Chemopreventive Effect of 5-Flurouracil Polymeric Hybrid PLGA-Lecithin Nanoparticles against Colon Dysplasia Model in Mice and Impact on p53 Apoptosis
Abstract
1. Introduction
2. Materials and Methods
2.1. Drugs and Chemicals
2.2. Formulating the Hybrid Poly(Lactic-co-glycolic Acid) (PLGA)-Lecithin Nanoparticles
2.3. Optimization of Formulation Variables
2.4. Characterization and Evaluation of the Optimized Formula
2.4.1. Particle Size, Polydispersity Index, and Zeta Potential (ZP)
2.4.2. Encapsulation Efficiency (EE%)
2.4.3. In Vitro Drug Release of Mixed 5FU-PLNs
2.5. In Vivo Pharmacological Activity
2.5.1. Experimental Animals
2.5.2. Drugs and Chemicals
2.5.3. Experimental Groups
2.5.4. Animal Sacrifice and Blood/Tissue Sampling
2.5.5. Determination of Colonic Expression of p53 and Caspase 3
RNA Extraction
Real Time-PCR Detection of p53 and Caspase 3 Gene Expression
2.5.6. Histopathological Examination of Colon Tissue
2.5.7. Immunohistochemistry
2.5.8. Digital Morphometric Study
2.5.9. Statistical Analysis and Data Presentation
3. Results
3.1. Formulae Optimization and Characterizations
3.2. Results of the In Vivo Study
3.2.1. Colonic Expression of the Target Genes
3.2.2. Histopathological Examination and Histologic Grading of Colonic Mucosal Lesions
3.2.3. Immunohistochemical Expression of Ki-67 in Colon Tissue
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Arnold, M.; Abnet, C.C.; Neale, R.E.; Vignat, J.; Giovannucci, E.L.; McGlynn, K.A.; Bray, F.J.G. Global burden of 5 major types of gastrointestinal cancer. Gastroenterology 2020, 159, 335–349.e15. [Google Scholar] [CrossRef]
- Tanaka, T. Colorectal carcinogenesis: Review of human and experimental animal studies. J. Carcinog. 2009, 8, 5. [Google Scholar] [CrossRef]
- Perše, M.; Cerar, A.J.B.R.I. Morphological and molecular alterations in 1, 2 dimethylhydrazine and azoxymethane induced colon carcinogenesis in rats. J. Biomed. Biotechnol. 2010, 2011, 1–14. [Google Scholar] [CrossRef]
- Zaafar, D.K.; Zaitone, S.A.; Moustafa, Y.M. Role of metformin in suppressing 1,2-dimethylhydrazine-induced colon cancer in diabetic and non-diabetic mice: Effect on tumor angiogenesis and cell proliferation. PLoS ONE 2014, 9, e100562. [Google Scholar] [CrossRef]
- Tawfik, M.K.; Mohamed, M.I. Exenatide suppresses 1,2-dimethylhydrazine-induced colon cancer in diabetic mice: Effect on tumor angiogenesis and cell proliferation. Biomed. Pharm. 2016, 82, 106–116. [Google Scholar] [CrossRef]
- Guimarães, P.P.G.; Oliveira, S.R.; de Castro Rodrigues, G.; Gontijo, S.M.L.; Lula, I.S.; Cortés, M.E.; Denadai, Â.M.L.; Sinisterra, R.D.J.M. Development of sulfadiazine-decorated plga nanoparticles loaded with 5-fluorouracil and cell viability. Molecules 2015, 20, 879–899. [Google Scholar] [CrossRef]
- Gullotti, E.; Yeo, Y. Extracellularly activated nanocarriers: A new paradigm of tumor targeted drug delivery. Mol. Pharm. 2009, 6, 1041–1051. [Google Scholar] [CrossRef]
