Isolation and Identification of Alkaloid Genes from the Biomass of Fritillaria taipaiensis P.Y. Li
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples
2.2. Metabolomics Study
2.3. Transcriptomics Study
2.4. Data Analysis
3. Results
3.1. Chemical Constituents and Differential Metabolites
3.2. Transcriptome High-Throughput Sequencing Analysis
3.3. Genes Related to the Biosynthesis of Alkaloids in Biomass
3.4. qRT-PCR Validation of Candidate Genes and Determination of Four Alkaloid Components
4. Discussion
4.1. Relationship Between the Alkaloid Content and the Candidate Gene Transcription Level
4.2. Analysis of the Components of F. taipaiensis Using UPLC-Q-TOF-MS/MS Technology
4.3. Differences in the Medicinal Quality of F. taipaiensis from Different Regions
4.4. DEGs in the Samples from Different Regions
4.5. Discovery of Key Genes Involved in Differential Alkaloid Synthesis in F. taipaiensis from Different Regions
4.6. Differences in the Gene Expression of F. taipaiensis from Different Regions
4.7. Analysis of Systematic Signal Transduction Networks in F. taipaiensis from Different Regions
4.8. Functional Speculation of Key Genes Involved in Alkaloid Synthesis in F. taipaiensis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tang, X.; Zuo, M.; Li, Z.; Liu, H.; Xiong, C.X.; Zeng, X.H.; Sun, Y.; Hu, L.; Liu, S.J.; Lei, T.Z.; et al. Green processing of lignocellulosic biomass and its derivatives in deep eutectic solvents. Chemsuschem 2017, 10, 2696–2706. [Google Scholar] [CrossRef] [PubMed]
- Hajiali, F.; Jin, T.; Yang, G.; Santos, M.; Lam, E.; Moores, A. Mechanochemical Transformations of Biomass into Functional Materials. Chemsuschem 2022, 15, e202102535. [Google Scholar] [CrossRef] [PubMed]
- Antolini, E. Lignocellulose, cellulose and lignin as renewable alternative fuels for direct biomass fuel cells. Chemsuschem 2020, 14, 189–207. [Google Scholar] [CrossRef] [PubMed]
- Wang, A.W.; Liu, Y.M. Progress in the study of isosteroidal alkaloids and pharmacological activities. Nat. Prod. Res. Dev. 2022, 34, 164–175. [Google Scholar]
- Guerriero, G.; Hausman, J.F.; Strauss, J.; Ertan, H.; Siddiqui, K.S. Lignocellulosic biomass: Biosynthesis, degradation, and industrial utilization. Eng. Life Sci. 2016, 16, 1–6. [Google Scholar] [CrossRef]
- Fang, Z.T.; Jin, J.; Ye, Y.; He, W.Z.; Shu, Z.F.; Shao, J.N.; Fu, Z.S.; Lu, J.L.; Ye, J.H. Effects of Different Shading Treatments on the Biomass and Transcriptome Profiles of Tea Leaves (Camellia sinensis L.) and the Regulatory Effect on Phytohormone Biosynthesis. Front. Plant Sci. 2022, 13, 909765. [Google Scholar] [CrossRef]
- Maher, C.A.; Kumar-Sinha, C.; Cao, X.H.; Kalyana-Sundaram, S.; Han, B.; Jing, X.J.; Sam, L.; Barrette, T.; Palanisamy, N.; Chinnaiyan, A.M. Transcriptome sequencing to detect gene fusions in cancer. Nature 2009, 458, 97. [Google Scholar] [CrossRef]
- Franks, A.E.; Glaven, R.H.; Lovley, D.R. Real-Time Spatial Gene Expression Analysis within Current-Producing Biofilms. Chemsuschem 2012, 5, 1092–1098. [Google Scholar] [CrossRef]
- Kim, J.A.; Roy, N.S.; Lee, I.H.; Choi, A.Y.; Choi, B.S.; Yu, Y.S.; Park, N.I.; Park, K.C.; Kim, S.; Yang, H.S. Genome-wide transcriptome profiling of the medicinal plant Zanthoxylum planispinum using a single-molecule direct RNA sequencing approach. Genomics 2019, 111, 973–979. [Google Scholar] [CrossRef]
