Smith, J.S.C. A comparison of simple sequence repeat and single nucleotide polymorphism marker technologies for the genotypic analysis of maize (Zea mays L.). Theor. Appl. Genet. 2007, 115, 361–371. [Google Scholar] [CrossRef]
- Grattapaglia, D.; Silva-Junior, O.B.; Kirst, M.; de Lima, B.M.; Faria, D.A.; Pappas, G.J. High-throughput SNP genotyping in the highly heterozygous genome of Eucalyptus: Assay success, polymorphism and transferability across species. BMC Plant Biol. 2011, 11, 65. [Google Scholar] [CrossRef]
- Biswas, C.; Dey, P.; Karmakar, P.G.; Satpathy, S. Discovery of large-scale SNP markers and construction of linkage map in a RIL population of jute (Corchorus capsularis). Mol. Breed. 2015, 35, 1–10. [Google Scholar] [CrossRef]
- Cheng, L.; Chen, X.; Jiang, C.; Ma, B.; Ren, M.; Cheng, Y.; Liu, D.; Geng, R.; Yang, A. High-density SNP genetic linkage map construction and quantitative trait locus mapping for resistance to cucumber mosaic virus in tobacco (Nicotiana tabacum L.). Crop J. 2019, 7, 539–547. [Google Scholar] [CrossRef]
- Aflitos, S.; Schijlen, E.; De Jong, H.; De Ridder, D.; Smit, S.; Finkers, R.; Wang, J.; Zhang, G.; Li, N.; Mao, L.; et al. Exploring genetic variation in the tomato (Solanum section Lycopersicon) clade by whole-genome sequencing. Plant J. 2014, 80, 136–148. [Google Scholar] [CrossRef]
- Xanthopoulou, A.; Montero-Pau, J.; Mellidou, I.; Kissoudis, C.; Blanca, J.; Picó, B.; Tsaballa, A.; Tsaliki, E.; Dalakouras, A.; Paris, H.S.; et al. Whole-genome resequencing of Cucurbita pepo morphotypes to discover genomic variants associated with morphology and horticulturally valuable traits. Hortic. Res. 2019, 6. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.; Wang, Z.; Tian, L.; Zhang, Y.; Qi, D.; Huo, H.; Xu, J.; Li, Z.; Liao, R.; Shi, M.; et al. De novo assembly of a wild pear (Pyrus betuleafolia) genome. Plant Biotechnol. J. 2019, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Cardone, M.F.; D’Addabbo, P.; Alkan, C.; Bergamini, C.; Catacchio, C.R.; Anaclerio, F.; Chiatante, G.; Marra, A.; Giannuzzi, G.; Perniola, R.; et al. Inter-varietal structural variation in grapevine genomes. Plant J. 2016, 88, 648–661. [Google Scholar] [CrossRef] [PubMed]
- Baudhuin, L.M.; Lagerstedt, S.A.; Klee, E.W.; Fadra, N.; Oglesbee, D.; Ferber, M.J. Confirming variants in next-generation sequencing panel testing by sanger sequencing. J. Mol. Diagnostics 2015, 17, 456–461. [Google Scholar] [CrossRef]
- Mu, W.; Lu, H.M.; Chen, J.; Li, S.; Elliott, A.M. Sanger Confirmation Is Required to Achieve Optimal Sensitivity and Specificity in Next-Generation Sequencing Panel Testing. J. Mol. Diagnostics 2016, 18, 923–932. [Google Scholar] [CrossRef] [PubMed]