- Tahir, N.; Madni, A.; Correia, A.; Rehman, M.; Balasubramanian, V.; Khan, M.M.; Santos, H.A. Lipid-polymer hybrid nanoparticles for controlled delivery of hydrophilic and lipophilic doxorubicin for breast cancer therapy. Int. J. Nanomed. 2019, 14, 4961–4974. [Google Scholar] [CrossRef]
- Mohanty, A.; Uthaman, S.; Park, I.K. Utilization of polymer-lipid hybrid nanoparticles for targeted anti-cancer therapy. Molecules 2020, 25, 4377. [Google Scholar] [CrossRef]
- Wu, B.; Lu, S.-T.; Zhang, L.-J.; Zhuo, R.-X.; Xu, H.-B.; Huang, S. Codelivery of doxorubicin and triptolide with reduction-sensitive lipid–polymer hybrid nanoparticles for in vitro and in vivo synergistic cancer treatment. Int. J. Nanomed. 2017, 12, 1853. [Google Scholar] [CrossRef]
- Mukherjee, A.; Waters, A.K.; Kalyan, P.; Achrol, A.S.; Kesari, S.; Yenugonda, V.M. Lipid–polymer hybrid nanoparticles as a next-generation drug delivery platform: State of the art, emerging technologies, and perspectives. Int. J. Nanomed. 2019, 14, 1937. [Google Scholar] [CrossRef] [PubMed]
- Chan, J.M.; Zhang, L.; Yuet, K.P.; Liao, G.; Rhee, J.-W.; Langer, R.; Farokhzad, O.C. Plga–lecithin–peg core–shell nanoparticles for controlled drug delivery. Biomaterials 2009, 30, 1627–1634. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Xiang, D.; Shigdar, S.; Yang, W.; Li, Q.; Lin, J.; Liu, K.; Duan, W. Epithelial cell adhesion molecule aptamer functionalized plga-lecithin-curcumin-peg nanoparticles for targeted drug delivery to human colorectal adenocarcinoma cells. Int. J. Nanomed. 2014, 9, 1083–1096. [Google Scholar]
- Pandita, D.; Kumar, S.; Lather, V. Hybrid poly(lactic-co-glycolic acid) nanoparticles: Design and delivery prospectives. Drug Discov. Today 2015, 20, 95–104. [Google Scholar] [CrossRef]
- Bose, R.J.; Lee, S.H.; Park, H. Lipid-based surface engineering of plga nanoparticles for drug and gene delivery applications. Biomater. Res. 2016, 20, 34. [Google Scholar] [CrossRef]
- Hallan, S.S.; Kaur, P.; Kaur, V.; Mishra, N.; Vaidya, B. Lipid polymer hybrid as emerging tool in nanocarriers for oral drug delivery. Artif. Cells Nanomed. Biotechnol. 2016, 44, 334–349. [Google Scholar] [CrossRef]
- Rao, S.; Prestidge, C.A. Polymer-lipid hybrid systems: Merging the benefits of polymeric and lipid-based nanocarriers to improve oral drug delivery. Expert Opin. Drug Deliv. 2016, 13, 691–707. [Google Scholar] [CrossRef]
- Coskun, M.; Vermeire, S.; Nielsen, O.H. Novel targeted therapies for inflammatory bowel disease. Trends Pharm. Sci. 2017, 38, 127–142. [Google Scholar] [CrossRef]
- Sgorla, D.; Bunhak, É.J.; Cavalcanti, O.A.; Fonte, P.; Sarmento, B.J.E. Exploitation of lipid-polymeric matrices at nanoscale for drug delivery applications. Opin. Drug Deliv. 2016, 13, 1301–1309. [Google Scholar] [CrossRef]
- Berthet, M.; Gauthier, Y.; Lacroix, C.; Verrier, B.; Monge, C.J. Nanoparticle-based dressing: The future of wound treatment? Trends Biotechnol. 2017, 35, 770–784. [Google Scholar] [CrossRef]