- Zhao, Q.; Li, R.; Zhang, Y.; Huang, K.J.; Wang, W.G.; Li, J. Transcriptome analysis reveals in vitro-cultured regeneration bulbs as a promising source for targeted Fritillaria cirrhosa steroidal alkaloid biosynthesis. 3 Biotech 2018, 8, 191. [Google Scholar] [CrossRef]
- Chinese Pharmacopoeia Commission. Pharmacopoeia of the People’s Republic of China, 1st ed.; China Medical Science Press: Beijing, China, 2015; p. 36. [Google Scholar]
- Hu, Z.; Zong, J.F.; Yili, M.; Yu, M.H.; Aisa, H.A.; Hou, A.J. Isosteroidal alkaloids from the bulbs of Fritillaria tortifolia. Fitoterapia 2018, 131, 112–118. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Xiao, M.T.; Li, J.; Zhao, Q.; Wang, M.C.; Zhu, Z.W. Transcriptome analysis of CYP450 family members in Fritillaria cirrhosa D. Don and profiling of key CYP450s related to isosteroidal alkaloid biosynthesis. Genes 2023, 14, 219. [Google Scholar] [CrossRef]
- Peng, W.; Li, Z.; Wang, S.; Wang, B.J. Unravelling the C-C and C-N coupling mechanism for the CYP96T1-catalyzed biosynthesis of Amaryllidaceae alkaloids. Mol. Catal. 2023, 550, 113609. [Google Scholar] [CrossRef]
- Jiao, C.Y.; Wei, M.K.; Fan, H.H.; Song, C.; Wang, Z.J.; Cai, Y.P.; Jin, Q. Transcriptomic analysis of genes related to alkaloid biosynthesis and the regulation mechanism under precursor and methyl jasmonate treatment in Dendrobium officinale. Front. Plant Sci. 2022, 13, 941231. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.T.; Hedhili, S.; Montiel, G.; Zhang, Y.X.; Chatel, G.; Pré, M.; Gantet, P.; Memelink, J. The basic helix-loop-helix transcription factor CrMYC2 controls the jasmonate-responsive expression of the ORCA genes that regulate alkaloid biosynthesis in Catharanthus roseus. Plant J. 2011, 67, 61–71. [Google Scholar] [CrossRef] [PubMed]
- Zhou, N.; Mu, M.J.; Yang, M.; Zhou, Y.; Ma, M.G. The effect of microbial fertilizer on the growth, rhizospheric environment and medicinal quality of Fritillaria taipaiensis. Horticulturae 2021, 7, 500. [Google Scholar] [CrossRef]
- Sheng, L.; Zhou, N.; Fu, S.Z.; Yi, D.Y.; Jia, H.; Chen, H.Y. Pharmacognostical study on cultivated Fritillaria taipaiensis. J. Chin. Med. Mater. 2014, 37, 45–49. [Google Scholar]
- Mu, M.J.; Zhang, G.D.; Zhang, H.; Yang, M.; Guo, D.Q.; Zhou, N. Correlation between rhizospheric microorganisms distribution and alkaloid content of Fritillaria taipaiensis. China J. Chin. Mater. Med. 2019, 4, 2331–2335. [Google Scholar]
- Zhang, M.R.; Fu, S.B.; Xie, H.M.; Xie, J.H.; Gong, P.Z.; Wang, S.; Ye, B.G. Comparative study on the content of isosteroid alkaloids in Fritillaria cirrhosa from different producing areas. W. China J. Pharm. 2022, 37, 67–74. [Google Scholar]
- Lu, Q.X.; Rui, L.; Liao, J.Q.; Hu, Y.Q.; Gao, Y.D.; Wang, M.C.; Li, J.; Zhao, Q. Integrative analysis of the steroidal alkaloids distribution and biosynthesis of bulbs Fritillariae Cirrhosae through metabolome and transcriptome analyse. BMC Genom. 2022, 23, 551. [Google Scholar] [CrossRef]