- Quaynor, S.D.; Bosley, M.E.; Duckworth, C.G.; Porter, K.R.; Kim, S.H.; Kim, H.G.; Chorich, L.P.; Sullivan, M.E.; Choi, J.H.; Cameron, R.S.; et al. Targeted next generation sequencing approach identifies eighteen new candidate genes in normosmic hypogonadotropic hypogonadism and Kallmann syndrome. Mol. Cell. Endocrinol. 2016, 437, 86–96. [Google Scholar] [CrossRef] [PubMed]
- Strom, S.P.; Lee, H.; Das, K.; Vilain, E.; Nelson, S.F.; Grody, W.W.; Deignan, J.L. Assessing the necessity of confirmatory testing for exome-sequencing results in a clinical molecular diagnostic laboratory. Genet. Med. 2014, 16, 510–515. [Google Scholar] [CrossRef]
- Zheng, J.; Zhang, H.; Banerjee, S.; Li, Y.; Zhou, J.; Yang, Q.; Tan, X.; Han, P.; Fu, Q.; Cui, X.; et al. A comprehensive assessment of Next-Generation Sequencing variants validation using a secondary technology. Mol. Genet. Genomic Med. 2019, 7, 1–7. [Google Scholar] [CrossRef]
- Satya, R.V.; DiCarlo, J. Edge effects in calling variants from targeted amplicon sequencing. BMC Genomics 2014, 15, 1–7. [Google Scholar] [CrossRef]
- Lacombe, T.; Audeguin, L.; Boselli, M.; Bucchetti, B.; Cabello, F.; Chatelet, P.; Crespan, M.; D’Onofrio, C.; Eiras Dias, J.; Ercisli, S.; et al. Grapevine European Catalogue: Towards a comprehensive list. Vitis 2011, 50, 65–68. [Google Scholar]
- Excoffier, L.; Langaney, A. Origin and Differentiation of Human Mitochondrial DNA. J. Hum. Genet. 1989, 44, 73. [Google Scholar] [PubMed]
- Watterson, G.A.; Guess, H.A. Is the most frequent allele the oldest? Theor. Popul. Biol. 1977, 11, 141–160. [Google Scholar] [CrossRef]
- Donnelly, P.; Tavaré, S. The ages of alleles and a coalescent. Adv. Appl. Probab. 1986, 18, 1–19. [Google Scholar] [CrossRef]
- Riahi, L.; Zoghlami, N.; Dereeper, A.; Laucou, V.; Mliki, A.; This, P. Single nucleotide polymorphism and haplotype diversity of the gene NAC4 in grapevine. Ind. Crops Prod. 2013, 43, 718–724. [Google Scholar] [CrossRef]
- Fernandez, L.; Le Cunff, L.; Tello, J.; Lacombe, T.; Boursiquot, J.M.; Fournier-Level, A.; Bravo, G.; Lalet, S.; Torregrosa, L.; This, P.; et al. Haplotype diversity of VvTFL1A gene and association with cluster traits in grapevine (V. vinifera). BMC Plant Biol. 2014, 14, 1–14. [Google Scholar] [CrossRef]
- Nicolas, S.D.; Péros, J.P.; Lacombe, T.; Launay, A.; Le Paslier, M.C.; Bérard, A.; Mangin, B.; Valière, S.; Martins, F.; Le Cunff, L.; et al. Genetic diversity, linkage disequilibrium and power of a large grapevine (Vitis vinifera L) diversity panel newly designed for association studies. BMC Plant Biol. 2016, 16, 1–19. [Google Scholar] [CrossRef]
- Magris, G.; Di Gaspero, G.; Marroni, F.; Zenoni, S.; Tornielli, G.B.; Celii, M.; De Paoli, E.; Pezzotti, M.; Conte, F.; Paci, P.; et al. Genetic, epigenetic and genomic effects on variation of gene expression among grape varieties. Plant J. 2019, 99, 895–909. [Google Scholar] [CrossRef]