- Rezvantalab, S.; Drude, N.I.; Moraveji, M.K.; Guvener, N.; Koons, E.K.; Shi, Y.; Lammers, T.; Kiessling, F. Plga-based nanoparticles in cancer treatment. Front. Pharm. 2018, 9, 1260. [Google Scholar] [CrossRef] [PubMed]
- Maghrebi, S.; Prestidge, C.A.; Joyce, P. An update on polymer-lipid hybrid systems for improving oral drug delivery. Expert Opin. Drug Deliv. 2019, 16, 507–524. [Google Scholar] [CrossRef] [PubMed]
- Ghitman, J.; Biru, E.I.; Stan, R.; Iovu, H.J.M. Review of hybrid plga nanoparticles: Future of smart drug delivery and theranostics medicine. Mater. Des. 2020, 193, 108805. [Google Scholar] [CrossRef]
- Mandal, B.; Bhattacharjee, H.; Mittal, N.; Sah, H.; Balabathula, P.; Thoma, L.A.; Wood, G.C. Core–shell-type lipid–polymer hybrid nanoparticles as a drug delivery platform. Nanomed. Nanotechnol. Biol. Med. 2013, 9, 474–491. [Google Scholar] [CrossRef]
- Hadinoto, K.; Sundaresan, A.; Cheow, W.S.J. Lipid–polymer hybrid nanoparticles as a new generation therapeutic delivery platform: A review. Eur. J. Pharm. Biopharm. 2013, 85, 427–443. [Google Scholar] [CrossRef] [PubMed]
- Solanki, A.B.; Parikh, J.R.; Parikh, R.H. Formulation and optimization of piroxicam proniosomes by 3-factor, 3-level box-behnken design. AAPS Pharmscitech 2007, 8, E86. [Google Scholar] [CrossRef] [PubMed]
- Nair, K.L.; Jagadeeshan, S.; Nair, S.A.; Kumar, G.S. Biological evaluation of 5-fluorouracil nanoparticles for cancer chemotherapy and its dependence on the carrier, plga. Int. J. Nanomed. 2011, 6, 1685–1697. [Google Scholar]
- Colussi, C.; Fiumicino, S.; Giuliani, A.; Rosini, S.; Musiani, P.; Macrí, C.; Potten, C.S.; Crescenzi, M.; Bignami, M.J. 1, 2-dimethylhydrazine-induced colon carcinoma and lymphoma in msh2−/− mice. J. Natl. Cancer Inst. 2001, 93, 1534–1540. [Google Scholar] [CrossRef]
- Aranganathan, S.; Nalini, N. Antiproliferative efficacy of hesperetin (citrus flavanoid) in 1, 2-dimethylhydrazine-induced colon cancer. Phytother. Res. 2012, 27, 999–1005. [Google Scholar] [CrossRef]
- Ghadi, F.E.; Malhotra, A.; Ghara, A.R.; Dhawan, D. Modulation of fourier transform infrared spectra and total sialic acid levels by selenium during 1, 2 dimethylhydrazine-induced colon carcinogenesis in rats. Nutr. Cancer 2013, 65, 92–98. [Google Scholar] [CrossRef]
- Venkatachalam, K.; Vinayagam, R.; Arokia Vijaya Anand, M.; Isa, N.M.; Ponnaiyan, R. Biochemical and molecular aspects of 1,2-dimethylhydrazine (dmh)-induced colon carcinogenesis: A review. Toxicol. Res. 2020, 9, 2–18. [Google Scholar] [CrossRef] [PubMed]
- Gardouh, A.R.; Barakat, B.M.; Qushawy, M.K.E.; El-Kazzaz, A.Y.; Sami, M.M.; Zaitone, S.A. Antitumor activity of a molecularly imprinted nanopreparation of 5-flurouracil against Ehrlich’s carcinoma solid tumors grown in mice: Comparison to free 5-flurouracil. Chem. Biol. Interact. 2018, 295, 52–63. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− δδct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Jass, J.R. Pathogenesis of colorectal cancer. Surg. Clin. N. Am. 2002, 82, 891–904. [Google Scholar] [CrossRef]