- Ma, B.; Ma, J.; Li, B.; Tao, Q.; Gao, J.; Yan, Z. Effects of different harvesting times and processing methods on the quality of cultivated Fritillaria cirrhosa D. Don. Food Sci. Nutr. 2021, 9, 2853–2861. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.C.; Lee, M.R.; Wu, C.R.; Ke, H.J.; Xie, H.M.; Tsay, H.S.; Agrawal, D.C.; Chang, H.C. LED Lights affecting morphogenesis and isosteroidal alkaloid contents in Fritillaria cirrhosa D. Don-an important Chinese medicinal herb. Plants 2020, 9, 1351. [Google Scholar] [CrossRef] [PubMed]
- Wang, A.W.; Liu, Y.M.; Zhu, M.M.; Ma, R.X. Isosteroidal alkaloids of Fritillaria taipaiensis and their implication to Alzheimer’s disease: Isolation, structural elucidation and biological activity. Phytochemistry 2022, 201, 113279. [Google Scholar] [CrossRef] [PubMed]
- Geng, Z.; Liu, Y.F.; Gou, Y.; Zhou, Q.M.; He, C.J.; Guo, L.; Zhou, J.; Xiong, L. Metabolomics study of cultivated bulbus Fritillariae cirrhosae at different growth stages using UHPLC-QTOF-MS coupled with multivariate data analysis. Phytochem. Anal. 2018, 29, 290–299. [Google Scholar] [CrossRef]
- Ge, S. Analysis of Chemical Constituents Differences Between Fritillaria cirrhosa D. Don and Fritillaria thunbergii and Its Metabolomics Based on UPLC-Q-TOF-MS/MS Technology. Master’s Thesis, Qinghai Normal University, Xining, China, 2022. [Google Scholar]
- Li, Y.B.; Zhang, L.; Wu, H.Y.; Wu, X.; Ju, L.; Zhang, Y.J. Metabolomic study to discriminate the different Bulbus fritillariae species using rapid resolution liquid chromatography-quadrupole time-of-flight mass spectrometry coupled with multivariate statistical analysis. Anal. Methods 2014, 6, 2247–2259. [Google Scholar] [CrossRef]
- Wu, J.L.; Zhang, X.B.; Hu, J.; Li, M.; Jing, Z.X.; Yuan, Q.; Li, S.Q.; Zhang, C.C. Quality of Fritillaria thunbergii Miq. regionalization based on compositional content and ecological factors. J. Zhejiang Chin. Med. Univ. 2021, 45, 835–841. [Google Scholar]
- Wang, Q.; Ding, Y.; Yang, M.; Guo, D.Q.; Huang, Y.; Zhang, C.T.; Pang, Y.F.; Zhou, N. Correlation analysis of quality origin and phenotypic characters of Paris polyphylla var. yunnanensis. China J. Chin. Mater. Med. 2019, 44, 3203–3212. [Google Scholar]
- Sun, X.; Qian, Q.Y.; Zheng, S.H.; Cheng, H.M.; Huang, L.F. Quality ecotype of Panax quinquefolium L. based on hereditychemistry-ecology characteristics. Acta Pharm. Sin. 2019, 54, 1695–1705. [Google Scholar]
- Hao, D.C.; Chen, S.L.; Xiao, P.G.; Liu, M. Application of high-throughput sequencing in medicinal plant transcriptome studies. Drug Develop. Res. 2013, 73, 487–498. [Google Scholar] [CrossRef]
- Liao, H.; Quan, H.G.; Huang, B.H.; Ji, H.Y.; Zhang, T.; Chen, J.; Zhou, J.Y. Integrated transcriptomic and metabolomic analysis reveals the molecular basis of tissue-specific accumulation of bioactive steroidal alkaloids in Fritillaria unibracteata. Phytochemistry 2023, 214, 113831. [Google Scholar] [CrossRef]
- Zhou, M.; Zheng, W.; Guo, B.L.; Chen, A.J.; Ma, B.P. Study on the quality of cultivated Epimedium brevicornu based on UHPLC-PDA-Q-TOF/MSE technique. J. Pharm. 2020, 55, 995–1003. [Google Scholar]
- Shuai, H.W.; Meng, Y.J.; Chen, F.; Zhou, W.G.; Luo, X.F.; Yang, W.Y. Hormonal signaling responses to plant shade stress. J. Bot. 2018, 53, 139–148. [Google Scholar]
- Zhang, H.; Mao, R.; Wang, Y.Z.; Zhang, L.; Wang, C.Y.; Lv, S.K.; Liu, X.L.; Wang, Y.J.; Ji, W.Q. Transcriptome-wide alternative splicing modulation during plant-pathogen interactions in wheat. Plant Sci. 2019, 288, 110160. [Google Scholar] [CrossRef]