- Foria, S.; Copetti, D.; Eisenmann, B.; Magris, G.; Vidotto, M.; Scalabrin, S.; Testolin, R.; Cipriani, G.; Wiedemann-Merdinoglu, S.; Bogs, J.; et al. Gene duplication and transposition of mobile elements drive evolution of the Rpv3 resistance locus in grapevine. Plant J. 2020, 101, 529–542. [Google Scholar] [CrossRef]
- Schaart, J.G.; van de Wiel, C.C.M.; Lotz, L.A.P.; Smulders, M.J.M. Opportunities for Products of New Plant Breeding Techniques. Trends Plant Sci. 2016, 21, 438–449. [Google Scholar] [CrossRef]
- Bisht, D.S.; Bhatia, V.; Bhattacharya, R. Improving plant-resistance to insect-pests and pathogens: The new opportunities through targeted genome editing. Semin. Cell Dev. Biol. 2019, 1–12. [Google Scholar] [CrossRef]
- Pompili, V.; Dalla Costa, L.; Piazza, S.; Pindo, M.; Malnoy, M. Reduced fire blight susceptibility in apple cultivars using a high-efficiency CRISPR/Cas9-FLP/FRT-based gene editing system. Plant Biotechnol. J. 2020, 18, 845–858. [Google Scholar] [CrossRef] [PubMed]
- Low, Y.C.; Lawton, M.A.; Di, R. Validation of barley 2OGO gene as a functional orthologue of Arabidopsis DMR6 gene in Fusarium head blight susceptibility. Sci. Rep. 2020, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Ffrench-Constant, R.H.; Bass, C. Does resistance really carry a fitness cost? Curr. Opin. Insect Sci. 2017, 21, 39–46. [Google Scholar] [CrossRef]
- Zaidi, S.S.E.A.; Mukhtar, M.S.; Mansoor, S. Genome Editing: Targeting Susceptibility Genes for Plant Disease Resistance. Trends Biotechnol. 2018, 36, 898–906. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Leal, D.; Lemmon, Z.H.; Man, J.; Bartlett, M.E.; Lippman, Z.B. Engineering Quantitative Trait Variation for Crop Improvement by Genome Editing. Cell 2017, 171, 470–480.e8. [Google Scholar] [CrossRef]
- Wolter, F.; Puchta, H. Application of CRISPR/Cas to Understand Cis- and Trans-Regulatory Elements in Plants. In Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2018; pp. 23–40. [Google Scholar]
- Bastet, A.; Robaglia, C.; Gallois, J.L. eIF4E Resistance: Natural Variation Should Guide Gene Editing. Trends Plant Sci. 2017, 22, 411–419. [Google Scholar] [CrossRef]
- Bastet, A.; Zafirov, D.; Giovinazzo, N.; Guyon-Debast, A.; Nogué, F.; Robaglia, C.; Gallois, J.-L. Mimicking natural polymorphism in eIF4E by CRISPR-Cas9 base editing is associated with resistance to potyviruses. Plant Biotechnol. J. 2019, 17, 1736–1750. [Google Scholar] [CrossRef]





| Gene | ID | Amplicon | Illumina Forward Primer 5′-3′ | Illumina Reverse Primer 3′-5′ | Amplicon Position |
|---|---|---|---|---|---|
| VvDMR6.1 | VIT_216s0098g00860 | 1 | CTGCTTAGTAGAGTGGTTAT | CGATGTGTTGGATGAGTTGG | Intron-Exon 1 Junction |
| 2 | ATGTCCCCATAATCGACCTC | GTAGAACTCATCGGCCACCT | Exon 1- Intron Junction | ||
| 3 | ATGGGGTAGCTGCAGAAATG | TTGAAGGAAGGAGGATTGGA | Exon 2 | ||
| 4 | TCTCGAACAAATCCTAATTCAAAA | GAAGAATGGTAAGGGCGTTG | Intron-Exon 3 Junction | ||
| 5 | AACCCGAGCTCACTTATGGA | AAATTTTAAAAACCGGGCAAA | Exon 3-Intron Junction | ||