- Cheng, L.; Lai, M.-D.J. Aberrant crypt foci as microscopic precursors of colorectal cancer. World J. Gastroenterol. 2003, 9, 2642. [Google Scholar] [CrossRef]
- Boivin, G.P.; Washington, K.; Yang, K.; Ward, J.M.; Pretlow, T.P.; Russell, R.; Besselsen, D.G.; Godfrey, V.L.; Doetschman, T.; Dove, W.F.; et al. Pathology of mouse models of intestinal cancer: Consensus report and recommendations. Gastroenterology 2003, 124, 762–777. [Google Scholar] [CrossRef]
- Bahr, H.I.; Ibrahiem, A.T.; Gabr, A.M.; Elbahaie, A.M.; Elmahdi, H.S.; Soliman, N.; Youssef, A.M.; El-Sherbiny, M.; Zaitone, S.A. Chemopreventive effect of α-hederin/carboplatin combination against experimental colon hyperplasia and impact on jnk signaling. Toxicol. Mech. Methods 2020, 1–22. [Google Scholar] [CrossRef]
- Perše, M.; Cerar, A.J.R. The dimethylhydrazine induced colorectal tumours in rat-experimental colorectal carcinogenesis. Radiol. Oncol. 2005, 39, 1. [Google Scholar]
- Bertrand, N.; Wu, J.; Xu, X.; Kamaly, N.; Farokhzad, O.C. Cancer nanotechnology: The impact of passive and active targeting in the era of modern cancer biology. Adv. Drug Deliv. Rev. 2014, 66, 2–25. [Google Scholar] [CrossRef]
- Chandran, S.P.; Natarajan, S.B.; Chandraseharan, S.; Shahimi, M.S.B.M. Nano drug delivery strategy of 5-fluorouracil for the treatment of colorectal cancer. J. Cancer Res. Pract. 2017, 4, 45–48. [Google Scholar] [CrossRef]
- Wu, P.; Zhou, Q.; Zhu, H.; Zhuang, Y.; Bao, J. Enhanced antitumor efficacy in colon cancer using egf functionalized plga nanoparticles loaded with 5-fluorouracil and perfluorocarbon. BMC Cancer 2020, 20, 354. [Google Scholar] [CrossRef] [PubMed]
- Ps, S.; Joshi, V.J. Preparation and characterisation of 5-fluorouracil loaded plga nanoparticles for colorectal cancer therapy. Unique J. Pharm. Biol. Sci. 2013, 1, 52–58. [Google Scholar]
- Ortiz, R.; Prados, J.; Melguizo, C.; Arias, J.L.; Ruiz, M.A.; Alvarez, P.J.; Caba, O.; Luque, R.; Segura, A.; Aránega, A. 5-fluorouracil-loaded poly(ε-caprolactone) nanoparticles combined with phage e gene therapy as a new strategy against colon cancer. Int. J. Nanomed. 2012, 7, 95–107. [Google Scholar]
- Wong, H.L.; Bendayan, R.; Rauth, A.M.; Xue, H.Y.; Babakhanian, K.; Wu, X.Y. A mechanistic study of enhanced doxorubicin uptake and retention in multidrug resistant breast cancer cells using a polymer-lipid hybrid nanoparticle system. J. Pharmacol. Exp. Ther. 2006, 317, 1372–1381. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Zhao, X.; Wang, H.; Zhao, R.; Ji, T.; Ren, H.; Anderson, G.J.; Nie, G.; Hao, J.J. Multiple layer-by-layer lipid-polymer hybrid nanoparticles for improved folfirinox chemotherapy in pancreatic tumor models. Adv. Funct. Mater. 2015, 25, 788–798. [Google Scholar] [CrossRef]