- Liu, J.J.; Han, L.J.; Li, G.D.; Zhang, A.L.; Liu, X.L.; Zhao, M.Z. Transcriptome and metabolome profiling of the medicinal plant Veratrum mengtzeanum reveal key components of the alkaloid biosynthesis. Front. Genet. 2023, 14, 1023433. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Ashrita; Acharya, V.; Warghat, A.R. Comparative transcriptome analysis infers bulb derived in vitro cultures as a promising source for sipeimine biosynthesis in Fritillaria cirrhosa D. Don (Liliaceae, syn. Fritillaria roylei Hook.)-High value Himalayan medicinal herb. Phytochemistry 2021, 108, 112631. [Google Scholar] [CrossRef]
- Tholl, D. Biosynthesis and biological functions of terpenoids in plants. Adv. Biochem. Eng. Biotechnol. 2015, 148, 63–106. [Google Scholar]







| Sample Group | Collection Site | Latitude and Longitude | Elevation/m |
|---|---|---|---|
| WXY | Yinchangping, Hongchiba, Wuxi County, Chongqing | 31°37′46.30″ N/108°56′00.27″ E | 2105 |
| WX | Narrow Neck, Hongchiba Community, Wuxi County, Chongqing | 31°37′32.05″ N/108°57′20.71″ E | 1769 |
| FJ | Meng Yuan Medicine Valley, Xicao Village, Xinglong Town, Fengjie County, Chongqing | 30°45′47.47″ N/109°36′38.96″ E | 1915 |
| WS | Renziping, Lihe Village, Dangyang Township, Wushan County, Chongqing | 30°46′07.21″ N/109°36′33.99″ E | 1538 |
| CK | Xiaolongtan, Sihe Village, Mingzhong Township, Chengkou County, Chongqing | 31°41′14.08″ N/108°56′52.59″ E | 1562 |
| NL | Yangjiancao, Cuiyu Township, Ninglang County, Lijiang City, Yunnan Province | 27°31′04.91″ N/100°35′39.14″ E | 3372 |
| TB | Tangkou Village, Zuitou Township, Taibai County, Baoji City, Shaanxi Province | 34°03′25.82″ N/107°23′40.79″ E | 1625 |
| GY | Qinglin Village, Lijia Town, Chaotian District, Guangyuan City, Sichuan Province | 32°35′10.06″ N/106°13′17.34″ E | 1760 |
| Gene Name | KO Number | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Temperature (°C) |
|---|---|---|---|---|
| HMGS | K01641 | CCAACCTTGCGAGCGAATA | TTGTAGGGAGAATGGAACACGA | 59.60 |
| HMGR | K00021 | TGCGAGGCTCCTGGCTACT | CTTTGCTGGACCTGTTATACTTCA | 60.70 |
| TPS | K03527 | AGGATCAAATCACGGGAGGC | ATCAATCCTCCAAGTCGCCC | 59.82 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, N.; Mei, C.-M.; Chen, F.-G.; Zhao, Y.-W.; Ma, M.-G.; Li, W.-D. Isolation and Identification of Alkaloid Genes from the Biomass of Fritillaria taipaiensis P.Y. Li. Metabolites 2024, 14, 590. https://doi.org/10.3390/metabo14110590
Zhou N, Mei C-M, Chen F-G, Zhao Y-W, Ma M-G, Li W-D. Isolation and Identification of Alkaloid Genes from the Biomass of Fritillaria taipaiensis P.Y. Li. Metabolites. 2024; 14(11):590. https://doi.org/10.3390/metabo14110590
Chicago/Turabian StyleZhou, Nong, Chun-Mei Mei, Fu-Gui Chen, Yu-Wei Zhao, Ming-Guo Ma, and Wei-Dong Li. 2024. "Isolation and Identification of Alkaloid Genes from the Biomass of Fritillaria taipaiensis P.Y. Li" Metabolites 14, no. 11: 590. https://doi.org/10.3390/metabo14110590
APA StyleZhou, N., Mei, C.-M., Chen, F.-G., Zhao, Y.-W., Ma, M.-G., & Li, W.-D. (2024). Isolation and Identification of Alkaloid Genes from the Biomass of Fritillaria taipaiensis P.Y. Li. Metabolites, 14(11), 590. https://doi.org/10.3390/metabo14110590