| 6 | GGAAATGGGCATGTGCTAATA | TGCCCCAGAACTTCTTGTAA | Intron-Exon 4 Junction | ||
| VvDMR6.2 | VIT_213s0047g00210 | 1 | TCGGAGTCTTCACTCCCTTT | GCCATAACGGCTACAAGCAT | Exon 1 |
| 2 | GGTGTGGATGTGACCAGTGA | CCAAAGGATGGCAATGAAGT | Intron-Exon 2 Junction | ||
| 3 | AGGAGAAAGTGCACAATTGGA | TCCGAAAAGGAAAAATGATGC | Exon 2-Intron Junction | ||
| 4 | TCCAAAATGAAGACATAAGAAGGA | TATGTGCTGGCAGTCCGTAA | Intron-Exon 3 Junction | ||
| 5 | CTTGTCCCGAGCCAGAGTTA | CCTGCATGCAATCATTTGTT | Exon 3-Intron Junction | ||
| 6 | CCCAGGTGCTTTTGTTGTTA | CCCTTGCTGGACTAATGAGC | Exon 3- Exon 4 Junction | ||
| 7 | CGATTGCTTCTTTCCTCTGC | CGCATTATGCCTTGTTGAAG | Exon 4 | ||
| VvDLO1 | VIT_215s0048g02430 | 1 | ACAGGCCATCCCTCAGTACA | ATCGACATGTACCCGAAAAA | Exon 1 |
| 2 | CCTTGCTTTGACATGATTCTTC | TGAAAGATGGAGGGTTGGAG | Exon 2 | ||
| 3 | CCAACTGGAGAGATTTCCTGA | CGCCTTATCTATGTGGTTCCTC | Exon 2- Exon 3 Junction | ||
| 4 | CTGGCCATGCTGATCCTAAT | CCTATGGACCGCACTCTTGT | Exon 3- Exon 4 Junction | ||
| 5 | TTCCTGTAAAGGGCAGGATG | TTCCTGTAAAGGGCAGGATG | Exon 3- Exon 4 Junction | ||
| VvDLO2 | VIT_202s0025g02970 | 1 | CAACCCCCACTTGTGAATTT | CTTGGCCAATCTGTTTGACA | Intron-Exon 1 Junction |
| 2 | AAGGATGTCCAGGCATCAGA | GAGCCTGACTGGATTGGAAG | Exon 1 | ||
| 3 | AGCTGCCAGAAAGCGAGA | CATGTAACTGCATGTTGGTCAG | Exon 1-Intron Junction | ||
| 4 | TCTGACCAACATGCAGTTACA | TCTTGGAGAAGAACTGTGATTAAA | Intron-Exon 2 Junction | ||
| 5 | CTTATGGGTTGCCTGGACAT | TTTTCCTCATTTTTGCAGGTG | Exon 2-Intron Junction |
| Genotype | Taxon | VvDMR6.1 Haplotype | VvDMR6.2 Haplotype | VvDLO1 Haplotype | VvDLO2 Haplotype | OIV 452(-1) |
|---|---|---|---|---|---|---|
| PN40024 | 1,1 | 1,1 | 1,1 | 1,1 | ||
| B87-60 | Vitis hybrid | 5,8 | - | - | - | |
| Blanc du Bois | Vitis hybrid | 15,16 | - | - | - | 6 † |
| Blue Lake | Vitis hybrid | 5,8 | 8,13 | - | - | 8 † |
| Captivator | Vitis hybrid | - | 7,8 | - | - | 7 † |
| Catawba | Vitis hybrid | - | 1,3 | - | - | 3 ‡ |
| Chancellor | Vitis hybrid | 1,17 | - | - | 1,19 | 1 ‡ |
| Clinton | Vitis hybrid | - | 10,10 | - | 7,14 | 1 † |
| D’Arpa | Vitis hybrid | - | 7,8 | - | - | 9 † |
| Diamond | Vitis hybrid | - | - | - | 1,19 | 5 ‡ |
| F560 Big Brown | Vitis hybrid | - | - | 8,9 | - | 9 † |
| FLA 449 | Vitis hybrid | - | 1,10 | - | - | |
| FLA W1521 | Vitis hybrid | - | 8,8 | - | - | 8 † |
| Golden Muscat | Vitis hybrid | - | 5,10 | - | 1,14 | 2 ‡ |
| Herbert | Vitis hybrid | - | 5,10 | 1,3 | - | |
| Kunleany | Vitis hybrid | - | - | 1,7 | - | 9 † |
| Lenoir | Vitis hybrid | - | - | 9,9 | - | 8 † |
| M11-14St. George | Vitis hybrid | - | - | - | 1,6 | 9 † |
| Mantey | Vitis hybrid | - | - | 2,2 | - | |
| Mars | Vitis hybrid | - | 1,9 | - | - | 8 † |
| MW66 | Vitis hybrid | 2,3 | - | - | - | 5 † |
| NY08.0701b | Vitis hybrid | 12,14 | - | - | - | |
| NY63.1016.01 | Vitis hybrid | 11,13 | - | - | - | |
| NY65.0562.01 | Vitis hybrid | - | - | - | 1,15 | |
| NY84.0100.05 | Vitis hybrid | 1,13 | - | - | - | |