- Wong, H.L.; Rauth, A.M.; Bendayan, R.; Manias, J.L.; Ramaswamy, M.; Liu, Z.; Erhan, S.Z.; Wu, X.Y. A new polymer–lipid hybrid nanoparticle system increases cytotoxicity of doxorubicin against multidrug-resistant human breast cancer cells. Pharm. Res. 2006, 23, 1574–1585. [Google Scholar] [CrossRef]
- Zhong, Y.; Wang, C.; Cheng, R.; Cheng, L.; Meng, F.; Liu, Z.; Zhong, Z.J.J. Crgd-directed, nir-responsive and robust aunr/peg–pcl hybrid nanoparticles for targeted chemotherapy of glioblastoma in vivo. J. Control. Release 2014, 195, 63–71. [Google Scholar] [CrossRef]
- Takahashi, M.; Wakabayashi, K.J.C. Gene mutations and altered gene expression in azoxymethane-induced colon carcinogenesis in rodents. Cancer Sci. 2004, 95, 475–480. [Google Scholar] [CrossRef]
- Latif, Y.A.; El-Bana, M.; Hussein, J.; El-Khayat, Z.; Farrag, A.R.J. Effects of resveratrol in combination with 5-fluorouracil on n-methylnitrosourea-induced colon cancer in rats. Comp. Haematol. Int. 2019, 28, 1351–1362. [Google Scholar]
- Ryan, K.M.; Phillips, A.C.; Vousden, K.H. Regulation and function of the p53 tumor suppressor protein. Curr. Opin. Cell Biol. 2001, 13, 332–337. [Google Scholar] [CrossRef]
- Große, L.; Wurm, C.A.; Brüser, C.; Neumann, D.; Jans, D.C.; Jakobs, S. Bax assembles into large ring-like structures remodeling the mitochondrial outer membrane in apoptosis. EMBO J. 2016, 35, 402–413. [Google Scholar] [CrossRef] [PubMed]
- Cheng, M.; He, B.; Wan, T.; Zhu, W.; Han, J.; Zha, B.; Chen, H.; Yang, F.; Li, Q.; Wang, W.; et al. 5-fluorouracil nanoparticles inhibit hepatocellular carcinoma via activation of the p53 pathway in the orthotopic transplant mouse model. PLoS ONE 2012, 7, e47115. [Google Scholar] [CrossRef]
- Mohammad, O.; Faisal, S.M.; Ahmad, N.; Rauf, M.A.; Umar, M.S.; Mujeeb, A.A.; Pachauri, P.; Ahmed, A.; Kashif, M.; Ajmal, M.J. Bio-mediated synthesis of 5-fu based nanoparticles employing orange fruit juice: A novel drug delivery system to treat skin fibrosarcoma in model animals. Sci. Rep. 2019, 9, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Kong, L.; Wang, X.; Zhang, K.; Yuan, W.; Yang, Q.; Fan, J.; Wang, P.; Liu, Q. Gypenosides synergistically enhances the anti-tumor effect of 5-fluorouracil on colorectal cancer in vitro and in vivo: A role for oxidative stress-mediated DNA damage and p53 activation. PLoS ONE 2015, 10, e0137888. [Google Scholar] [CrossRef] [PubMed]
- Xavier, C.P.; Lima, C.F.; Rohde, M.; Pereira-Wilson, C. Quercetin enhances 5-fluorouracil-induced apoptosis in msi colorectal cancer cells through p53 modulation. Cancer Chemother. Pharmacol. 2011, 68, 1449–1457. [Google Scholar] [CrossRef]
- Can, G.; Akpinar, B.; Baran, Y.; Zhivotovsky, B.; Olsson, M. 5-fluorouracil signaling through a calcium–calmodulin-dependent pathway is required for p53 activation and apoptosis in colon carcinoma cells. Oncogene 2013, 32, 4529–4538. [Google Scholar] [CrossRef]
- Okada, K.; Hakata, S.; Terashima, J.; Gamou, T.; Habano, W.; Ozawa, S.J. Combination of the histone deacetylase inhibitor depsipeptide and 5-fluorouracil upregulates major histocompatibility complex class ii and p21 genes and activates caspase-3/7 in human colon cancer hct-116 cells. Oncol. Rep. 2016, 36, 1875–1885. [Google Scholar] [CrossRef]
- Schmoll, H.-J.; Twelves, C.; Sun, W.; O’Connell, M.J.; Cartwright, T.; McKenna, E.; Saif, M.; Lee, S.; Yothers, G.; Haller, D.J. Effect of adjuvant capecitabine or fluorouracil, with or without oxaliplatin, on survival outcomes in stage iii colon cancer and the effect of oxaliplatin on post-relapse survival: A pooled analysis of individual patient data from four randomised controlled trials. Lancet Oncol. 2014, 15, 1481–1492. [Google Scholar]
- Omwoyo, W.N.; Moloto, M.J. Encapsulation of ibuprofen into solid lipid nanoparticles for controlled and sustained release using emulsification solvent evaporation technique. Asian J. Pharm. Clin. Res. 2019. [Google Scholar] [CrossRef]
- Yoshizawa, Y.; Kono, Y.; Ogawara, K.-I.; Kimura, T.; Higaki, K.J.I. Peg liposomalization of paclitaxel improved its in vivo disposition and anti-tumor efficacy. Int. J. Pharm. 2011, 412, 132–141. [Google Scholar] [CrossRef]
- Cho, Y.-S.; Yoon, T.-J.; Jang, E.-S.; Hong, K.S.; Lee, S.Y.; Kim, O.R.; Park, C.; Kim, Y.-J.; Yi, G.-C.; Chang, K.J.C.L. Cetuximab-conjugated magneto-fluorescent silica nanoparticles for in vivo colon cancer targeting and imaging. Cancer Lett. 2010, 299, 63–71. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y. Controlled Delivery of Nanoparticles to the Colon for Tumour Targeting. Ph.D. Thesis, The University of Queensland, Brisbane, Australia, 2015. [Google Scholar]
Independent Variable | Levels | |||||
---|---|---|---|---|---|---|
Low Coded (−1) | Medium Coded (0) | High Coded (1) | ||||
Factor | Name | Units | Type | Low Actual | Medium Actual | High Actual |
X1 | PLGA conc. | mg in 100 mL | Numeric | 33.34 | 66.67 | 100 |
X2 | Lecithin conc. | mg in 100 mL | Numeric | 66.67 | 133.34 | 200 |
X3 | surfactant | % (w/v) | Numeric | 0.50 | 1.00 | 1.50 |
Dependent variables, Y1 = Particles size (nm); Y2 = % Entrapment efficiency. |
Target Gene | Primer Sequence: 5′-3′ | Gene Bank Accession Number |
---|---|---|
p53 | F: CTAGCTCCCATCACTTCATCCC R: AAATGCAGACAGGCTTTGCAG | NM_001127233.1 |
Caspase 3 | F: GAGCTTGGAACGGTACGCTA R: CCGTACCAGAGCGAGATGAC | NM_001284409.1 |
GAPDH | F: AGAGAGGCCCAGCTACTCG R: GGCACTGCACAAGAAGATGC | NM_008084.3 |
Run Formulation | PLGA | Lecithin | Surfactant | Particles Size | Entrapment | |
---|---|---|---|---|---|---|
Code | mg | mg | (%) | (nm) | (%) | |
X1 | X2 | X3 | Y1 | Y2 | ||
1 | PLNs-01 | −1 | −1 | 0 | 153 ± 0.50 | 59.1 ± 0.15 |
2 | PLNs-02 | 1 | −1 | 0 | 155 ± 1.00 | 71 ± 0.58 |
3 | PLNs-03 | −1 | 1 | 0 | 172 ± 0.76 | 61 ± 0.20 |
4 | PLNs-04 | 1 | 1 | 0 | 210 ± 1.53 | 65.5 ± 0.75 |