| NY97.0503.02 | Vitis hybrid | - | - | - | 7,14 | |
| NY97.0512.01 | Vitis hybrid | - | 1,4 | - | 1,17 | |
| Ontario | Vitis hybrid | - | - | - | 1,4 | 5 ‡ |
| Petra | Vitis hybrid | 7,9 | 1,6 | 4,5 | - | 9 † |
| Pixiola | Vitis hybrid | - | - | - | 1,18 | |
| Schuyler | Vitis hybrid | - | - | - | 1,14 | 5† |
| Seibel 880 | Vitis hybrid | - | - | - | 1,14 | |
| Sheridan | Vitis hybrid | - | 10,10 | - | - | |
| Steuben | Vitis hybrid | - | - | - | 1,5 | 2 ‡ |
| V. riparia x V. cordifolia | Vitis hybrid | - | - | - | 11,14 | |
| Venus | Vitis hybrid | - | 5,8 | - | - | 7 † |
| Wayne | Vitis hybrid | - | 5,10 | - | - | |
| Worden | Vitis hybrid | - | 10,10 | - | 1,16 | |
| V. aestivalis | Vitis spp. | - | - | - | 10,18 | 9 ‡ |
| V. berlandieri Texas | Vitis spp. | - | - | 4,4 | 8,9 | 9 † |
| V. cordifolia | Vitis spp. | - | - | 1,4 | 8,19 | 9 † |
| V. rubra | Vitis spp. | - | 1,12 | - | - | 9 † |
| V. rupestris du Lot | Vitis spp. | 4,10 | - | - | - | 9 † |
| V. smalliana | Vitis spp. | - | - | 6,1 | 1,19 | |
| Coia1 | Vitis spp./hybrid | - | 10,11 | - | - | 9 † |
| Coia5 | Vitis spp./hybrid | - | 10,10 | - | - | 9 † |
| Coia7 | Vitis spp./hybrid | - | 10,14 | - | 7,19 | 9 † |
| Coia9 | Vitis spp./hybrid | - | 10,1 | - | - | 9 † |
| Coia10 | Vitis spp./hybrid | - | 10,10 | - | - | 9 † |
| Coia11 | Vitis spp./hybrid | - | 10,10 | - | - | 9 † |
| Coia12 | Vitis spp./hybrid | - | 10,10 | - | 3,19 | not available |
| Corella2 | Vitis spp./hybrid | - | - | - | 1,18 | not available |
| Lorenzo1 | Vitis spp./hybrid | - | - | - | 12,13 | 9 † |
| Franconia | Vitis vinifera | - | - | - | 1,2 | 1 † |
| Italia | Vitis vinifera | - | 1,2 | - | - | 1 † |
| Pinot gris | Vitis vinifera | 6,15 | - | - | - | 1 † |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pirrello, C.; Zeilmaker, T.; Bianco, L.; Giacomelli, L.; Moser, C.; Vezzulli, S. Mining Grapevine Downy Mildew Susceptibility Genes: A Resource for Genomics-Based Breeding and Tailored Gene Editing. Biomolecules 2021, 11, 181. https://doi.org/10.3390/biom11020181
Pirrello C, Zeilmaker T, Bianco L, Giacomelli L, Moser C, Vezzulli S. Mining Grapevine Downy Mildew Susceptibility Genes: A Resource for Genomics-Based Breeding and Tailored Gene Editing. Biomolecules. 2021; 11(2):181. https://doi.org/10.3390/biom11020181
Chicago/Turabian StylePirrello, Carlotta, Tieme Zeilmaker, Luca Bianco, Lisa Giacomelli, Claudio Moser, and Silvia Vezzulli. 2021. "Mining Grapevine Downy Mildew Susceptibility Genes: A Resource for Genomics-Based Breeding and Tailored Gene Editing" Biomolecules 11, no. 2: 181. https://doi.org/10.3390/biom11020181
APA StylePirrello, C., Zeilmaker, T., Bianco, L., Giacomelli, L., Moser, C., & Vezzulli, S. (2021). Mining Grapevine Downy Mildew Susceptibility Genes: A Resource for Genomics-Based Breeding and Tailored Gene Editing. Biomolecules, 11(2), 181. https://doi.org/10.3390/biom11020181