5 | PLNs-05 | −1 | 0 | −1 | 154 ± 1.00 | 58.7 ± 0.61 |
6 | PLNs-06 | 1 | 0 | −1 | 152 ± 0.58 | 67.5 ± 1.00 |
7 | PLNs-07 | −1 | 0 | 1 | 140 ± 1.00 | 60 ± 0.55 |
8 | PLNs-08 | 1 | 0 | 1 | 159 ± 1.00 | 69.3 ± 1.15 |
9 | PLNs-09 | 0 | −1 | −1 | 140 ± 0.58 | 74.2 ± 0.20 |
10 | PLNs-10 | 0 | 1 | −1 | 191 ± 1.00 | 72.1 ± 0.51 |
11 | PLNs-11 | 0 | −1 | 1 | 139 ± 0.58 | 75.6 ± 0.25 |
12 | PLNs-12 | 0 | 1 | 1 | 163 ± 1.53 | 72 ± 0.61 |
13 | PLNs-13 | 0 | 0 | 0 | 150 ± 0.58 | 73 ± 0.25 |
14 | PLNs-14 | 0 | 0 | 0 | 151 ± 1.00 | 72.7 ± 0.20 |
15 | PLNs-15 | 0 | 0 | 0 | 149 ± 0.58 | 73.4 ± 0.25 |
Name | Goal | Lower Limit | Upper Limit | Lower Weight | Upper Weight | Importance |
PLGA | Within range | 33.3 | 100 | 1 | 1 | 3 |
Lecithin | Within range | 66.7 | 200 | 1 | 1 | 3 |
Poloxamer 188 | Within range | 0.5 | 1.5 | 1 | 1 | 3 |
Particle size (nm) | Minimize | 139 | 210 | 1 | 1 | 1 |
EE% | Maximize | 58.7 | 75.6 | 1 | 1 | 5 |
Solutions | ||||||
Number | PLGA (mg in 100 mL) | Lecithin (mg in 100 mL) | Poloxamer 188(1% w/v) | Particle Size (nm) | EE % | Desirability |
Software result 1 | 72.1 | 86.8 | 1.5 | 139.089 | 75.6 | 1 |
Software result 2 | 67.5 | 69.9 | 1.5 | 141.145 | 75.6002 | 1 (selected) |
Software result 3 | 70.9 | 78.6 | 1.4 | 141.817 | 75.6 | 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
A. Attia, M.; Enan, E.T.; Hashish, A.A.; M. H. El-kannishy, S.; Gardouh, A.R.; K. Tawfik, M.; Faisal, S.; El-Mistekawy, A.; Salama, A.; Alomar, S.Y.; et al. Chemopreventive Effect of 5-Flurouracil Polymeric Hybrid PLGA-Lecithin Nanoparticles against Colon Dysplasia Model in Mice and Impact on p53 Apoptosis. Biomolecules 2021, 11, 109. https://doi.org/10.3390/biom11010109
A. Attia M, Enan ET, Hashish AA, M. H. El-kannishy S, Gardouh AR, K. Tawfik M, Faisal S, El-Mistekawy A, Salama A, Alomar SY, et al. Chemopreventive Effect of 5-Flurouracil Polymeric Hybrid PLGA-Lecithin Nanoparticles against Colon Dysplasia Model in Mice and Impact on p53 Apoptosis. Biomolecules. 2021; 11(1):109. https://doi.org/10.3390/biom11010109
Chicago/Turabian StyleA. Attia, Mohammed, Eman T. Enan, Abdullah A. Hashish, Sherif M. H. El-kannishy, Ahmed R. Gardouh, Mona K. Tawfik, Salwa Faisal, Amr El-Mistekawy, Ayman Salama, Suliman Y. Alomar, and et al. 2021. "Chemopreventive Effect of 5-Flurouracil Polymeric Hybrid PLGA-Lecithin Nanoparticles against Colon Dysplasia Model in Mice and Impact on p53 Apoptosis" Biomolecules 11, no. 1: 109. https://doi.org/10.3390/biom11010109
APA StyleA. Attia, M., Enan, E. T., Hashish, A. A., M. H. El-kannishy, S., Gardouh, A. R., K. Tawfik, M., Faisal, S., El-Mistekawy, A., Salama, A., Alomar, S. Y., H. Eltrawy, A., Yagub Aloyouni, S., & Zaitone, S. A. (2021). Chemopreventive Effect of 5-Flurouracil Polymeric Hybrid PLGA-Lecithin Nanoparticles against Colon Dysplasia Model in Mice and Impact on p53 Apoptosis. Biomolecules, 11(1), 109. https://doi.org/10.3390/biom11010109